ID: 970837762

View in Genome Browser
Species Human (GRCh38)
Location 4:20431435-20431457
Sequence GCAGCCTGCCTGGCAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 275}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970837762 Original CRISPR GCAGCCTGCCTGGCAAAAGC AGG Intronic
900204492 1:1426259-1426281 GCAGCCGGCCGGGCAGCAGCGGG - Exonic
902712946 1:18253132-18253154 GCAGCCTGCTTGGGGAAAGAGGG - Intronic
902727312 1:18345863-18345885 GCAGGCTGCCTGCCAAGCGCAGG + Intronic
903178504 1:21594040-21594062 GCAGACGGCCTGGCACCAGCTGG + Intergenic
903481502 1:23656870-23656892 TCACCATGCCTGGCCAAAGCTGG + Intergenic
903770117 1:25758540-25758562 GGAGCCAGCCTGGCCAAAGGGGG + Intronic
904912996 1:33949384-33949406 GCCGCCTGCCTGGCAGAGCCAGG - Intronic
904940892 1:34164497-34164519 CCAGCGTGCCTGGCAGAATCAGG + Intronic
905146038 1:35887424-35887446 GCAGCCAGACTGGCAAAAGAGGG + Intronic
911291855 1:96066000-96066022 CCAGCATGGCTGGAAAAAGCAGG + Intergenic
911852776 1:102839654-102839676 CCAGATTGCTTGGCAAAAGCAGG + Intergenic
912548587 1:110468938-110468960 GCAAGGTGCCTGGCAACAGCAGG - Intergenic
913071241 1:115300708-115300730 GCTGCATGCCTGGGCAAAGCTGG - Intronic
913234239 1:116766274-116766296 GCACCCTGCCTGGTTCAAGCAGG - Intronic
913686624 1:121238162-121238184 GCTGCCTGCCAGGTAAAATCTGG + Intronic
914038478 1:144025802-144025824 GCTGCCTGCCAGGTAAAATCTGG + Intergenic
914150977 1:145042106-145042128 GCTGCCTGCCAGGTAAAATCTGG - Intronic
914392618 1:147236074-147236096 GCTGCCTGCCTTGCCACAGCTGG - Intronic
914681732 1:149943684-149943706 GCTGCCAGGCTGGCAAGAGCAGG - Exonic
915349486 1:155215455-155215477 GCAGGCTACCTGGGGAAAGCTGG + Intergenic
918265459 1:182838435-182838457 GCATTCTGCCTGGCTAACGCAGG - Intergenic
918663978 1:187125525-187125547 GCATCTTACCTGGCAGAAGCAGG + Intergenic
920473950 1:206256720-206256742 GCTGCCTGCCAGGTAAAATCTGG + Intronic
920507248 1:206525280-206525302 CCAACCTGCCTGGCAGAAGTTGG - Intronic
922250959 1:223847853-223847875 GGAGCCTGCCTGGCAAATTCTGG + Intergenic
922584442 1:226723015-226723037 GCATCCTGCCTGCCAAACCCTGG - Intronic
922752829 1:228078885-228078907 CCAGCCTGCCTGGGAAAACAAGG + Intergenic
924469213 1:244325102-244325124 GCAGCCTCCCAGGCCAGAGCAGG + Intergenic
924779249 1:247131594-247131616 ACAGCCTCCCTGGCTAAAGCAGG - Intronic
1065835423 10:29653322-29653344 ACAGCCTGCATGGCTGAAGCAGG - Intronic
1068613703 10:59088808-59088830 GCAGCCTGCACCGCACAAGCAGG - Intergenic
1069615710 10:69804970-69804992 GGAGTTTGCCAGGCAAAAGCGGG + Intronic
1069722192 10:70556931-70556953 GGACCCTGCCTGGCACAAGTAGG + Intronic
1070240208 10:74673029-74673051 CCAGCCTTCCTGACAAAAGCTGG + Intronic
1070300101 10:75197271-75197293 GCAGCCTGCCTGGCATCAGTAGG + Intergenic
1070507900 10:77131675-77131697 CCACCGTGCCTGGCAACAGCTGG - Intronic
1072764388 10:98083825-98083847 GCAGCCTGAGTGACTAAAGCAGG - Intergenic
1073253247 10:102134559-102134581 GCAGGCTGCCTGGTAATATCAGG + Intronic
1075253536 10:120905399-120905421 GCTGCATGGCTGGCAAAAGTAGG + Exonic
1075729763 10:124629169-124629191 CCAGCCTGCCTGGCATGTGCTGG + Intronic
1075838547 10:125477264-125477286 GCACCCTGCCTGGCTCCAGCAGG + Intergenic
1076009420 10:126975413-126975435 GCAACCAGCCTGGGAGAAGCAGG - Intronic
1076718486 10:132381161-132381183 CCAGCATGGCTGGAAAAAGCAGG + Intergenic
1076729270 10:132430093-132430115 GCAGGCTGCCAGGCAAGTGCAGG + Intergenic
1077274509 11:1697580-1697602 GCAGCTGGCCTGGGAACAGCAGG - Exonic
1077460288 11:2705658-2705680 TCAGCCTGCCAGGGAAAAGTGGG + Intronic
1077662882 11:4084934-4084956 TCAGCTTGCTTGGCAAGAGCTGG + Intronic
1077773663 11:5248400-5248422 GCAGGCTTCCTGGCAGAAGATGG - Exonic
1077774173 11:5253318-5253340 GCAGGCTTCCTGGCAGAAGATGG - Exonic
1077775618 11:5268510-5268532 GCAGGCTGCCTGGCAGAAGCTGG - Exonic
1079138817 11:17793919-17793941 GCAGGGTCCCTGGCACAAGCTGG + Intronic
1081907731 11:46680045-46680067 GCAGCAGGCCTGGCAGAAGTAGG + Intronic
1084721439 11:70908267-70908289 TCAGCCTGGCTGGCACACGCAGG + Intronic
1085113883 11:73912909-73912931 GCATTCAGCCTGGCAAAAGAGGG - Intronic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1090532034 11:127600881-127600903 GCAGACTGCCTGACAGAAGCAGG - Intergenic
1091251910 11:134151253-134151275 GCAGGCCGCCTGGCAGAGGCAGG + Exonic
1091582655 12:1798549-1798571 GAAGCCTGCCTGACAATGGCAGG + Intronic
1094329170 12:29273496-29273518 CCAGCCTTCCTGGCACTAGCAGG + Intronic
1096018342 12:48299292-48299314 GCAGCCTGCATTGCATAAGCAGG + Intergenic
1096138126 12:49219819-49219841 GCAGCCAGCCTGACCACAGCTGG + Intronic
1096145497 12:49276077-49276099 GCACCCTGCTTGGGAAATGCTGG - Intergenic
1096849745 12:54428003-54428025 GCAGCCTTCATGGCAGAGGCCGG - Intergenic
1098283436 12:68884430-68884452 GCAGCATGCCTGGCAAGGGCAGG + Intronic
1099619389 12:84981879-84981901 GCAGAATGCCTGGCAAAAGCAGG + Intergenic
1099713901 12:86265240-86265262 GCAGCCTGCCAGGCCAAAACAGG + Intronic
1100027185 12:90145067-90145089 CCAGCATGCCTGGCAACAGCAGG - Intergenic
1101091618 12:101292608-101292630 GCAGTCTGCCAGTCAGAAGCGGG + Intronic
1101145671 12:101838406-101838428 CCACCGTGCCTGGCAGAAGCTGG - Intergenic
1106027945 13:25973126-25973148 ACTGCCTTCCTGGCAAAGGCAGG - Intronic
1108738218 13:53307644-53307666 GATGCCTGCCTGGAAGAAGCAGG + Intergenic
1109603195 13:64659454-64659476 GCAAACTTGCTGGCAAAAGCAGG - Intergenic
1110746100 13:79054943-79054965 GCTGCAGGCCTGGCAACAGCAGG + Intergenic
1111474443 13:88726245-88726267 GCTGCCTGCCTTGCCACAGCTGG + Intergenic
1113489701 13:110681516-110681538 GCAGCCACTCTGGCAGAAGCTGG + Intronic
1117186804 14:53247791-53247813 TGAGCCTGCCTGGCAGGAGCTGG - Intergenic
1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG + Intergenic
1118045984 14:61971847-61971869 ACAGCTTGCCATGCAAAAGCTGG + Intergenic
1118235216 14:63996948-63996970 GCAGCCTTCCTCAGAAAAGCAGG - Exonic
1118853563 14:69603798-69603820 GAAGCCTGCCTGGAAGAAGGGGG - Intergenic
1119469065 14:74882208-74882230 GCAGGCTGCCTGGAGAAGGCAGG - Intronic
1119539121 14:75427649-75427671 GCTGCCTGGCGGGCACAAGCCGG + Intergenic
1122253141 14:100454672-100454694 GCAGCCTGTCTGGCACAGACTGG - Intronic
1125417997 15:39473454-39473476 GCAGGCTGCCTGCTAACAGCTGG + Intergenic
1126062020 15:44792035-44792057 GCAACCTCCCTCCCAAAAGCTGG + Intergenic
1127039116 15:54953937-54953959 GCAGGCTGTCTGGGGAAAGCTGG - Intergenic
1128082378 15:64864326-64864348 GCAGCTGGACAGGCAAAAGCTGG + Intronic
1128864822 15:71106505-71106527 GCAGCCTGCCTGACCCATGCAGG + Intronic
1128992291 15:72271358-72271380 GCAGCCTGGTTTGAAAAAGCCGG - Intronic
1130244469 15:82232037-82232059 GCAGCCTGCCTAGCAAAACTGGG - Intronic
1130718967 15:86367444-86367466 GCAGACTGACTGGTAAAAACTGG - Intronic
1130915667 15:88302666-88302688 GCACGGTGCCTGGCAAAAGCAGG + Intergenic
1131310214 15:91283895-91283917 GCTGTCTGACTGGCAAAGGCTGG + Intronic
1131495601 15:92908100-92908122 TCAGACTAACTGGCAAAAGCCGG - Intronic
1132323102 15:100941833-100941855 CCAGGCTGCCTGGCACAAGCTGG + Intronic
1132463077 16:64949-64971 GAAGCCACCCTGGCTAAAGCTGG - Exonic
1134139598 16:11706554-11706576 CCTGCCTGCCTGCCAAAAGTAGG - Intronic
1134182768 16:12061121-12061143 GAAGGCTGCCTGGAAGAAGCAGG - Intronic
1134766164 16:16759903-16759925 TCAGTCTGCCTTTCAAAAGCTGG - Intergenic
1134979886 16:18599308-18599330 TCAGGCTGCCTTTCAAAAGCTGG + Intergenic
1135333835 16:21584228-21584250 GCACCGTGCCTGGCCGAAGCAGG - Intergenic
1136344701 16:29667121-29667143 CCAGCCTGGCTGGTAGAAGCTGG - Exonic
1140942706 16:79736842-79736864 GGAGCTTGCTTGGCAAAAGGTGG - Intergenic
1141154746 16:81589549-81589571 GCAGCCAGCCTGGCCCATGCCGG + Intronic
1142003923 16:87680079-87680101 GCTGCCTCCCTTGCAAAGGCAGG + Intronic
1142569697 17:865220-865242 ACAGGCTGGCTGACAAAAGCTGG + Intronic
1142976532 17:3648027-3648049 GCAGCCTCCCTGGCACAGACTGG - Intronic
1144523945 17:15973969-15973991 GCAGCCTGCTGAGCCAAAGCAGG + Intronic
1144675371 17:17158363-17158385 GTGGCCTGCCAGGCAGAAGCTGG - Intronic
1144755391 17:17677343-17677365 GAAGCCTCCCTGGTTAAAGCAGG + Intergenic
1146184960 17:30718767-30718789 GCACAGTGCCTGGCACAAGCAGG - Intergenic
1146456911 17:33015691-33015713 GCTGTCTGCCTGGGAGAAGCTGG + Intronic
1146623666 17:34419665-34419687 GGAGCCTGCCGGGCACAAGGTGG + Intergenic
1147003001 17:37378423-37378445 CCACCATGCCTGGCCAAAGCTGG - Intronic
1147201115 17:38802043-38802065 GCAGCTTCCCTGGAAAATGCAGG + Exonic
1147506875 17:41026901-41026923 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147506878 17:41026931-41026953 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147506895 17:41027069-41027091 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147507165 17:41030022-41030044 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147507556 17:41034597-41034619 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147507569 17:41034705-41034727 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147507572 17:41034735-41034757 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147508203 17:41041251-41041273 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147508207 17:41041281-41041303 GCAGCGTGGCTGGCAGGAGCTGG + Exonic
1147508210 17:41041311-41041333 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147664814 17:42139876-42139898 GCATCCTGCCTGGCATTGGCAGG - Intronic
1147866351 17:43555231-43555253 GGATCCTGCCTGGGAAAAGACGG - Intronic
1149832771 17:59886425-59886447 TCAGCCTGCTTAGCAAATGCTGG - Intronic
1150526401 17:65927183-65927205 GCACCTTACATGGCAAAAGCAGG - Intronic
1150620823 17:66806657-66806679 ACAGCCTGCCTGTTTAAAGCAGG + Exonic
1151311224 17:73293502-73293524 GTGGCCTGCCAGGCAAAACCTGG - Intronic
1151767027 17:76137933-76137955 GCGGCCTGGCGGGCAAAGGCTGG + Exonic
1152112150 17:78362838-78362860 GCCCTGTGCCTGGCAAAAGCAGG - Intergenic
1153051302 18:905503-905525 GCTGGCTGCCTGGCCCAAGCAGG + Intronic
1154500362 18:14992979-14993001 GCTGCCTGCCAGGCAAAAGAGGG + Intergenic
1155215880 18:23642456-23642478 GCTGCCTGCCTCGCCACAGCTGG + Intronic
1158771872 18:60528700-60528722 GCAGGCTGCCTGTAAAAAGCTGG + Intergenic
1160563212 18:79771772-79771794 GCAGCCGGCCTGGCAGAGGCTGG + Intergenic
1161626742 19:5331418-5331440 CCACCATGCCTGGCAAAATCAGG + Intronic
1162439850 19:10686241-10686263 GCAGCCTGACTGGGCAAAGGTGG + Intronic
1163848645 19:19651337-19651359 GCAGCTTGCCGGGCCAAAGAGGG + Intronic
1164551777 19:29218163-29218185 CCAGCCTGCTTGGCAAGAGATGG - Intergenic
1164682514 19:30145128-30145150 CCACCCTGGCTGGCAAGAGCAGG + Intergenic
1164833491 19:31340832-31340854 GCAGACTGGCTGGGGAAAGCGGG - Intronic
1165739124 19:38195289-38195311 GGAGCCTTCCAGGAAAAAGCAGG - Intronic
1168412000 19:56146190-56146212 GCAGCAGGCCTGGCAGCAGCAGG - Intronic
925885683 2:8392286-8392308 GCAGCCTGCCTCGGGAATGCAGG + Intergenic
926976894 2:18524616-18524638 GCAGCCTTCCTGGAAAAGGCAGG + Intergenic
927218284 2:20682580-20682602 ACATCCTCCCTGGCAAAAGGTGG + Intergenic
928638314 2:33270617-33270639 GAATCCTGCCTGGCAAAGGATGG + Intronic
931187974 2:59972171-59972193 GCAGCCTGGCAGGCAAGAACAGG + Intergenic
933131767 2:78681406-78681428 GCAGCCAGCAGTGCAAAAGCTGG + Intergenic
933713855 2:85345964-85345986 GCTGCCTGCCAGGTAAAAGGCGG - Exonic
935456101 2:103269212-103269234 GCATAATGCCTGGCAAAGGCAGG + Intergenic
938080726 2:128368662-128368684 GCAGCCTGCCTGGCAGGGGCAGG + Intergenic
938499565 2:131823324-131823346 GCTGCCTGCCAGGCAAAAGAGGG + Intergenic
939277449 2:140017196-140017218 GCAGGCTGCCAGGCATAAGGGGG + Intergenic
939522859 2:143254284-143254306 GCAGCCTCCCTCACACAAGCGGG + Intronic
941113123 2:161439742-161439764 GCACCCCGCCTGGCTAAGGCTGG - Intronic
941921360 2:170854068-170854090 ACAGACTGGCTGGCAAAAGAGGG + Intronic
942605349 2:177684732-177684754 GCAGATTGCCTGGCAAAATTAGG + Intronic
944389875 2:199206880-199206902 GCAGCCTGTCTAGCAAAAGCAGG + Intergenic
947228900 2:227866002-227866024 GCAGCATGCCTGGTACTAGCAGG + Intergenic
947911230 2:233802289-233802311 TCAGCGTGGCTGGCAAGAGCAGG + Exonic
948831205 2:240599138-240599160 ACAGCCTGCTTGGCAAGAGCAGG - Intronic
1169459322 20:5780695-5780717 AAAGCCTGGCTGGGAAAAGCAGG - Intronic
1169563905 20:6831877-6831899 GCAAAGTGCCTGGCAAAAGTTGG - Intergenic
1169736243 20:8840499-8840521 GCAGGATGCCTGGCAAAGGTGGG + Intronic
1170900336 20:20456436-20456458 GCAGCCTGCCTGTCCAAGGAGGG - Intronic
1171051475 20:21863242-21863264 GAAGCCAGCCTGGAAAAAGCCGG + Intergenic
1173308734 20:41876798-41876820 GAAGCATGCCAGTCAAAAGCAGG - Intergenic
1176019180 20:62953830-62953852 GCTGGCTGCATGGGAAAAGCTGG + Intronic
1177973283 21:27816910-27816932 GCAGCCTCCCTGGCAAGGGTGGG - Intergenic
1178350036 21:31866259-31866281 GAAGCCTGCCTGGCACAGCCAGG - Intergenic
1178365580 21:31986554-31986576 GGAGTCTGCCTGGCAAATGAAGG - Intronic
1178373803 21:32050039-32050061 GCAGCCAGGCTGGCACAGGCTGG + Intergenic
1179365042 21:40751081-40751103 GCAGCCTGTGTGACAAGAGCAGG - Intronic
1179403320 21:41104442-41104464 GACGCATGCCTGGGAAAAGCAGG + Intergenic
1179513924 21:41893447-41893469 GCAGCCTGCATGTAAAAAGATGG + Intronic
1179626065 21:42650237-42650259 GCGGCCTGCCTGGCAGAGGCAGG + Intergenic
1179929598 21:44558503-44558525 GCAGCCTGACTGGCAGGGGCTGG + Exonic
1179944934 21:44666785-44666807 GCAGGATGCCTGGCAGGAGCTGG + Exonic
1180129993 21:45821178-45821200 CCAGCCTGCCAGGCAAAAAGTGG - Intronic
1180877715 22:19182562-19182584 GCAGCCCTCCAGGCTAAAGCTGG + Intronic
1181084072 22:20431254-20431276 CCAGCCTGCGTGGCACAGGCAGG + Exonic
1181118994 22:20652898-20652920 GCAGCCAGCCTGGCCAAGACTGG + Intergenic
1181617955 22:24067831-24067853 GCACCATGCCTGGCACTAGCAGG + Intronic
1181821906 22:25483020-25483042 TCAGCCTGCATGGCCCAAGCTGG - Intergenic
1181896356 22:26111322-26111344 GCAACCTTCCTGGCAAAAGGTGG + Intergenic
1182418532 22:30236937-30236959 GCAGCCATCTTTGCAAAAGCTGG - Intergenic
1182549890 22:31095157-31095179 CCAGCCTGCCTGCCCAAAGATGG - Intronic
1183015159 22:34980161-34980183 GCTTCCTCCCTGGCAACAGCTGG + Intergenic
1183582262 22:38733075-38733097 GGAGCCTGCCTGGGAAAAGCCGG - Exonic
1183967010 22:41447899-41447921 GCAGCCCGCGTGGCCAGAGCCGG - Intergenic
1184381350 22:44146823-44146845 CCAGCCTGGCTGGTAAAAGAGGG + Intronic
950497210 3:13340875-13340897 AGAGCCTGCCTGGCAAGAGTAGG + Intronic
950789549 3:15461524-15461546 GGAGCCTGCCTGGGAAAAGATGG - Intronic
951528996 3:23681429-23681451 CCAGCTTGGCTGGAAAAAGCTGG + Intergenic
951932327 3:27982199-27982221 GCAGCTCACATGGCAAAAGCAGG - Intergenic
952526034 3:34211444-34211466 GCAACCTCCCTTCCAAAAGCTGG - Intergenic
954671365 3:52292953-52292975 GCAGCCTGGCTGGCAAGCTCAGG - Exonic
954702283 3:52456514-52456536 GTGGGCTGCCTGGCAAAAACCGG + Intronic
958550338 3:95604629-95604651 GCAGTCTGCTTGTCAAAAGGTGG - Intergenic
959246321 3:103874098-103874120 GCAGCCTGACTAGCACATGCTGG - Intergenic
959246347 3:103874332-103874354 GCAGCCTGACTAGCACATGCTGG - Intergenic
962282105 3:134059906-134059928 GCAGCCTGCCTGGAAGCACCTGG - Intergenic
962370737 3:134818968-134818990 GCAGCCTGGCTGGAAACAGGAGG + Intronic
962406778 3:135107275-135107297 GCAGTCTCCCTGCCAAAAACGGG + Intronic
963868236 3:150385717-150385739 GCAGGCTGCCTGGCAGAACTAGG + Intergenic
965869786 3:173252128-173252150 GCACATTACCTGGCAAAAGCAGG + Intergenic
968245572 3:197143541-197143563 CCACCGTGCCTGGCAACAGCTGG + Intronic
969636933 4:8374705-8374727 GCAGGCTGCCTGGCATGAGGGGG + Intronic
970669471 4:18379633-18379655 GCAGCCTGCCTGGGAGAAGAGGG - Intergenic
970733717 4:19140682-19140704 GCACCCCGCCTGGCAAAAAGAGG + Intergenic
970837762 4:20431435-20431457 GCAGCCTGCCTGGCAAAAGCAGG + Intronic
971347001 4:25820808-25820830 GCAGCCTGGGTGACAAGAGCAGG - Intronic
972630635 4:40838754-40838776 CCACCATGCCTGGCAAAAGCAGG + Intronic
975650276 4:76586151-76586173 GCCGCCTGCCTGACAGGAGCTGG - Intronic
976037954 4:80847199-80847221 GCAGCCTTCCTGGGTAGAGCAGG - Intronic
976085477 4:81403144-81403166 GTAGCATGCCCAGCAAAAGCTGG - Intergenic
976472960 4:85450892-85450914 GGAGCCTGTCTGCCAAAACCTGG - Intergenic
980901479 4:138909311-138909333 GCAGCTTGCATGGTAACAGCTGG - Intergenic
981791258 4:148539546-148539568 AAAGCCTGCCTGGCAGGAGCTGG + Intergenic
982262366 4:153505892-153505914 GGAGGCTGCCTGGCCAGAGCAGG + Intronic
985178975 4:187235861-187235883 GCAGCCTGCCCTGCAAAGCCTGG + Intergenic
985926120 5:3020499-3020521 GAAGCCTGCATGGTAAATGCCGG + Intergenic
985937749 5:3109760-3109782 ACAGCCTGTCTGGGAAAAGCTGG + Intergenic
987391541 5:17380824-17380846 GCTTCCTGCCTGGCAAAAATGGG + Intergenic
988644035 5:33073987-33074009 GCAGACTGCATGGCAAGTGCTGG - Intergenic
988806078 5:34741969-34741991 GCACGATGCCTGGCAAAAGTAGG + Intronic
989102971 5:37837880-37837902 CCAGCCTGCCAGGCACAAGAAGG - Intronic
989689670 5:44126004-44126026 GGAGCCTGCATAGCCAAAGCAGG + Intergenic
992657442 5:78924165-78924187 GCACCAGGCCTGGCATAAGCAGG - Intronic
993140265 5:84024562-84024584 GCAGGCAGCGTGGTAAAAGCTGG + Intronic
994141259 5:96344086-96344108 GCTGCCAGCCTGACAAAGGCAGG - Intergenic
996606445 5:125328784-125328806 TGATCCTGCCTGGAAAAAGCAGG - Intergenic
996965922 5:129306859-129306881 CCAGCCTGCCTGGCTGCAGCAGG + Intergenic
997976086 5:138442020-138442042 GCAGGCAGCATGGCAGAAGCGGG - Intronic
999032004 5:148304377-148304399 GCAGCCTCCCTAGCAAGAGTAGG + Intergenic
999773647 5:154793867-154793889 GGAGCCTGCCTGGCACGACCAGG + Exonic
1001244127 5:170093018-170093040 ACATCCTGCCTGGCTGAAGCAGG - Intergenic
1001652222 5:173324087-173324109 GCACCCTGCCTGGCAGCATCTGG + Intronic
1002088779 5:176792601-176792623 GAAGCCCACCTGGCACAAGCTGG + Intergenic
1003384012 6:5650762-5650784 CCACCCTGCCTGGCCAAAGTGGG + Intronic
1006385549 6:33728816-33728838 GAAGCCTTCCTGGAAGAAGCAGG - Intronic
1007339525 6:41181730-41181752 ACACCCTGCCTGGCAAAGACAGG + Intergenic
1007958111 6:45935376-45935398 CCAGCCTGCCTGGCACATGGTGG - Intronic
1008426310 6:51361542-51361564 GCAGCCTGACTGAAAGAAGCTGG - Intergenic
1010077890 6:71822249-71822271 GCAGCCTGCCTTGCTACTGCTGG - Intergenic
1012006887 6:93724030-93724052 GAAGCCTGCCCGGGAAGAGCAGG + Intergenic
1012967895 6:105695372-105695394 GCAGAATGCCTGGCAATAGTAGG - Intergenic
1014263594 6:119249208-119249230 GCAGCCTCCCTGACAAAAAGGGG + Intronic
1014848200 6:126306416-126306438 CCACCATGCCTGGCCAAAGCTGG - Intergenic
1015505188 6:133978025-133978047 TCAGCCTCCCTGGCAACAACTGG - Intronic
1015715048 6:136183764-136183786 GAAGCCTGCCTGCCAGGAGCAGG - Intronic
1017106655 6:150894484-150894506 TGAGCCTGACTGGCCAAAGCTGG - Intronic
1018935220 6:168269610-168269632 GCAGCCTGCCAGGGAGAAGTGGG - Intergenic
1019113539 6:169738140-169738162 CCAGCCTGCCTGGCTCCAGCAGG + Intergenic
1019442804 7:1055960-1055982 GCAGCCTCGCAGGCAGAAGCTGG + Intronic
1019594416 7:1851858-1851880 GTCGCCTGCCTGCCAACAGCTGG + Intronic
1019754618 7:2759926-2759948 ACAGCCTGCTTGGCAGGAGCAGG - Intronic
1019831605 7:3336279-3336301 ATATCCTGCCTGGCAGAAGCAGG + Intronic
1022273766 7:28836301-28836323 GCAGCCTGCCTCTCAAATCCTGG + Intergenic
1022632163 7:32095450-32095472 GCAGCCTTCCTTGCTAAAACTGG + Intronic
1022989260 7:35692235-35692257 GCAGACCTCCTGCCAAAAGCAGG + Intronic
1023302808 7:38792019-38792041 CCAGACTGCCTGGCCAGAGCTGG + Intronic
1023864599 7:44232778-44232800 GCCTCCTGCCTGGGGAAAGCGGG + Intronic
1024539858 7:50467461-50467483 TTAGCCTGCCTGGAAACAGCTGG - Intronic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1029559050 7:101290341-101290363 GCAGCCTCCCTGGCAATAGAAGG + Intergenic
1030811133 7:113973786-113973808 GCAGCCTCCCTCAGAAAAGCAGG + Intronic
1031127602 7:117792114-117792136 GAAGCCTGCCTGTCAATACCTGG + Exonic
1031844724 7:126791456-126791478 GCAGCCTACCTGGTTACAGCAGG - Intronic
1032083897 7:128873686-128873708 ACGGCCTGCCTGGAAAGAGCAGG + Intronic
1032409762 7:131686350-131686372 GCATCCTGCCTGGCACATGATGG - Intergenic
1032516145 7:132507738-132507760 GCTGCCTACCTGTCCAAAGCGGG - Exonic
1034080617 7:148274608-148274630 GCAGGGTACATGGCAAAAGCAGG - Intronic
1034534752 7:151719800-151719822 ACAGGCTGCCTGGCAAACTCAGG - Intronic
1035742963 8:1943145-1943167 GCGGCCTGCCTAGCACAGGCAGG + Intronic
1037072916 8:14674795-14674817 GCAGTTTACATGGCAAAAGCAGG - Intronic
1038395789 8:27244542-27244564 CCAGGCTCCCTGGCAAATGCTGG - Intronic
1045953897 8:107884578-107884600 GTAGACTGCCTGGAAATAGCAGG + Intergenic
1048335881 8:133501901-133501923 GCATCCTGGCTGGCAGAAGATGG + Intronic
1049044158 8:140136352-140136374 GCTGCCTGGCAGGCACAAGCAGG + Intronic
1049156955 8:141073128-141073150 GCAGCCTACCTGGCCCCAGCTGG + Intergenic
1054328189 9:63728452-63728474 GCTGCCTGCCAGGCACAAGAGGG - Intergenic
1054745962 9:68853966-68853988 CCAGCTTGCCTGGCACAAGCCGG - Intronic
1055729410 9:79265170-79265192 ACAGGCTGCCTGGCAGAGGCAGG - Intergenic
1056011020 9:82330534-82330556 ACAGCATGCTTGGCAAAAGAAGG + Intergenic
1056532115 9:87497491-87497513 GCACCGTGCCCGGCACAAGCTGG + Intronic
1057154465 9:92829103-92829125 GCAGCCTGCCTGGCTAGGGTTGG + Intergenic
1060837877 9:126770724-126770746 CCACCCTGCCCGGCCAAAGCTGG + Intergenic
1060995062 9:127871249-127871271 GGAGCCTGGCTGGAAAGAGCAGG - Intronic
1061445284 9:130634028-130634050 GCACCCTGCCAGGCACAAGAGGG - Intronic
1061618927 9:131798330-131798352 GGAGGCTGCCTGGCGAGAGCTGG - Intergenic
1062130140 9:134888169-134888191 GCAGCTTGCCTGAGAGAAGCGGG - Intergenic
1062190302 9:135244543-135244565 GCAGCCTGCCTGCCTCACGCGGG - Intergenic
1186680677 X:11870534-11870556 GCTGCCTCCCAGACAAAAGCAGG + Intergenic
1187526299 X:20058206-20058228 GCAGTCTGCCTGATAAAAGCTGG + Intronic
1188308611 X:28588900-28588922 GCAGCCAGCTTGGGAAATGCAGG + Intronic
1189284969 X:39845592-39845614 GGAGGCTCCCTGGCAAAAGTGGG + Intergenic
1189463305 X:41259675-41259697 GCAGCCAGTCTGGCAGATGCAGG - Intergenic
1190131712 X:47754116-47754138 TCCCCCTGCCTGGAAAAAGCAGG - Intergenic
1191225203 X:58035186-58035208 CCAGTCTGTCTGGCACAAGCAGG + Intergenic
1192202418 X:69074998-69075020 GCAGCCTGACTGGCTCAAACTGG + Intergenic
1196110665 X:111943762-111943784 GCAGATTGCCTGGCAACAGACGG + Intronic
1196905424 X:120427476-120427498 GATGCCTGCCTAGCCAAAGCTGG - Intergenic
1197030117 X:121803024-121803046 GCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1198333400 X:135643331-135643353 GCAGCCTGCATGCCAGAAGCTGG + Intergenic
1199858840 X:151781498-151781520 GCAGCAGGCCTGGCAGAAGGCGG + Intergenic
1201948880 Y:19541446-19541468 GGAGCCAGCCTGGTAAAAGATGG - Intergenic