ID: 970820288

View in Genome Browser
Species Human (GRCh38)
Location 4:20204308-20204330
Sequence TTGGGAGGGGACTAACTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970820278_970820288 0 Left 970820278 4:20204285-20204307 CCAGTTTTGGGTAGGGACAGTCC No data
Right 970820288 4:20204308-20204330 TTGGGAGGGGACTAACTTGGGGG No data
970820273_970820288 17 Left 970820273 4:20204268-20204290 CCTTCAGAAATCATGGACCAGTT No data
Right 970820288 4:20204308-20204330 TTGGGAGGGGACTAACTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970820288 Original CRISPR TTGGGAGGGGACTAACTTGG GGG Intergenic
No off target data available for this crispr