ID: 970816893

View in Genome Browser
Species Human (GRCh38)
Location 4:20167382-20167404
Sequence AATAAAAGACAGAAGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970816891_970816893 9 Left 970816891 4:20167350-20167372 CCTTATGCAGGACTGGAATTAGA No data
Right 970816893 4:20167382-20167404 AATAAAAGACAGAAGATGGATGG No data
970816888_970816893 25 Left 970816888 4:20167334-20167356 CCATAACAAACTTCTACCTTATG No data
Right 970816893 4:20167382-20167404 AATAAAAGACAGAAGATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970816893 Original CRISPR AATAAAAGACAGAAGATGGA TGG Intergenic
No off target data available for this crispr