ID: 970815577

View in Genome Browser
Species Human (GRCh38)
Location 4:20152177-20152199
Sequence AGTGTAGATCTCAGATCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970815577_970815582 25 Left 970815577 4:20152177-20152199 CCTTCAGATCTGAGATCTACACT No data
Right 970815582 4:20152225-20152247 CAGTACCAATTAACTCCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970815577 Original CRISPR AGTGTAGATCTCAGATCTGA AGG (reversed) Intergenic