ID: 970779270

View in Genome Browser
Species Human (GRCh38)
Location 4:19716255-19716277
Sequence AACCTTTCACAGATGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970779270_970779275 26 Left 970779270 4:19716255-19716277 CCCTGCTCCATCTGTGAAAGGTT No data
Right 970779275 4:19716304-19716326 AGGCAGAGTGCAAGTTTGGCAGG No data
970779270_970779274 22 Left 970779270 4:19716255-19716277 CCCTGCTCCATCTGTGAAAGGTT No data
Right 970779274 4:19716300-19716322 AAAGAGGCAGAGTGCAAGTTTGG No data
970779270_970779273 6 Left 970779270 4:19716255-19716277 CCCTGCTCCATCTGTGAAAGGTT No data
Right 970779273 4:19716284-19716306 ATGTTCTTGCAGATGCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970779270 Original CRISPR AACCTTTCACAGATGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr