ID: 970789524 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:19840225-19840247 |
| Sequence | TTGGATGCTCTCCTGCCCTT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 970789517_970789524 | 30 | Left | 970789517 | 4:19840172-19840194 | CCACTAGAATGAGTTTCTGATAA | No data | ||
| Right | 970789524 | 4:19840225-19840247 | TTGGATGCTCTCCTGCCCTTTGG | No data | ||||
| 970789522_970789524 | -7 | Left | 970789522 | 4:19840209-19840231 | CCTCCATCTTGCTCTCTTGGATG | No data | ||
| Right | 970789524 | 4:19840225-19840247 | TTGGATGCTCTCCTGCCCTTTGG | No data | ||||
| 970789523_970789524 | -10 | Left | 970789523 | 4:19840212-19840234 | CCATCTTGCTCTCTTGGATGCTC | No data | ||
| Right | 970789524 | 4:19840225-19840247 | TTGGATGCTCTCCTGCCCTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 970789524 | Original CRISPR | TTGGATGCTCTCCTGCCCTT TGG | Intergenic | ||