ID: 970775187

View in Genome Browser
Species Human (GRCh38)
Location 4:19666108-19666130
Sequence CAAAATTATTAAATGCAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970775186_970775187 -2 Left 970775186 4:19666087-19666109 CCATAACTTTTTGTCTTAAAACA No data
Right 970775187 4:19666108-19666130 CAAAATTATTAAATGCAGTCAGG No data
970775185_970775187 1 Left 970775185 4:19666084-19666106 CCTCCATAACTTTTTGTCTTAAA No data
Right 970775187 4:19666108-19666130 CAAAATTATTAAATGCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970775187 Original CRISPR CAAAATTATTAAATGCAGTC AGG Intergenic
No off target data available for this crispr