ID: 970822723

View in Genome Browser
Species Human (GRCh38)
Location 4:20237689-20237711
Sequence TGTTCCTTGTAGAAGACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970822723_970822726 -5 Left 970822723 4:20237689-20237711 CCCTCAGTCTTCTACAAGGAACA No data
Right 970822726 4:20237707-20237729 GAACACACTCTCTTGGATAGAGG No data
970822723_970822729 29 Left 970822723 4:20237689-20237711 CCCTCAGTCTTCTACAAGGAACA No data
Right 970822729 4:20237741-20237763 GGCTTCGCATTAGATTATATAGG No data
970822723_970822727 8 Left 970822723 4:20237689-20237711 CCCTCAGTCTTCTACAAGGAACA No data
Right 970822727 4:20237720-20237742 TGGATAGAGGTCCTCAAACTTGG No data
970822723_970822730 30 Left 970822723 4:20237689-20237711 CCCTCAGTCTTCTACAAGGAACA No data
Right 970822730 4:20237742-20237764 GCTTCGCATTAGATTATATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970822723 Original CRISPR TGTTCCTTGTAGAAGACTGA GGG (reversed) Intergenic
No off target data available for this crispr