ID: 970820267

View in Genome Browser
Species Human (GRCh38)
Location 4:20204175-20204197
Sequence CAGTAGGACTGGATGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970820263_970820267 -5 Left 970820263 4:20204157-20204179 CCTGTGGGGAAGTGAGGTCAGTA No data
Right 970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG No data
970820257_970820267 12 Left 970820257 4:20204140-20204162 CCTGCACTAGGGAGTACCCTGTG No data
Right 970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG No data
970820262_970820267 -4 Left 970820262 4:20204156-20204178 CCCTGTGGGGAAGTGAGGTCAGT No data
Right 970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970820267 Original CRISPR CAGTAGGACTGGATGGAAGA AGG Intergenic
No off target data available for this crispr