ID: 970817878

View in Genome Browser
Species Human (GRCh38)
Location 4:20179209-20179231
Sequence CTGGCTCTCGGGTGCTGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970817878_970817884 -5 Left 970817878 4:20179209-20179231 CCAGCGCAGCACCCGAGAGCCAG No data
Right 970817884 4:20179227-20179249 GCCAGCACTGCTAGGGGACCTGG No data
970817878_970817887 16 Left 970817878 4:20179209-20179231 CCAGCGCAGCACCCGAGAGCCAG No data
Right 970817887 4:20179248-20179270 GGCACACCCTCCGCAGCTGCTGG 0: 23
1: 137
2: 331
3: 558
4: 802
970817878_970817888 21 Left 970817878 4:20179209-20179231 CCAGCGCAGCACCCGAGAGCCAG No data
Right 970817888 4:20179253-20179275 ACCCTCCGCAGCTGCTGGCCCGG 0: 187
1: 509
2: 468
3: 221
4: 305
970817878_970817890 22 Left 970817878 4:20179209-20179231 CCAGCGCAGCACCCGAGAGCCAG No data
Right 970817890 4:20179254-20179276 CCCTCCGCAGCTGCTGGCCCGGG 0: 187
1: 583
2: 609
3: 350
4: 868

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970817878 Original CRISPR CTGGCTCTCGGGTGCTGCGC TGG (reversed) Intergenic
No off target data available for this crispr