ID: 970789523

View in Genome Browser
Species Human (GRCh38)
Location 4:19840212-19840234
Sequence GAGCATCCAAGAGAGCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970789523_970789524 -10 Left 970789523 4:19840212-19840234 CCATCTTGCTCTCTTGGATGCTC No data
Right 970789524 4:19840225-19840247 TTGGATGCTCTCCTGCCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970789523 Original CRISPR GAGCATCCAAGAGAGCAAGA TGG (reversed) Intergenic