ID: 970820278

View in Genome Browser
Species Human (GRCh38)
Location 4:20204285-20204307
Sequence GGACTGTCCCTACCCAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970820278_970820288 0 Left 970820278 4:20204285-20204307 CCAGTTTTGGGTAGGGACAGTCC No data
Right 970820288 4:20204308-20204330 TTGGGAGGGGACTAACTTGGGGG No data
970820278_970820289 21 Left 970820278 4:20204285-20204307 CCAGTTTTGGGTAGGGACAGTCC No data
Right 970820289 4:20204329-20204351 GGACAGAGTACCCTTAAACTAGG No data
970820278_970820290 22 Left 970820278 4:20204285-20204307 CCAGTTTTGGGTAGGGACAGTCC No data
Right 970820290 4:20204330-20204352 GACAGAGTACCCTTAAACTAGGG No data
970820278_970820287 -1 Left 970820278 4:20204285-20204307 CCAGTTTTGGGTAGGGACAGTCC No data
Right 970820287 4:20204307-20204329 CTTGGGAGGGGACTAACTTGGGG No data
970820278_970820286 -2 Left 970820278 4:20204285-20204307 CCAGTTTTGGGTAGGGACAGTCC No data
Right 970820286 4:20204306-20204328 CCTTGGGAGGGGACTAACTTGGG No data
970820278_970820284 -3 Left 970820278 4:20204285-20204307 CCAGTTTTGGGTAGGGACAGTCC No data
Right 970820284 4:20204305-20204327 TCCTTGGGAGGGGACTAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970820278 Original CRISPR GGACTGTCCCTACCCAAAAC TGG (reversed) Intergenic
No off target data available for this crispr