ID: 970775574

View in Genome Browser
Species Human (GRCh38)
Location 4:19670092-19670114
Sequence CTGGGAGAATGGAATCAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970775569_970775574 12 Left 970775569 4:19670057-19670079 CCAGATCTACATTTGATTGGTGT No data
Right 970775574 4:19670092-19670114 CTGGGAGAATGGAATCAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970775574 Original CRISPR CTGGGAGAATGGAATCAAGT TGG Intergenic
No off target data available for this crispr