ID: 970820290

View in Genome Browser
Species Human (GRCh38)
Location 4:20204330-20204352
Sequence GACAGAGTACCCTTAAACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970820278_970820290 22 Left 970820278 4:20204285-20204307 CCAGTTTTGGGTAGGGACAGTCC No data
Right 970820290 4:20204330-20204352 GACAGAGTACCCTTAAACTAGGG No data
970820285_970820290 1 Left 970820285 4:20204306-20204328 CCTTGGGAGGGGACTAACTTGGG No data
Right 970820290 4:20204330-20204352 GACAGAGTACCCTTAAACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970820290 Original CRISPR GACAGAGTACCCTTAAACTA GGG Intergenic
No off target data available for this crispr