ID: 970789522

View in Genome Browser
Species Human (GRCh38)
Location 4:19840209-19840231
Sequence CATCCAAGAGAGCAAGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970789522_970789524 -7 Left 970789522 4:19840209-19840231 CCTCCATCTTGCTCTCTTGGATG No data
Right 970789524 4:19840225-19840247 TTGGATGCTCTCCTGCCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970789522 Original CRISPR CATCCAAGAGAGCAAGATGG AGG (reversed) Intergenic