ID: 970834628

View in Genome Browser
Species Human (GRCh38)
Location 4:20387761-20387783
Sequence ATTCAGTTATACGTGGTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 113}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970834628_970834636 10 Left 970834628 4:20387761-20387783 CCTAGAACCACGTATAACTGAAT 0: 1
1: 0
2: 2
3: 7
4: 113
Right 970834636 4:20387794-20387816 ACCTGGATGGGCCTGGAAGTGGG 0: 1
1: 0
2: 4
3: 27
4: 223
970834628_970834633 3 Left 970834628 4:20387761-20387783 CCTAGAACCACGTATAACTGAAT 0: 1
1: 0
2: 2
3: 7
4: 113
Right 970834633 4:20387787-20387809 GCCAACAACCTGGATGGGCCTGG 0: 1
1: 1
2: 14
3: 93
4: 526
970834628_970834635 9 Left 970834628 4:20387761-20387783 CCTAGAACCACGTATAACTGAAT 0: 1
1: 0
2: 2
3: 7
4: 113
Right 970834635 4:20387793-20387815 AACCTGGATGGGCCTGGAAGTGG No data
970834628_970834632 -2 Left 970834628 4:20387761-20387783 CCTAGAACCACGTATAACTGAAT 0: 1
1: 0
2: 2
3: 7
4: 113
Right 970834632 4:20387782-20387804 ATTCTGCCAACAACCTGGATGGG No data
970834628_970834630 -7 Left 970834628 4:20387761-20387783 CCTAGAACCACGTATAACTGAAT 0: 1
1: 0
2: 2
3: 7
4: 113
Right 970834630 4:20387777-20387799 ACTGAATTCTGCCAACAACCTGG 0: 5
1: 19
2: 43
3: 65
4: 200
970834628_970834631 -3 Left 970834628 4:20387761-20387783 CCTAGAACCACGTATAACTGAAT 0: 1
1: 0
2: 2
3: 7
4: 113
Right 970834631 4:20387781-20387803 AATTCTGCCAACAACCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970834628 Original CRISPR ATTCAGTTATACGTGGTTCT AGG (reversed) Intronic
902673374 1:17991712-17991734 ATGCTCTTATACGTAGTTCTTGG + Intergenic
910652214 1:89581900-89581922 ATTCAGTGACAGGTTGTTCTGGG + Intronic
910980073 1:92951375-92951397 ATTCAGTTACATGTGGTTGCAGG - Intronic
913670330 1:121092401-121092423 ATTCAGTTCTTTGTGGTTGTAGG + Intronic
914022097 1:143879842-143879864 ATTCAGTTCTTTGTGGTTGTAGG + Intergenic
914315291 1:146505525-146505547 ACTCAGCAATACGTTGTTCTTGG + Intergenic
914349432 1:146827319-146827341 TTTCAGTTCTTCCTGGTTCTTGG - Intergenic
914660582 1:149787771-149787793 ATTCAGTTCTTTGTGGTTGTAGG + Intronic
916505774 1:165427123-165427145 ATTCGGTTAAACATTGTTCTGGG - Intronic
917849464 1:179048186-179048208 ATTCACTTCTACGCGCTTCTAGG - Intronic
918284338 1:183037137-183037159 ATTCAGTTGTTAATGGTTCTAGG + Intronic
919380777 1:196858099-196858121 ATTCAGTTATACATTGTTTTTGG + Intronic
924324041 1:242877551-242877573 ATTCAGTTCTTTGTGGTTGTAGG + Intergenic
924632860 1:245758840-245758862 ATTGAGATATTCCTGGTTCTTGG + Intronic
1064355092 10:14609400-14609422 ATTCAGTTCTTTGTGGTTATAGG + Intronic
1065713053 10:28534589-28534611 ATTCTGATGTAGGTGGTTCTAGG + Intronic
1068611629 10:59066780-59066802 TTTCAGGTTTACATGGTTCTTGG - Intergenic
1069299451 10:66888268-66888290 ATTCAGTTCCAAGTGGTTGTGGG - Intronic
1069350909 10:67525871-67525893 ATGCATTTATACGAGGTGCTGGG + Intronic
1070624741 10:78042726-78042748 ACTCAGCTAGAGGTGGTTCTGGG + Intronic
1071274267 10:84038545-84038567 ATTCAGTTCTTTGTGGTTGTAGG - Intergenic
1073714141 10:106083181-106083203 ATTCAGTTCTACGGTTTTCTGGG + Intergenic
1075178265 10:120185769-120185791 TTTCAGGTATAGGTGGATCTAGG + Intergenic
1075930412 10:126290212-126290234 ATTCAGTTCTATGTGGTGGTAGG - Intronic
1076375045 10:129977996-129978018 ATTCAGGTACTCGTGGTTGTAGG - Intergenic
1077767016 11:5170060-5170082 ATTCAGTGACATTTGGTTCTGGG - Intronic
1081399576 11:42627097-42627119 ATTAAGTTATTCAGGGTTCTAGG - Intergenic
1081548564 11:44091343-44091365 ATTCAATTATATGTAGTTCTTGG + Intergenic
1084286057 11:68131671-68131693 ATGGAGTTAAAAGTGGTTCTTGG + Intergenic
1085488369 11:76888563-76888585 ATTCAGTTTTCTGTGGTTATAGG + Intronic
1089681190 11:120119856-120119878 ATTCAATGAGACCTGGTTCTGGG - Intronic
1090669757 11:128937975-128937997 TTTCAGTTGTACTTGGATCTGGG + Intronic
1093430218 12:19076653-19076675 ATTCAGTTATTTTTAGTTCTAGG - Intergenic
1096059491 12:48684609-48684631 TTTCACTTAGAAGTGGTTCTAGG - Intergenic
1100976449 12:100127551-100127573 ATTCAGTGATATGAGTTTCTAGG + Intronic
1101266579 12:103094449-103094471 ATTCAGTTCTAGGTATTTCTAGG + Intergenic
1102077300 12:110069823-110069845 ATTCAGTTATACATGTTCCATGG - Intronic
1102333920 12:112060657-112060679 ATTTAGTTATACATGGCACTTGG - Intronic
1103465228 12:121137079-121137101 ATTCAGTTATACATGTTCCATGG + Intronic
1104193824 12:126511178-126511200 TTTCAGTTATTCGTTATTCTGGG + Intergenic
1106891975 13:34255466-34255488 ACTCAGTGAAATGTGGTTCTTGG - Intergenic
1109412036 13:61982837-61982859 ATTCAGTTACCTGTGGTTCCAGG - Intergenic
1111478895 13:88795052-88795074 ATTCAGTTATCAGTGGATATAGG - Intergenic
1113018027 13:105850439-105850461 ACCCAGCTATACGTGTTTCTGGG + Intergenic
1116279967 14:42893310-42893332 AATCAGTTATATGTAGTTATAGG - Intergenic
1128949940 15:71868182-71868204 ATTCAGTTCCATGTGGTTGTTGG + Intronic
1129966064 15:79736811-79736833 ATTCAGTTCTGTGTGGTTGTAGG - Intergenic
1130319806 15:82831979-82832001 TTTCATTTGTACCTGGTTCTAGG - Intronic
1131136606 15:89941480-89941502 ATTCTTTCATATGTGGTTCTTGG - Intergenic
1134413278 16:14021259-14021281 ATTCAGTTCTTCGTGGTTGTAGG + Intergenic
1134438569 16:14283797-14283819 ATTCCCTTCCACGTGGTTCTGGG - Intergenic
1137710331 16:50562598-50562620 ATTCAGATGTAGGTGGTCCTCGG - Intronic
1139984604 16:70888235-70888257 TTTCAGTTCTTCCTGGTTCTTGG + Intronic
1140613962 16:76636967-76636989 ATTCAGTTATATGTGGTTGTAGG + Intergenic
1141541831 16:84729421-84729443 ATTCCTTTATATGTGGTTATTGG + Intronic
1144771290 17:17760957-17760979 ATGCAGTTCTAGGAGGTTCTTGG - Intronic
1148569309 17:48655127-48655149 ATTCAGTTAAACATTATTCTGGG - Intergenic
1151047154 17:70934184-70934206 ATTCAGTGATAGGTGGTTGTTGG + Intergenic
1155571061 18:27194246-27194268 AGTAGGTTATAGGTGGTTCTTGG - Intergenic
1157646511 18:49278797-49278819 CTTCAGTCATAGCTGGTTCTAGG - Intronic
1157964053 18:52188292-52188314 ATTCAGTTCTGCTTGGTTGTTGG + Intergenic
1159413705 18:68116161-68116183 TTGCAGTTAAACGTTGTTCTGGG - Intergenic
1159573746 18:70150044-70150066 ATTCTGTTATACCTGCTTCAGGG - Exonic
1161510424 19:4667642-4667664 ATTCAGTTACTTGTGGTTCAGGG - Intronic
1164758065 19:30705151-30705173 TTTCAGTTATATTTGATTCTTGG + Intronic
930453364 2:51573173-51573195 TTTTAGTTATACGTGTTGCTAGG + Intergenic
931694316 2:64860267-64860289 ATTCGGTTGGTCGTGGTTCTCGG - Intergenic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
944175866 2:196828839-196828861 ATTCACTTTTATGTGGTCCTAGG - Intergenic
947240600 2:227990087-227990109 ATTCAGTTCCATGTGGTTGTAGG - Intronic
1170540214 20:17380010-17380032 ATTCAGTTGTTTGTGGTTGTAGG - Intronic
1172477427 20:35249248-35249270 ACTCAGTCAGAGGTGGTTCTTGG + Intronic
1174359453 20:50018693-50018715 ATTCAGATGCAGGTGGTTCTTGG + Intergenic
1178049827 21:28735375-28735397 ATTCAGTTACTTGTGGTTGTAGG + Intergenic
1181185163 22:21098130-21098152 ATTCAGTTAGTTGTGGTTGTAGG + Intergenic
950067507 3:10124743-10124765 ATTCAGTTTCTCGTGGTTGTAGG + Intronic
952592300 3:34971281-34971303 ATTCAGTTCTTTGTGGTTGTAGG - Intergenic
952682710 3:36113557-36113579 ATTTAATTATATGTGGTTGTTGG + Intergenic
955693450 3:61612441-61612463 GTTCAGTTGTAGGTAGTTCTCGG + Intronic
965441626 3:168722076-168722098 ATTGAGTTATACCTGGGACTAGG + Intergenic
967489742 3:190076608-190076630 ATTCAGCTTTATTTGGTTCTGGG - Intronic
967653075 3:192010325-192010347 ATTCAGTTAAACGTAGTCATTGG + Intergenic
970834628 4:20387761-20387783 ATTCAGTTATACGTGGTTCTAGG - Intronic
970899586 4:21143414-21143436 ATTCAGTTCCATGTGGTTGTAGG - Intronic
970901776 4:21167913-21167935 ATACAGTGATTCATGGTTCTGGG + Intronic
972242583 4:37209111-37209133 ATTATTTTATACCTGGTTCTTGG - Intergenic
973709754 4:53617007-53617029 ACTCAGTAATACTTGTTTCTTGG - Intronic
974170889 4:58265967-58265989 ATTAAGTTATACATGGTAATTGG + Intergenic
974857209 4:67475399-67475421 ACTCAGTTTTAAGTGGTTGTGGG - Intronic
987736673 5:21854316-21854338 GTTCAGTTATACTTAGTTTTGGG - Intronic
990084954 5:51964664-51964686 ATTCAGTTAATCATGGTTATAGG + Intergenic
991114553 5:62939012-62939034 ATTCAGTTCTTTGTGGTTATGGG + Intergenic
991327637 5:65454775-65454797 ATTCAGTTCTTTGTGGTTATGGG - Intronic
994186691 5:96822992-96823014 ATTCAGTTACACAAGGTTGTAGG + Intronic
994725136 5:103426616-103426638 AATGAGTTTTACATGGTTCTTGG + Intergenic
1006121836 6:31811781-31811803 ATTCATTGCTACCTGGTTCTTGG + Exonic
1011138642 6:84128703-84128725 TTTAAGTTATACTTTGTTCTGGG + Intronic
1011967892 6:93182398-93182420 ATTCAGTTTTAAGTAGCTCTTGG + Intergenic
1013427022 6:110021490-110021512 ATTTGGTTAAACGTGATTCTGGG + Intergenic
1013827542 6:114231984-114232006 TTTCAGTTATATGTGAATCTAGG + Intronic
1015163921 6:130182341-130182363 ATTCAGGTATTCTTGCTTCTAGG - Intronic
1021932265 7:25593540-25593562 ATTCAGATATTCTTGGATCTTGG - Intergenic
1024692858 7:51821557-51821579 ATTCAGTTATCCCTGGTTTTTGG + Intergenic
1029567772 7:101350370-101350392 ATTAAGTCATGCGTGGTACTGGG - Intergenic
1031440500 7:121788831-121788853 ATTCAGTTCTGTGTGGTTGTGGG + Intergenic
1037237764 8:16740810-16740832 ATTCAGTCCTAGGTGGTTGTAGG - Intergenic
1047122495 8:121921533-121921555 ATTCAGTTCTAAAAGGTTCTTGG - Intergenic
1048139973 8:131784775-131784797 ATTCAGTAATAGTTGGATCTAGG - Intergenic
1048185530 8:132236949-132236971 ATTCAGTTCTTTGTGGTTGTAGG - Intronic
1051434238 9:17013879-17013901 ATTCAGTTAAACATTATTCTGGG + Intergenic
1052593284 9:30526833-30526855 ATTCAGTTTTCCATGATTCTTGG + Intergenic
1055492162 9:76816400-76816422 ATTGAGCTATGAGTGGTTCTTGG - Intronic
1056478847 9:86980556-86980578 ATTCAGTTCCATGTGGTTGTAGG + Intergenic
1058657645 9:107238381-107238403 ATTCAGTTCTGCGTGGTTGTAGG + Intergenic
1058815054 9:108675371-108675393 ATGCAGGTAGACATGGTTCTTGG - Intergenic
1185885600 X:3779762-3779784 ATTCAATTATTTGTGGTTATAGG - Intergenic
1186422014 X:9433813-9433835 ATTCAGTTTTTTGTGGTTGTAGG - Intergenic
1188254271 X:27940968-27940990 ATTTAGTTCTATGTGGTTGTAGG + Intergenic
1189994489 X:46625853-46625875 ATTCAGTTCCATGTGGTTGTAGG - Intronic
1192048244 X:67699322-67699344 ATTCAGTTATTTGTGGTTGTAGG + Intronic
1199001779 X:142647400-142647422 ATCCAGTTATTTGTGGTTGTAGG - Intergenic
1199160140 X:144599559-144599581 ATTCATTGACACGTGGGTCTGGG - Intergenic
1201578828 Y:15490149-15490171 ATTCAGTTCTTCGTGGTTCTGGG + Intergenic