ID: 970808258

View in Genome Browser
Species Human (GRCh38)
Location 4:20061219-20061241
Sequence CTCCAGGTGACCCTTGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970808258_970808268 25 Left 970808258 4:20061219-20061241 CCAGGCACAAGGGTCACCTGGAG No data
Right 970808268 4:20061267-20061289 GGACAGCACCTGAGCTGCAGAGG No data
970808258_970808264 4 Left 970808258 4:20061219-20061241 CCAGGCACAAGGGTCACCTGGAG No data
Right 970808264 4:20061246-20061268 TTAAAACCAGGTGGGCCTGCCGG No data
970808258_970808263 -4 Left 970808258 4:20061219-20061241 CCAGGCACAAGGGTCACCTGGAG No data
Right 970808263 4:20061238-20061260 GGAGGAAATTAAAACCAGGTGGG No data
970808258_970808262 -5 Left 970808258 4:20061219-20061241 CCAGGCACAAGGGTCACCTGGAG No data
Right 970808262 4:20061237-20061259 TGGAGGAAATTAAAACCAGGTGG No data
970808258_970808260 -8 Left 970808258 4:20061219-20061241 CCAGGCACAAGGGTCACCTGGAG No data
Right 970808260 4:20061234-20061256 ACCTGGAGGAAATTAAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970808258 Original CRISPR CTCCAGGTGACCCTTGTGCC TGG (reversed) Intergenic
No off target data available for this crispr