ID: 970825937

View in Genome Browser
Species Human (GRCh38)
Location 4:20274667-20274689
Sequence CTGTGGATTTCACACTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970825937 Original CRISPR CTGTGGATTTCACACTCAGA AGG (reversed) Intronic
902531728 1:17094850-17094872 CTGTGGAGTTCATTCTCATATGG + Intronic
905861624 1:41355761-41355783 CTGTGAACATCACCCTCAGATGG + Intergenic
906263962 1:44414549-44414571 TTATGGCTTTGACACTCAGAGGG - Intronic
906934716 1:50203271-50203293 CTGTTGTTTTCACACTGAAAAGG + Intronic
910146117 1:84081925-84081947 CTGTGGATTTGAAAGTCAGTAGG + Intronic
910754511 1:90673194-90673216 CTGTGAATTCAACACTCAGGTGG + Intergenic
912758141 1:112342041-112342063 CTTTGGATTTCATTCTCAGTGGG + Intergenic
912891746 1:113540409-113540431 CTCTGGAGTCCACACTAAGAAGG - Intronic
917974799 1:180231603-180231625 CTGTGGCTTGCACGCTCAGCAGG + Intronic
922978775 1:229806992-229807014 ATTTTTATTTCACACTCAGAAGG + Intergenic
923349972 1:233094793-233094815 CTGTGGTTTACACACACTGATGG + Intronic
1064005371 10:11695043-11695065 CTGAGGACTTCTGACTCAGATGG - Intergenic
1064379930 10:14832416-14832438 CTCTGGATGTCACTCTGAGAAGG + Intronic
1064560782 10:16593716-16593738 CTTGGGATTTCACACTCACTGGG + Intronic
1065794598 10:29294229-29294251 CTGGGTTTTTCACACTCAGATGG - Intronic
1066046169 10:31597391-31597413 ATCTGAATTTCACAGTCAGATGG + Intergenic
1070956761 10:80469028-80469050 CTGTGCACTGCACACCCAGAGGG - Intronic
1072800789 10:98390948-98390970 CTGGAGGTTTCTCACTCAGATGG + Intronic
1073075611 10:100824311-100824333 CTGTGCATTCCAAACCCAGATGG - Intronic
1075973070 10:126671787-126671809 CTTTGCATGTCACACTCAGCAGG + Intergenic
1076602572 10:131668346-131668368 CAGTGGACTTCCCACTTAGAAGG + Intergenic
1078460607 11:11512413-11512435 CTCTGGATTTCACTCAGAGATGG + Intronic
1085420797 11:76357248-76357270 CTGTGGATTTTGCTCTCTGAGGG + Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1089665493 11:120015400-120015422 GAGGTGATTTCACACTCAGAAGG - Intergenic
1090665202 11:128910425-128910447 CTGCAGACTTCACACTCAGACGG + Intronic
1096430251 12:51537351-51537373 CTGTGGATTTCACCATCTGTCGG - Intergenic
1096960167 12:55569598-55569620 CTCTGGATTTCAAACTTACATGG - Intergenic
1097468892 12:59963738-59963760 CTGTGCCTTTTACAATCAGAAGG + Intergenic
1098090560 12:66896318-66896340 CTGTGGATTGCACACACACAAGG - Intergenic
1106101106 13:26695684-26695706 CTGTGGCTTTCACACTTAGGTGG + Intergenic
1106428192 13:29654051-29654073 CAGTAGCTTTCAAACTCAGAGGG + Intergenic
1109116229 13:58390053-58390075 TTGTGCATTTCACACTTAGAAGG + Intergenic
1111957844 13:94777499-94777521 CTGTGGCTATCACATTCAAAGGG - Intergenic
1114704484 14:24711424-24711446 CTTTGAAGTTCACACTCACAGGG - Intergenic
1117255511 14:53973198-53973220 TTGTCTATTTAACACTCAGAGGG - Intergenic
1121219068 14:92272245-92272267 TTGCAGATTACACACTCAGATGG + Intergenic
1124409011 15:29420289-29420311 CTGTGGATGTCATACTGTGAGGG - Intronic
1128672360 15:69583782-69583804 CTGTGGAAGTCACACTCTGTAGG + Intergenic
1128907845 15:71484116-71484138 CTCAGGATTTGAAACTCAGATGG + Intronic
1129977563 15:79834926-79834948 CTGGGCATTTGACACACAGAAGG + Intronic
1130073366 15:80667757-80667779 CTAGTTATTTCACACTCAGATGG + Intergenic
1131222574 15:90597345-90597367 TTGTGGATGACACGCTCAGAAGG + Intronic
1131227889 15:90640344-90640366 CTTTCCTTTTCACACTCAGAAGG - Intronic
1132840252 16:1975386-1975408 CTGGGGACTTCACACCCAGCTGG - Exonic
1133845819 16:9452899-9452921 CTCAGGATTGCACACTCAGTAGG - Intergenic
1135292957 16:21255878-21255900 CTGTAGATGCCACACTCAAAAGG - Intronic
1135639345 16:24107571-24107593 CTGTGCATCTCAAAGTCAGAAGG + Intronic
1135862382 16:26068528-26068550 GTGTGGACTTCAAAGTCAGATGG - Intronic
1138068591 16:53967702-53967724 CTGTGGGTTTTACACTAAAAAGG + Intronic
1141631513 16:85290502-85290524 CTGTGGAATGAACACACAGAAGG - Intergenic
1148436398 17:47689280-47689302 CTGTGGAGCTCACATTCTGATGG + Intergenic
1149416050 17:56461053-56461075 CTGTGGGTTCCACACTTACAGGG - Intronic
1151164173 17:72189971-72189993 CTGTGGATGTGAGAGTCAGAGGG - Intergenic
1152202391 17:78954651-78954673 CAGTGGATTTTACACTCATGTGG + Intergenic
1156712722 18:39966209-39966231 CAGTGGATGTCACACACTGAGGG - Intergenic
1157976501 18:52333705-52333727 CTTTGGATTTCTCACTTATAGGG - Intergenic
1160473311 18:79159405-79159427 CTGTAGAGTTCCAACTCAGAAGG + Intronic
1160488983 18:79320752-79320774 CTGTGGGTTTTACACTGGGAGGG + Intronic
1160554349 18:79716422-79716444 CTGGCTATTTCACACTGAGATGG - Intronic
1160733997 19:653530-653552 CTGTGGATCTCACACTGCAACGG + Intronic
1161139795 19:2640486-2640508 CTGTAGATTTCACACAAGGAGGG - Intronic
1161431765 19:4236672-4236694 CTGTGGATGTCTCACCCAGGAGG - Intronic
1166271571 19:41717664-41717686 TTCTGGATTCCACACTCATAGGG - Exonic
1166405946 19:42521971-42521993 TTCTGTATTTCACACTCATAGGG + Exonic
927442767 2:23130958-23130980 CAGGGGAATTCACACTTAGAGGG + Intergenic
929612232 2:43279619-43279641 TTGTGGCTTTCCCACTAAGATGG + Intronic
929909434 2:46076390-46076412 CCGTGGCTTTCACACACAGATGG + Intronic
932291232 2:70581736-70581758 CTGTGGATGTCACACAGAGATGG + Intergenic
935123941 2:100206208-100206230 TTGTGGATGGCACACACAGATGG - Intergenic
935201209 2:100858178-100858200 CTGTAGCTTTCACAGTGAGAAGG - Intronic
935411184 2:102765225-102765247 CTGTAGATTTCAGACTCACCAGG - Intronic
937904833 2:127047947-127047969 CTGTGGCTTTCTTACTGAGATGG - Intergenic
938556789 2:132431722-132431744 GTGTGGACTTCACATTCAGTGGG + Intronic
938824515 2:134991712-134991734 CTGTGGAATTCACACAGAGGTGG + Intronic
939037465 2:137149690-137149712 CTGTGGATTTCAGACTTGCATGG + Intronic
940908757 2:159191858-159191880 CTGTGGTTTTCACATTTAGTGGG + Intronic
941179760 2:162244874-162244896 CTGAGGATTTCACAATCACTTGG - Intronic
941347667 2:164390054-164390076 CTTTGGATTTCGGACACAGATGG + Intergenic
941686515 2:168454207-168454229 CAGTGGATTTAAGAGTCAGAAGG + Intergenic
941824797 2:169883196-169883218 CTGAGGGCTTCACACTGAGACGG + Intronic
942635835 2:178004486-178004508 CTGGGGATTTCAAATTAAGATGG - Intronic
944340943 2:198598235-198598257 CTCTGGATTTCTAACTAAGAAGG + Intergenic
944479935 2:200145978-200146000 CTGTGGAACTCACACTCAGGTGG + Intergenic
944681136 2:202077886-202077908 CTGTTGTTTTCATAGTCAGATGG - Intronic
944691092 2:202159147-202159169 CTGTGGATTTCACATACAACAGG + Intronic
946483371 2:220077744-220077766 GGGTGGATTTTACACCCAGATGG + Intergenic
946638690 2:221759065-221759087 CTGTGTATTACACAGTGAGAGGG - Intergenic
1169435083 20:5579938-5579960 CTGTAGATTTCAGACTCAATTGG - Intronic
1170587406 20:17745233-17745255 CAGTGGATTTCAGGCTCAGCTGG - Intergenic
1171884784 20:30644048-30644070 CTGTAGTTTTCACCCACAGAGGG + Intergenic
1172843961 20:37918752-37918774 CTGAGGTTTGCACAGTCAGAGGG - Intronic
1173946047 20:46951773-46951795 GTGTGGATTTCAGGATCAGATGG + Intronic
1174094948 20:48080948-48080970 CCGTGCCTTTCACATTCAGAAGG - Intergenic
1174751141 20:53112340-53112362 CACAGGATTTCACTCTCAGAAGG - Intronic
1175201771 20:57283066-57283088 CTGTGGAGTTCACCCTCAGTAGG - Intergenic
1175725249 20:61313548-61313570 GCGTGGATTTCACGATCAGACGG + Intronic
1176688970 21:9881419-9881441 CTCTGGATTTCACACTTGCATGG - Intergenic
1177431420 21:20996917-20996939 CTGGGGATTTCACGCTGAAAAGG - Intergenic
1179188818 21:39106508-39106530 CTCTGGAATTCCCACTCAAATGG - Intergenic
1182000365 22:26914893-26914915 CTGTGGGGTTTACACTCAGTGGG + Intergenic
1184589983 22:45475675-45475697 CTGCAGATTTTACATTCAGAAGG + Intergenic
1184972029 22:48029862-48029884 CCGTGATTTTCACAGTCAGATGG - Intergenic
949818338 3:8086837-8086859 CTGTTCATTGCACTCTCAGAAGG + Intergenic
950458771 3:13108639-13108661 CTCAGGATTCCAAACTCAGAGGG - Intergenic
951350240 3:21598349-21598371 CTGTGGATTTTTCACTCATTAGG - Intronic
951583728 3:24193397-24193419 CTGTGGATCTCAAACTCTGTTGG - Intronic
951687856 3:25364443-25364465 ATGTGGGCTTCACACTCAGGAGG + Intronic
952053171 3:29411068-29411090 CTGGGGATTTCAATCTGAGATGG - Intronic
954039687 3:47875622-47875644 CTGTCTATCTGACACTCAGAGGG + Intronic
954954551 3:54507894-54507916 CTGAGGATTGAACACTTAGAGGG + Intronic
954957053 3:54530419-54530441 CTGTGTTTTTCCCACTCCGAAGG + Intronic
958109621 3:89123538-89123560 CTGTTGATTTGACTTTCAGATGG - Intronic
958710640 3:97713040-97713062 TTGTGTATTTCATAATCAGATGG + Intronic
960670314 3:120149077-120149099 TTGAGGTTTTAACACTCAGATGG - Intergenic
960767826 3:121156899-121156921 CTGTGGATTTTAGAATCTGAGGG + Intronic
964457968 3:156889451-156889473 ATTTGGATTTCTCTCTCAGAAGG + Intronic
965023842 3:163271860-163271882 ATGTGGATTTCTCACTAAAATGG - Intergenic
968520320 4:1032126-1032148 CTGTGGCTTTCACACGCTGACGG - Intergenic
969789732 4:9484441-9484463 CTCTGGATTTCATCTTCAGATGG + Intergenic
970825937 4:20274667-20274689 CTGTGGATTTCACACTCAGAAGG - Intronic
973368432 4:49226331-49226353 CTGTAGTTTTCACCCACAGAGGG + Intergenic
973392615 4:49569094-49569116 CTGTAGTTTTCACCCACAGAGGG - Intergenic
973570010 4:52229063-52229085 ATGTGTATTTCATATTCAGAAGG - Intergenic
976439802 4:85060224-85060246 TTCTGTATTTCATACTCAGAAGG + Intergenic
977976266 4:103270278-103270300 CTCAGGATTTCAGACTCAGAAGG - Intergenic
980254528 4:130361262-130361284 CTGATGACTTCACTCTCAGAAGG - Intergenic
980352355 4:131699237-131699259 CTCTGGATTTCACACTTGCATGG - Intergenic
982217604 4:153095599-153095621 CTGTGGAGTTCACTTTCACAAGG + Intergenic
985660015 5:1152331-1152353 CTGTGGCTTCTACACTCAGTTGG - Intergenic
986742078 5:10713118-10713140 CTGTGGAGTTCATCCTGAGAGGG - Intronic
987167563 5:15216952-15216974 ATTTGGATTTTACTCTCAGATGG + Intergenic
988334817 5:29893469-29893491 CTGTGGATCTCACACTTTGCTGG + Intergenic
989187505 5:38639252-38639274 CTGTGCATTTCCCAGTCAGTAGG + Intergenic
992877201 5:81068719-81068741 CTGAGAAGTTCACACTCTGAGGG - Intronic
994892272 5:105651446-105651468 CTGGGCATTTCACTGTCAGAAGG - Intergenic
996246509 5:121271021-121271043 CTCTGGATTTCAGACTTACATGG - Intergenic
996699716 5:126438067-126438089 CTGTGCTTTTCAGCCTCAGAGGG + Intronic
998063930 5:139141145-139141167 CTGTGGAGCTCCCAGTCAGATGG - Intronic
998932021 5:147191492-147191514 GTGTGGGTTTTACAGTCAGATGG + Intergenic
1000403662 5:160862400-160862422 CTGTGGATTTCACACTTACCTGG + Intergenic
1000659572 5:163920806-163920828 CAGTGGATTTCAGACTTACATGG + Intergenic
1000725888 5:164770202-164770224 CTTTGGATTACACACTGATATGG - Intergenic
1001780171 5:174361481-174361503 CTATGGATTTCAGACCCAAAAGG - Intergenic
1003564177 6:7208511-7208533 CTGGGGATTTCACCCTGAAATGG + Intronic
1004835954 6:19531752-19531774 CTGAGGCTTTCAGACTTAGACGG + Intergenic
1008863564 6:56181525-56181547 CAGTGGTTTTCACTCTAAGAGGG + Intronic
1008880493 6:56376304-56376326 CTGTGGGTTTCACAGTAAGCTGG - Intronic
1010359605 6:74977684-74977706 CTGTGGATTCCACCCTCTAAAGG + Intergenic
1013470000 6:110455520-110455542 TTGTGGATTTTACAGTCATATGG - Intronic
1013796309 6:113893371-113893393 CCGAGGATTTCACCCTAAGAAGG + Intergenic
1014117381 6:117680804-117680826 CTGTTGAATTCTCACACAGAAGG - Intronic
1014171862 6:118287652-118287674 CAGTGGTTCTCAAACTCAGAGGG - Intronic
1014481483 6:121943753-121943775 CAGTTGATTTCACACTCACTTGG + Intergenic
1014696489 6:124627690-124627712 TTGTGGGTATCATACTCAGAAGG + Intronic
1014777150 6:125524292-125524314 CTGAGGATTTCACAGTAAAAGGG + Intergenic
1015566165 6:134573817-134573839 CTCTGAAATGCACACTCAGATGG + Intergenic
1017605522 6:156128461-156128483 CTGTGGAGTCCACACCCACACGG + Intergenic
1018509598 6:164510761-164510783 CAGAGGATGTCACTCTCAGACGG - Intergenic
1019091603 6:169539824-169539846 CTGTGGACTTCACATTCCCAGGG + Intronic
1019904455 7:4050199-4050221 CTGGTAATTTCACATTCAGAGGG + Intronic
1020444039 7:8249502-8249524 CTGTTTATTTCACACTCGGTGGG + Intronic
1020536758 7:9407885-9407907 CTGAGGATTGCACAGTCAGGTGG + Intergenic
1020567807 7:9819460-9819482 CTGTGGATTACAAATTCAAAGGG + Intergenic
1021998689 7:26203801-26203823 CTCTGGGTTTCACACTAAAAAGG + Intronic
1028504397 7:91555546-91555568 CTTTGGATTTCAGACTCTGTAGG - Intergenic
1028667378 7:93362494-93362516 CTTTGGATTTCACCTTCAGATGG + Intergenic
1028779530 7:94719903-94719925 CTGTGGAGTTCACAGGGAGAGGG - Intergenic
1030079060 7:105761901-105761923 CTGATGATTTTACACTGAGAAGG - Intronic
1030797454 7:113806179-113806201 CTGTGGTTTTCCCAGCCAGATGG + Intergenic
1031287238 7:119885735-119885757 CTGTGGCTTTCCCACGCACATGG + Intergenic
1034163660 7:149010064-149010086 CTGTGGCTTTCAGAGTCAGATGG + Intronic
1035418900 7:158710907-158710929 CTGTGGATTTTACAGTCATGTGG - Intergenic
1037136365 8:15466853-15466875 CTGTTAATTGCTCACTCAGAGGG + Intronic
1037619574 8:20551524-20551546 CCGTGGGTTTCACTCTCAGGAGG + Intergenic
1039490153 8:37941579-37941601 CTGTTGATGTCTCACCCAGAAGG + Intergenic
1039759689 8:40561403-40561425 TTCTGGTTTTCACTCTCAGAAGG + Intronic
1044958152 8:97503303-97503325 CTTGGGACTTCCCACTCAGATGG - Intergenic
1049477289 8:142802637-142802659 CTGGGGACTTCACATACAGAAGG + Intergenic
1052336903 9:27329586-27329608 GTGTAGATTTAACACCCAGACGG - Exonic
1053289315 9:36869572-36869594 CTGGGGATGTCAGACACAGAGGG - Intronic
1053666230 9:40319811-40319833 CTGTGGCTTTCCCACACTGAGGG - Intronic
1053780357 9:41600476-41600498 CTCTGGATTTCACACTTGCATGG + Intergenic
1054168299 9:61810633-61810655 CTCTGGATTTCACACTTGCATGG + Intergenic
1054377383 9:64459839-64459861 CTGTGGCTTTCCCACACTGAGGG - Intergenic
1054518379 9:66056472-66056494 CTGTGGCTTTCCCACACTGAGGG + Intergenic
1054669230 9:67770185-67770207 CTCTGGATTTCACACTTGCATGG - Intergenic
1055492174 9:76816549-76816571 GTGTGGATTTAACAGTCAGTCGG - Intronic
1056118139 9:83461210-83461232 CAGAGGAGTTCACAATCAGAGGG + Intronic
1060243382 9:121924322-121924344 CTGGGGATGTGGCACTCAGATGG - Intronic
1060302368 9:122382375-122382397 GTGTATATTTCACACTCACAGGG + Intronic
1185815896 X:3155049-3155071 CTGTGTATTTCAGACACACATGG + Intergenic
1188489120 X:30718447-30718469 CTGTGTATGACACAATCAGATGG - Intronic
1190123177 X:47680345-47680367 CATTGGATTTCACACCCTGAAGG + Intergenic
1192533251 X:71907725-71907747 CTTGGCATTTCACATTCAGAAGG - Intergenic
1192856468 X:75017791-75017813 TTCTGGATTTCAGACTCACATGG - Intergenic
1193804502 X:85978157-85978179 CAGTGAATCTCTCACTCAGAGGG + Intronic
1199393295 X:147306487-147306509 CTGTGCTTTTCTCAATCAGATGG - Intergenic