ID: 970789522 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:19840209-19840231 |
| Sequence | CATCCAAGAGAGCAAGATGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 970789522_970789524 | -7 | Left | 970789522 | 4:19840209-19840231 | CCTCCATCTTGCTCTCTTGGATG | No data | ||
| Right | 970789524 | 4:19840225-19840247 | TTGGATGCTCTCCTGCCCTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 970789522 | Original CRISPR | CATCCAAGAGAGCAAGATGG AGG (reversed) | Intergenic | ||