ID: 970789524

View in Genome Browser
Species Human (GRCh38)
Location 4:19840225-19840247
Sequence TTGGATGCTCTCCTGCCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970789517_970789524 30 Left 970789517 4:19840172-19840194 CCACTAGAATGAGTTTCTGATAA No data
Right 970789524 4:19840225-19840247 TTGGATGCTCTCCTGCCCTTTGG No data
970789522_970789524 -7 Left 970789522 4:19840209-19840231 CCTCCATCTTGCTCTCTTGGATG No data
Right 970789524 4:19840225-19840247 TTGGATGCTCTCCTGCCCTTTGG No data
970789523_970789524 -10 Left 970789523 4:19840212-19840234 CCATCTTGCTCTCTTGGATGCTC No data
Right 970789524 4:19840225-19840247 TTGGATGCTCTCCTGCCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970789524 Original CRISPR TTGGATGCTCTCCTGCCCTT TGG Intergenic