ID: 970798441

View in Genome Browser
Species Human (GRCh38)
Location 4:19943753-19943775
Sequence GTTGCCCAAAACTGTAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970798441_970798443 22 Left 970798441 4:19943753-19943775 CCCACACTACAGTTTTGGGCAAC No data
Right 970798443 4:19943798-19943820 ACACTCCCTTTATTTAAAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970798441 Original CRISPR GTTGCCCAAAACTGTAGTGT GGG (reversed) Intergenic