ID: 970828879

View in Genome Browser
Species Human (GRCh38)
Location 4:20311319-20311341
Sequence CTGTGAACACAAATATTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 284}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970828879 Original CRISPR CTGTGAACACAAATATTTGA GGG (reversed) Intronic
901387064 1:8917537-8917559 CTCTGTAAACAAGTATTTGATGG + Intergenic
901713735 1:11136378-11136400 CTGTGAAGACAGATGTCTGAGGG - Intronic
902386199 1:16077284-16077306 CTGTGTGCACAAATGTTTGGAGG + Intergenic
903711013 1:25324287-25324309 CTCTGAAAAAAAATATTTGCTGG + Intronic
903715934 1:25367142-25367164 CTCTGAAAAAAAATATTTGCTGG - Intronic
903840850 1:26238849-26238871 CTGTAAATATAAATATTTTAAGG + Intronic
909183968 1:72461566-72461588 CTAAAAACACAAATATTAGAAGG + Intergenic
909289354 1:73862562-73862584 CTGTGAACACACATTCTTCAGGG - Intergenic
911293800 1:96088727-96088749 GTGTGTACACAACTATTTTATGG - Intergenic
911535476 1:99094799-99094821 CTGTAAACACAAAAATTAGCTGG + Intergenic
912309480 1:108605406-108605428 CAGTGAATACAAATATGTTAAGG - Intronic
912335185 1:108855467-108855489 CTGTAAATAAATATATTTGAAGG + Intronic
912713013 1:111962952-111962974 CTGTGACCACCACCATTTGAAGG + Intronic
916619940 1:166486271-166486293 ATATAAACACTAATATTTGATGG - Intergenic
917205652 1:172568567-172568589 CTGTGTACACAAAAATTTTAAGG - Intronic
917253293 1:173086614-173086636 CTTTCAACACAAATTTTGGAGGG + Intergenic
917450298 1:175142394-175142416 CTGTGAACACAAAAATAAGAAGG - Intronic
917480881 1:175411048-175411070 CGATGAATGCAAATATTTGAAGG + Intronic
918337435 1:183532485-183532507 CTGTGAACACAGTTATTAGAAGG + Intronic
918901794 1:190431265-190431287 CCTTGCATACAAATATTTGAGGG - Intronic
920818300 1:209356092-209356114 CTGTGATCACAAATAGTTAATGG - Intergenic
921769179 1:219014794-219014816 CTGTTGACAAAAATAATTGATGG - Intergenic
924699873 1:246440603-246440625 CTATGAAAAAAAATATTTGGGGG + Intronic
1062826583 10:573569-573591 CTGAGAACACAAAAATTAGCTGG - Intronic
1064259462 10:13773680-13773702 CTGTGATGACTAATTTTTGATGG + Intronic
1064560489 10:16590748-16590770 AGGTGAACACAATTATTTTAAGG - Exonic
1064678550 10:17786153-17786175 CTTTGGAAACAAATATTTCAGGG + Intronic
1065361176 10:24890531-24890553 CAATGACCAGAAATATTTGATGG - Intronic
1065967782 10:30783237-30783259 CTCTGAAACCAAATATTTGCAGG - Intergenic
1067914391 10:50380812-50380834 CTGTGAAAACAGGTATTTGATGG + Intronic
1067920434 10:50450454-50450476 TTGTCAAGAAAAATATTTGAAGG - Intronic
1068320450 10:55407161-55407183 ATGTGAACAGAGATATGTGAAGG + Intronic
1068362875 10:56002493-56002515 CTGTGAACTCAGTTCTTTGATGG - Intergenic
1068681143 10:59821638-59821660 CTGAGAACAGAAAGAGTTGAGGG + Intronic
1068993564 10:63177380-63177402 ATGTAAAAACAAATATTTCATGG - Intronic
1069038479 10:63670092-63670114 CTGGGAACAGATATATCTGAGGG - Intergenic
1071766233 10:88668932-88668954 CTGAGATCACAAAAGTTTGAAGG - Intronic
1071938444 10:90557884-90557906 TTCTGAACGTAAATATTTGAAGG - Intergenic
1071996898 10:91158407-91158429 CTGAGGAGACAAAGATTTGAAGG + Intergenic
1073698699 10:105900107-105900129 ATGTGAACATAAATAACTGAAGG + Intergenic
1075356815 10:121786085-121786107 TTGTGACAAAAAATATTTGAGGG + Intronic
1079507096 11:21165484-21165506 CTGAGAACAGAGAGATTTGAGGG - Intronic
1079554049 11:21737788-21737810 CTGTAAACACAAAACTTTGGGGG - Intergenic
1079600400 11:22305107-22305129 CACTGAACACAAAAAATTGAGGG + Intergenic
1080373508 11:31680112-31680134 CTGTGACCCCAATTATCTGATGG + Intronic
1080726291 11:34902091-34902113 CTGTTAACTCAAATACCTGAGGG + Intronic
1081377127 11:42373428-42373450 CAGTGTTCACAAATATTTCAGGG + Intergenic
1084042886 11:66552693-66552715 CTGAAAACACAAAAATTTGCTGG + Intronic
1084160162 11:67344043-67344065 CTGTAATCCCAAATATTTGGGGG - Intronic
1086685724 11:89731172-89731194 CTGTGACCACTCATATTTCATGG + Intergenic
1088001632 11:104888886-104888908 ATGTGAACACATATTTTTTAAGG + Intergenic
1089084310 11:115803804-115803826 CTGTGAACAAAAGTTTTTGAAGG - Intergenic
1090145704 11:124320083-124320105 CTGTGACCACATATATTCCAAGG + Exonic
1090220910 11:125024262-125024284 CTCTGAAAACAAAAATTGGAGGG - Intronic
1091420734 12:337802-337824 CTGAGAACACAAAAATTAGCCGG - Intronic
1091806012 12:3356385-3356407 CTGTGAAAACATGTATTTTAGGG + Intergenic
1091944122 12:4519962-4519984 TTATGATCACAAATCTTTGATGG - Intronic
1093828855 12:23730351-23730373 CAATAAACACAAATATTAGAGGG + Intronic
1094117473 12:26932792-26932814 CTGTCAACTCCAATATTTGGAGG + Intronic
1098592850 12:72234217-72234239 CTGTGAACATAAAAATTACAAGG - Intronic
1098972271 12:76869058-76869080 CTGAGAATATAAATATTTGAAGG + Intronic
1099002496 12:77195961-77195983 TTGTGAACCCAGGTATTTGAGGG + Intergenic
1099712836 12:86248926-86248948 CAGTGAACACAAATAAATAATGG - Intronic
1100641611 12:96487117-96487139 CTGAAAACACAAATATTAGCTGG - Intergenic
1101389127 12:104284158-104284180 CTGAGAAAACAAATATTCCAGGG + Intronic
1102442709 12:112975616-112975638 CTATGAACACCAAGATTTAAGGG - Intergenic
1105299782 13:19122103-19122125 CTGATAACACAGATATATGAAGG - Intergenic
1105383657 13:19910667-19910689 CTGAGAAAACAAATATCTGAGGG + Intergenic
1105901422 13:24757668-24757690 CTATGAGCAGAAATATTTTAGGG + Intergenic
1107307691 13:39039578-39039600 CTGTGAACACTAATATCTTTGGG - Exonic
1108045687 13:46382282-46382304 CTGTGAACAAAAATACTGAAAGG + Intronic
1109995255 13:70115203-70115225 CTCTGAACACACATAGTAGAAGG + Intergenic
1110053255 13:70932447-70932469 TGGTAAAAACAAATATTTGAAGG + Intergenic
1110468586 13:75831444-75831466 CTGAGTACACAAGAATTTGAAGG - Intronic
1110691532 13:78435045-78435067 TTGTGCTCAGAAATATTTGAAGG + Intergenic
1110736031 13:78937753-78937775 GTGTGATCACTAATCTTTGAGGG - Intergenic
1113665601 13:112139719-112139741 CTGTGAAAATATATATTTAAGGG + Intergenic
1113842586 13:113368773-113368795 CTGTAAACACAAAAATTAGCCGG + Intergenic
1114306318 14:21426471-21426493 CTGTGTTCACAAATACCTGAAGG + Intronic
1114866516 14:26600501-26600523 CAGTGGACAAAGATATTTGAAGG + Intergenic
1116262019 14:42642233-42642255 CTGTGAGCAAAAATAAATGAGGG + Intergenic
1116701791 14:48254071-48254093 CTGTGACCACAATTCTCTGAGGG - Intergenic
1117470030 14:56034772-56034794 ATGTGAACAAAAATATTCAAAGG - Intergenic
1118706103 14:68481751-68481773 TTGTGAACAGAAATATTACAGGG - Intronic
1119966158 14:78917800-78917822 GTGTGAAAACACAGATTTGAGGG + Intronic
1123145326 14:106124197-106124219 CAATGAACACAAAAACTTGAAGG + Intergenic
1124837213 15:33206850-33206872 CTGAAAACACAAATATTAGCTGG - Intergenic
1125350365 15:38760366-38760388 TTGTCAACAAATATATTTGATGG - Intergenic
1125363595 15:38890128-38890150 CTTTGGACTGAAATATTTGAAGG - Intergenic
1126304317 15:47237769-47237791 CTGAGCACAAAAATCTTTGAGGG + Intronic
1127244952 15:57163010-57163032 CTGAAAACACAAAAATTTGCCGG + Intronic
1127481475 15:59381527-59381549 GTGTTTACACAAATATTTAAAGG - Intronic
1128063710 15:64751169-64751191 CTGAAAACACAAATATTAGCCGG + Intronic
1128201263 15:65810354-65810376 ATCTGAACACAAATGTTTGTGGG - Intronic
1128409782 15:67382959-67382981 CTGTCAACACATATACTTTATGG + Intronic
1130028904 15:80294502-80294524 CTGTATACACACGTATTTGAAGG - Intergenic
1130439613 15:83939781-83939803 CTGAAAACACAAAAATTTGCTGG - Intronic
1131279417 15:91008764-91008786 CTGTGAGCACATATATTAAAGGG + Intronic
1136168978 16:28476628-28476650 CAGTGAATACATAGATTTGATGG + Intergenic
1137861148 16:51848354-51848376 CTCTCAACACAAATAACTGAGGG + Intergenic
1138117761 16:54373962-54373984 CTGTGGAGACAAATAAGTGAAGG - Intergenic
1138792464 16:59922282-59922304 CTGAGAAAAACAATATTTGATGG - Intergenic
1138870755 16:60880732-60880754 CAGTGAATACAAACATATGAGGG - Intergenic
1139559434 16:67732449-67732471 CTCTAAACACAAATGTCTGAAGG + Intronic
1142423695 16:89989314-89989336 CTGTGAATGCAAATATTTCTGGG - Intergenic
1142572560 17:884550-884572 CTCTGGACACAAAGATTTGATGG + Intronic
1143963615 17:10740001-10740023 CTGGGAACAAAAATATCTAAAGG - Intergenic
1145074776 17:19843223-19843245 CTGGGAACAGAAAAATTTAAGGG + Intronic
1147413613 17:40272377-40272399 CTGTAAACACTATTATATGATGG - Intronic
1148169449 17:45506966-45506988 CTTTAAACTCAAATATTTGTTGG + Intergenic
1148365903 17:47055697-47055719 CTTTAAACTCAAATATTTGTTGG - Intergenic
1148493108 17:48036095-48036117 CTGTCAACACAATTAATTGTAGG - Intronic
1150400637 17:64853438-64853460 CTTTAAACTCAAATATTTGTTGG + Intergenic
1153570630 18:6469543-6469565 CTAAGAACATAAATATTTAAGGG - Intergenic
1154054398 18:10998460-10998482 GTGTGTACAGAAATAATTGAGGG + Intronic
1155667884 18:28333623-28333645 CTGTGAGCAAAAATACTAGAAGG + Intergenic
1155731558 18:29166064-29166086 CTGTGAACACAGAGAGTAGAGGG - Intergenic
1157771719 18:50353712-50353734 CTGTGACCTCAATTATCTGATGG + Intergenic
1159270665 18:66145484-66145506 CTGTGAACAGATATATCTGGTGG + Intergenic
1159529839 18:69641316-69641338 CTGTTTACAAAAATATTTCATGG + Intronic
1159848455 18:73495439-73495461 CTGTGATCTCAAATCCTTGATGG - Intergenic
1159886728 18:73914674-73914696 CTGTGAATACAAATATTACAAGG + Intergenic
1160283362 18:77514934-77514956 CTTTGAAAACAAATAGTTCAGGG + Intergenic
1163738131 19:18994354-18994376 CTGTGAACATACCTATTTGTTGG + Exonic
1164397696 19:27880232-27880254 CTGTTAACTCAAATACCTGAGGG + Intergenic
1164422303 19:28105381-28105403 CTGTGAACACTAACATGTAATGG + Intergenic
1167922792 19:52796011-52796033 CTAGGAACACAAAAATTTGCCGG + Intronic
925100527 2:1240831-1240853 ATGTAAACAAAAATAGTTGATGG - Intronic
925284573 2:2707310-2707332 CTGTGAACATAAGTAATTGAGGG - Intergenic
925671731 2:6317242-6317264 TTGTAAACACCAATATTTAAAGG - Intergenic
925945273 2:8856714-8856736 CTGAAAACACAAAAATTAGACGG - Exonic
926569196 2:14510902-14510924 CTGTACACAGAACTATTTGATGG - Intergenic
928796674 2:35031633-35031655 CAGTGAACACATATTTTTCAAGG - Intergenic
929230924 2:39559180-39559202 CTGTGAATGACAATATTTGAAGG + Intergenic
929431199 2:41888136-41888158 CTGTGAAGACAATTTTTTAAAGG - Intergenic
930299660 2:49599039-49599061 CAGTGTACACAATTACTTGATGG + Intergenic
930799199 2:55424944-55424966 CTGAGAATACAAATATTAGCCGG + Intergenic
930938768 2:56987994-56988016 CTTTTTTCACAAATATTTGAAGG - Intergenic
934986138 2:98886330-98886352 CTGTGAAGTTAAATATTTGCCGG - Intronic
935077073 2:99755667-99755689 TTGTGAAGCCAAAAATTTGAGGG - Intronic
936271362 2:111051856-111051878 ATCTGAGCACAAATATTTAAAGG + Intronic
936393500 2:112098369-112098391 CTGTTAACCCAAAAATTTTATGG + Intronic
937777407 2:125795061-125795083 CCGTGACCACAAATTTTTAATGG + Intergenic
940698752 2:157014940-157014962 CTATGAACACACATATTGAAGGG - Intergenic
942979365 2:182060932-182060954 CTGTCATAAGAAATATTTGATGG + Intronic
945040851 2:205742806-205742828 CTGTAAGCACAAATAGTTAATGG + Intronic
945318066 2:208392156-208392178 CTGTTAACTCAAATACCTGAGGG - Intronic
945700237 2:213160595-213160617 TTGTGAACAGAAATTTCTGATGG + Intergenic
946895782 2:224322006-224322028 CTGAGAAAAAAAATATTAGAAGG - Intergenic
947268194 2:228305349-228305371 CTGTTAACTCAAATACCTGAGGG - Intergenic
948167050 2:235871058-235871080 TTGAGAACTCAAATATTTTAAGG - Intronic
948202351 2:236138367-236138389 TTTTCAACACAAACATTTGAAGG - Intergenic
948299812 2:236895746-236895768 CTGTGAAGTCAATCATTTGAAGG + Intergenic
948769771 2:240245676-240245698 TTGTGAAAACAACAATTTGAAGG - Intergenic
1173169643 20:40713647-40713669 CTGTCAACACACAGATTTGCTGG + Intergenic
1173626583 20:44477206-44477228 TTGTGAACACTGATGTTTGATGG + Intronic
1174124512 20:48293260-48293282 CTGTGAATATAAATCTTTAAGGG - Intergenic
1175617465 20:60413020-60413042 ACATGAACACACATATTTGAAGG + Intergenic
1177042102 21:16126724-16126746 CTCTCAACAAAAATATTTGAAGG - Intergenic
1177461462 21:21416322-21416344 CTGTGATCAGTAATCTTTGATGG - Intronic
1177464293 21:21455327-21455349 CAGTGAATACAAATAATTGTAGG - Intronic
1177800822 21:25826975-25826997 ATGTTAACACAACTATTTGTGGG + Intergenic
1182317798 22:29459548-29459570 CTGTGTGCATAAATATTTGGGGG - Intergenic
1182460766 22:30482059-30482081 CTGAGTACAGAATTATTTGAGGG - Intergenic
950628470 3:14265760-14265782 GTGTGAAAACAAATATGGGAAGG + Intergenic
951666708 3:25133460-25133482 CTGTAAGCACAAATATTAAAAGG + Intergenic
951899805 3:27645684-27645706 CTGAAAATACAAAAATTTGATGG - Intergenic
952286065 3:31970898-31970920 CTGTGAGTACAAATGTTTGGAGG - Intronic
953899628 3:46832719-46832741 GTTGCAACACAAATATTTGATGG - Intronic
954016832 3:47700448-47700470 CTGAGGACACAAACATTTAATGG + Intronic
954819187 3:53310329-53310351 CTTTGAACACAAAACTTTAAAGG - Intronic
954985467 3:54787102-54787124 TCCTGAACACACATATTTGAGGG + Intronic
955101866 3:55858466-55858488 CTCTGAGCAAAAATATTTAAAGG + Intronic
957676045 3:83366491-83366513 CTATGAGCATAAATATTTGTGGG + Intergenic
958781204 3:98544731-98544753 CTGTGACCAGAAAAATTTTAAGG - Intronic
960737895 3:120800578-120800600 ATCTGAACACATATATTAGAAGG + Intergenic
962808667 3:138944657-138944679 CTCTGAACACAGCTTTTTGAAGG + Exonic
963497809 3:146089939-146089961 CCCAGAACACATATATTTGAGGG + Intronic
963924676 3:150938837-150938859 CTGAGCACACAAATATATGCAGG - Intronic
964036726 3:152208178-152208200 CTGAGAACACAAAAATTAGCTGG + Intergenic
964617539 3:158684437-158684459 TTCTGAACACAAATATTTTGGGG + Intronic
964632243 3:158824011-158824033 CTCTGAACACAAATAGTATATGG + Intronic
964954707 3:162338452-162338474 TTGTAAACACAAATATTATATGG + Intergenic
965144381 3:164881312-164881334 CTTTGAAAACAAAAATTTTAAGG + Intergenic
965315604 3:167186366-167186388 CTATGTACTCAAATATTTGTAGG + Intergenic
965662336 3:171054634-171054656 ATGTGAAAAAAAATATTTTAGGG - Intergenic
966130139 3:176628155-176628177 CTGTAAATACAAAGGTTTGAAGG + Intergenic
966418391 3:179713777-179713799 TTGTGGACTCAAATATTTAATGG + Intronic
967639505 3:191844407-191844429 CTGTGATCAGGGATATTTGATGG - Intergenic
968172741 3:196523508-196523530 CTGTTAACTCAAATACCTGAGGG + Intergenic
968281057 3:197476955-197476977 AAGTCAACACATATATTTGATGG - Intergenic
970498654 4:16654135-16654157 TAGTGCAGACAAATATTTGAGGG + Intronic
970828879 4:20311319-20311341 CTGTGAACACAAATATTTGAGGG - Intronic
971000153 4:22313138-22313160 CTTAGAAAAAAAATATTTGAAGG + Intergenic
971915018 4:32858175-32858197 TTGTGAATAAAAATATTTTATGG + Intergenic
972535836 4:39999255-39999277 CTGAAAATACAAATATTTGCTGG + Intergenic
972950441 4:44315616-44315638 CTGTGAAAACAATCATTTTAGGG - Intronic
972966042 4:44511154-44511176 CTCTGAAAATAAACATTTGATGG - Intergenic
973829051 4:54739680-54739702 GTGTGTAGACAAATATTTGGAGG + Exonic
974117383 4:57596548-57596570 CTGTGAAGACAACTCTTTCAAGG + Intergenic
975186075 4:71404591-71404613 CTGTCAACAATAATCTTTGATGG + Intronic
977055941 4:92190614-92190636 CAGTGTACACCAATATTTCAGGG - Intergenic
977274545 4:94959904-94959926 CTTTGAACACTAATTTTTAAAGG - Intronic
980242625 4:130196911-130196933 ATGTAAACACATATATTTGCTGG - Intergenic
982416781 4:155142772-155142794 CTATGAAGAAAAATATATGAAGG - Intergenic
982983805 4:162178016-162178038 CTGTTAACACACAGATCTGAAGG + Intergenic
983412566 4:167418731-167418753 CTGTTAACTCAAATACCTGAGGG + Intergenic
987538983 5:19228840-19228862 ATGTAAAAACATATATTTGAAGG - Intergenic
990032119 5:51274347-51274369 CTTTGAACACCAATGTTTGTAGG - Intergenic
990051534 5:51507297-51507319 CTGTGACCTCAATTATCTGATGG + Intergenic
990521349 5:56584378-56584400 TTGTGAACTTAAATCTTTGATGG - Intronic
990524907 5:56615669-56615691 CAGTTTACATAAATATTTGAAGG + Intergenic
993562516 5:89428431-89428453 GTGTGGACATAAATATTTGGGGG + Intergenic
993565287 5:89467412-89467434 CTGTTAACACAAAAATTAGCAGG + Intergenic
993649178 5:90497581-90497603 CATTGAACATAACTATTTGAAGG - Intronic
994954930 5:106516064-106516086 ATGTGAAAACAAATATTGTATGG - Intergenic
996640833 5:125751272-125751294 CTGTGAAGACAATTTTTTGAAGG - Intergenic
998537856 5:142951219-142951241 CTGAAAACACAAAAATTTGCTGG - Intronic
998697482 5:144656698-144656720 CTGTGTCCTCAAATATGTGAAGG + Intergenic
999509688 5:152236142-152236164 CTGTGAACAGTGATTTTTGATGG - Intergenic
1000941206 5:167362383-167362405 ATTAGACCACAAATATTTGAGGG - Intronic
1001407193 5:171484511-171484533 CTGTGGACTCACATATTAGACGG - Intergenic
1002585877 5:180247776-180247798 CTGTGAACACAAAGCTTTTCAGG + Intronic
1004703407 6:18100423-18100445 TTGAGAACAGAAAGATTTGAGGG + Intergenic
1005668019 6:28077618-28077640 CTGTGGAGACAAATCTCTGAAGG - Intergenic
1006089825 6:31621595-31621617 CTGTGAAGATAAATATATGAAGG - Intronic
1006572924 6:35020209-35020231 CTGTGGATAGAAATATTTGGGGG + Intronic
1006744679 6:36333118-36333140 ATGGGAACACACATATTTGAAGG + Intronic
1007757547 6:44110071-44110093 CTGTGATTATAAATATTTTATGG + Intergenic
1008221318 6:48856910-48856932 GTGTTAAAACAAATATTTGAAGG - Intergenic
1008561904 6:52732308-52732330 CTATGGAGACAAATCTTTGAAGG + Intergenic
1009041358 6:58182775-58182797 CTGTAATCATAATTATTTGATGG - Intergenic
1009217211 6:60937090-60937112 CTGTAATCATAATTATTTGATGG - Intergenic
1010285700 6:74075335-74075357 CTGTGGAAATAAATATTTAAAGG + Intergenic
1012665866 6:101968734-101968756 CAGAGAACACACATTTTTGATGG - Intronic
1014198459 6:118583887-118583909 CTGTTAACTCAAATACCTGAGGG + Intronic
1014551471 6:122793701-122793723 TTGTGAACATAAATATGTCATGG + Intronic
1015121154 6:129702836-129702858 CTGAAAACACAAAAATTAGACGG + Intronic
1015644450 6:135370666-135370688 CTGTGACCACATCTCTTTGATGG + Intronic
1015691132 6:135924913-135924935 CTAAAAACACAAACATTTGAAGG + Intronic
1016172618 6:141038611-141038633 GTGTGAACATACATATGTGAAGG - Intergenic
1016409516 6:143767387-143767409 TTTTGAGCACCAATATTTGAAGG + Intronic
1016660839 6:146577903-146577925 CCGTTAATACAAATATTAGAAGG + Intergenic
1016794842 6:148107072-148107094 AAGTGAACAAAAATATTTGATGG - Intergenic
1017191097 6:151653480-151653502 CTGTGAACAGACAGACTTGAGGG - Intergenic
1017287838 6:152697903-152697925 ATGCGAACACAAGTATATGAGGG + Exonic
1018560730 6:165098709-165098731 CTGCTAACTCAAATATCTGAGGG + Intergenic
1020834331 7:13129957-13129979 CTGTGCACATTAATTTTTGAGGG + Intergenic
1021366626 7:19788143-19788165 CTGAGAAGGCAAATATTTGCTGG - Intergenic
1021808090 7:24376581-24376603 CTGTGAACACAATTGATTTAGGG + Intergenic
1022056358 7:26739394-26739416 CTTTCAACACCAATATTTAATGG - Intronic
1022840094 7:34155976-34155998 CTGTAAATAGGAATATTTGAGGG + Intergenic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1027759449 7:82259623-82259645 CCAGGAACACAAATATTGGAAGG + Intronic
1031269735 7:119633433-119633455 CTGAGAACACAATTATTTCAAGG + Intergenic
1031907273 7:127474611-127474633 GTGTGAGCAAAACTATTTGAGGG + Intergenic
1032370154 7:131341142-131341164 CTTTGAACATAATTATTTGTTGG + Intronic
1032830233 7:135617202-135617224 CTGTGAACACAAGAATTTACGGG + Exonic
1033387324 7:140891035-140891057 CTGTGAGTTCAAATCTTTGAGGG - Intronic
1034724819 7:153325560-153325582 ATTTGAACAGGAATATTTGAAGG - Intergenic
1037498182 8:19461003-19461025 CAGTGAACACAGCTATTTAAAGG + Intronic
1038751100 8:30296750-30296772 CTCTGAAGACAAAGATTTAATGG - Intergenic
1038901375 8:31848201-31848223 CTCTGAACAATAATATTTCAGGG + Intronic
1038920260 8:32075832-32075854 CTATGAACACAAAAATTAGGTGG - Intronic
1040876668 8:52159542-52159564 TTGTGAAAACAAATATTGAAAGG - Intronic
1041123971 8:54615813-54615835 CTGTTAACATAAATAAATGAGGG + Intergenic
1042073465 8:64961917-64961939 CTGTGAACAGACATAATTTAAGG - Intergenic
1042181135 8:66088588-66088610 TTGTGAACACATATAACTGAAGG + Intronic
1042868147 8:73373555-73373577 CTTTGAACCCAAATATTTACTGG - Intergenic
1043318335 8:78949123-78949145 CTGTTACCACAAATATTCAAAGG + Intergenic
1043874502 8:85469021-85469043 TTTTGAATAAAAATATTTGAAGG + Intronic
1044536728 8:93365298-93365320 CTGGGAATACAATTATTTGCAGG + Intergenic
1044888529 8:96806860-96806882 CAGCAAAAACAAATATTTGAGGG + Intronic
1046447292 8:114339468-114339490 CTGGAAACACAAACATTTAAAGG + Intergenic
1048783428 8:138025588-138025610 ATGTGAACCCAGATTTTTGAAGG + Intergenic
1050447079 9:5735767-5735789 CTGTTAACCTAAATATTTAAAGG + Intronic
1051518126 9:17953476-17953498 TTGTGAACACATATATCTGTAGG - Intergenic
1051553201 9:18353554-18353576 CTTTGAATTCAAATATTTTATGG + Intergenic
1051797254 9:20886402-20886424 CTGTGCACTTAGATATTTGAAGG + Intronic
1052514920 9:29467963-29467985 CTGTGACCACAACTCTTTGATGG + Intergenic
1052779666 9:32767739-32767761 TTGTGCTCAGAAATATTTGAAGG - Intergenic
1054893370 9:70278583-70278605 CTGTGAACTCAAAAACTTAAGGG + Exonic
1056029768 9:82540823-82540845 ATGTGAACAGAAAGATTTTAGGG - Intergenic
1056518596 9:87378932-87378954 CTGGGAACATAAAAATTTTATGG + Intergenic
1058356327 9:104087539-104087561 CTATGCACACTAATGTTTGATGG + Intergenic
1058495709 9:105557277-105557299 CTTAGAAAACAAATATATGATGG + Intergenic
1058710827 9:107677707-107677729 CTGTCATCAAAAATCTTTGAAGG - Intergenic
1059870617 9:118570072-118570094 CTAACAACATAAATATTTGAAGG - Intergenic
1061748410 9:132756949-132756971 TTGAGAACATAAATATTTGGGGG - Intronic
1186383964 X:9090806-9090828 CTGTCAGCACAAATATTTCTTGG + Intronic
1186623572 X:11267616-11267638 CTGTTAAATCAATTATTTGATGG + Intronic
1186630264 X:11340748-11340770 CTGTGACAACAGATATCTGAAGG - Intronic
1186922695 X:14299764-14299786 CTGTGAAGACAAATATAGGCAGG - Intergenic
1188173235 X:26955094-26955116 ATGTGAAAACTAAAATTTGAAGG - Intergenic
1188545682 X:31303656-31303678 CTATGAATACAAACGTTTGAAGG - Intronic
1188887519 X:35568715-35568737 CTATGAACAGAAATATTCCAGGG - Intergenic
1191720890 X:64227582-64227604 AAGAGAACACAAATATTTCAGGG - Intronic
1193553616 X:82928727-82928749 CTGCTAACTCAAATATGTGAGGG + Intergenic
1194871116 X:99132516-99132538 CTGTGAAGACAAATACTTGCTGG + Intergenic
1194933844 X:99923273-99923295 AAGTAAACACAAATATATGATGG - Intergenic
1195460689 X:105120372-105120394 CTCTGATCACGAATATTTAAAGG - Intronic
1195865012 X:109423081-109423103 CGGTGAACACAAATTTTCTAAGG + Intronic
1197315602 X:124962213-124962235 GTCTGAAGATAAATATTTGAAGG + Intronic
1200895543 Y:8372406-8372428 ATGTGTAAACAAATATTTGGTGG - Intergenic
1201454175 Y:14150472-14150494 ATGTATACACAAATATTTCATGG + Intergenic