ID: 970823289

View in Genome Browser
Species Human (GRCh38)
Location 4:20244443-20244465
Sequence TCTCACATAGTGCTAGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970823289_970823293 -5 Left 970823289 4:20244443-20244465 CCCACTCCTAGCACTATGTGAGA No data
Right 970823293 4:20244461-20244483 TGAGATAGAAAGAAAACTCAGGG No data
970823289_970823292 -6 Left 970823289 4:20244443-20244465 CCCACTCCTAGCACTATGTGAGA No data
Right 970823292 4:20244460-20244482 GTGAGATAGAAAGAAAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970823289 Original CRISPR TCTCACATAGTGCTAGGAGT GGG (reversed) Intergenic
No off target data available for this crispr