ID: 970815582

View in Genome Browser
Species Human (GRCh38)
Location 4:20152225-20152247
Sequence CAGTACCAATTAACTCCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970815578_970815582 -1 Left 970815578 4:20152203-20152225 CCTCCCTAGTCTAAATCCTAGAC No data
Right 970815582 4:20152225-20152247 CAGTACCAATTAACTCCCTTAGG No data
970815577_970815582 25 Left 970815577 4:20152177-20152199 CCTTCAGATCTGAGATCTACACT No data
Right 970815582 4:20152225-20152247 CAGTACCAATTAACTCCCTTAGG No data
970815579_970815582 -4 Left 970815579 4:20152206-20152228 CCCTAGTCTAAATCCTAGACAGT No data
Right 970815582 4:20152225-20152247 CAGTACCAATTAACTCCCTTAGG No data
970815580_970815582 -5 Left 970815580 4:20152207-20152229 CCTAGTCTAAATCCTAGACAGTA No data
Right 970815582 4:20152225-20152247 CAGTACCAATTAACTCCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970815582 Original CRISPR CAGTACCAATTAACTCCCTT AGG Intergenic