ID: 970806827

View in Genome Browser
Species Human (GRCh38)
Location 4:20046333-20046355
Sequence CACGGATTCCTGCTTCTCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970806827_970806832 26 Left 970806827 4:20046333-20046355 CCAGCGAGAAGCAGGAATCCGTG No data
Right 970806832 4:20046382-20046404 AGATAACAGGATGACATAAAAGG No data
970806827_970806831 13 Left 970806827 4:20046333-20046355 CCAGCGAGAAGCAGGAATCCGTG No data
Right 970806831 4:20046369-20046391 TCATAGGGCTAAGAGATAACAGG No data
970806827_970806833 27 Left 970806827 4:20046333-20046355 CCAGCGAGAAGCAGGAATCCGTG No data
Right 970806833 4:20046383-20046405 GATAACAGGATGACATAAAAGGG No data
970806827_970806830 -2 Left 970806827 4:20046333-20046355 CCAGCGAGAAGCAGGAATCCGTG No data
Right 970806830 4:20046354-20046376 TGAAAATAGCATAAATCATAGGG No data
970806827_970806829 -3 Left 970806827 4:20046333-20046355 CCAGCGAGAAGCAGGAATCCGTG No data
Right 970806829 4:20046353-20046375 GTGAAAATAGCATAAATCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970806827 Original CRISPR CACGGATTCCTGCTTCTCGC TGG (reversed) Intergenic
No off target data available for this crispr