ID: 970778103

View in Genome Browser
Species Human (GRCh38)
Location 4:19702028-19702050
Sequence GACACTTAACTCAGTACAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970778102_970778103 7 Left 970778102 4:19701998-19702020 CCTGTCTTTACAGAGTGTGCAGT No data
Right 970778103 4:19702028-19702050 GACACTTAACTCAGTACAAGAGG No data
970778101_970778103 8 Left 970778101 4:19701997-19702019 CCCTGTCTTTACAGAGTGTGCAG No data
Right 970778103 4:19702028-19702050 GACACTTAACTCAGTACAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970778103 Original CRISPR GACACTTAACTCAGTACAAG AGG Intergenic
No off target data available for this crispr