ID: 970764358

View in Genome Browser
Species Human (GRCh38)
Location 4:19529582-19529604
Sequence ATCCTGTTATTTGTGCAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970764357_970764358 -6 Left 970764357 4:19529565-19529587 CCATAAAAAATAATAAAATCCTG No data
Right 970764358 4:19529582-19529604 ATCCTGTTATTTGTGCAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970764358 Original CRISPR ATCCTGTTATTTGTGCAACA TGG Intergenic
No off target data available for this crispr