ID: 970840123

View in Genome Browser
Species Human (GRCh38)
Location 4:20458677-20458699
Sequence ACTGCTATCCTGCTTCTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970840123_970840125 -7 Left 970840123 4:20458677-20458699 CCTGTAAGAAGCAGGATAGCAGT 0: 1
1: 0
2: 0
3: 9
4: 127
Right 970840125 4:20458693-20458715 TAGCAGTGCTTCAGAATAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 122
970840123_970840124 -10 Left 970840123 4:20458677-20458699 CCTGTAAGAAGCAGGATAGCAGT 0: 1
1: 0
2: 0
3: 9
4: 127
Right 970840124 4:20458690-20458712 GGATAGCAGTGCTTCAGAATAGG 0: 1
1: 0
2: 0
3: 9
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970840123 Original CRISPR ACTGCTATCCTGCTTCTTAC AGG (reversed) Intronic
900677347 1:3896130-3896152 ACTGCTATCCTGCCTCTCCTGGG - Intronic
905605176 1:39291719-39291741 TCTGTTCTCCTGCTTCTTAGCGG + Intronic
906405562 1:45539326-45539348 ACTTCTATCCTTCTCCTTCCTGG + Intergenic
906921211 1:50066390-50066412 ACTGCTTTCCTGATTCTTCAAGG + Intronic
913109553 1:115645197-115645219 ATTTCTATTCTGTTTCTTACAGG - Intronic
916005344 1:160654449-160654471 TTTGCTAGCCTGCTTTTTACTGG + Intergenic
917617965 1:176765680-176765702 ACAGCTGTCCTGCTTCCCACAGG - Exonic
917624010 1:176827564-176827586 ACTGCTATCATTCTTATTAGTGG + Intronic
918233172 1:182554182-182554204 ACTGCTTTTCTGCTTCTCACAGG + Intronic
918492794 1:185099910-185099932 AATGGTATACTGCTTCTCACTGG - Exonic
922341963 1:224664652-224664674 ACTGCTATCCTTTTTCTTTATGG + Intronic
924248459 1:242107557-242107579 ATTGCCGTCCTGGTTCTTACTGG + Intronic
1063200041 10:3779358-3779380 GGTGCTATGCCGCTTCTTACAGG + Exonic
1064136774 10:12757800-12757822 TCTGGTCTCCTTCTTCTTACAGG + Intronic
1064342218 10:14497710-14497732 ACTGCCATGCTGCTTCCTCCCGG - Intergenic
1064731983 10:18340791-18340813 ACTGCTTTCCTTTTTCTTGCTGG - Intronic
1071953291 10:90729088-90729110 ACTGGGATTCTGTTTCTTACAGG - Intergenic
1076271751 10:129158611-129158633 ACTGCAAGCCTGCTTCTAACAGG - Intergenic
1076777529 10:132706305-132706327 ACTGCTCCACTGCTTCTTTCTGG - Intronic
1078749827 11:14150932-14150954 ACTGCTATCCTGGTCCTGATGGG - Intronic
1080186698 11:29496402-29496424 AATGCTATACTGCTTATTAATGG + Intergenic
1081002441 11:37691977-37691999 ACTGAGGTCCTGCTTCTTGCTGG - Intergenic
1081213034 11:40359193-40359215 ACTGGTATCCTGCTTTTGAGAGG - Intronic
1082267407 11:50134219-50134241 ACTGCTATCCCCCATTTTACAGG - Intergenic
1082274461 11:50206708-50206730 TCTGCTCTGCTTCTTCTTACTGG - Intergenic
1082288680 11:50344347-50344369 ACTGCTATCCCCCATTTTACAGG + Intergenic
1085154792 11:74283549-74283571 ACAGCTCTCCTGCTGCCTACAGG + Intronic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1095824268 12:46515677-46515699 ATTGCTAACCTGCATCTTCCTGG - Intergenic
1096202960 12:49698945-49698967 CCTCCTCTCCTGCTTCTTGCTGG - Intronic
1097294144 12:57944816-57944838 AATCCTTTCTTGCTTCTTACTGG + Intronic
1097425759 12:59442118-59442140 GCTTCAATCCTGCTTGTTACTGG + Intergenic
1099754154 12:86820532-86820554 ACTGTGATTCTTCTTCTTACAGG - Intronic
1099921944 12:88969427-88969449 AGTGCTATACTTCTTCTTTCTGG - Intergenic
1103930950 12:124450530-124450552 ACGGCTAGCTTGCTTCTCACTGG - Intronic
1110239778 13:73254296-73254318 ACTCCTCTCTTGCTTCTGACTGG + Intergenic
1110428823 13:75399821-75399843 ACTGTTAGCCTTCTTCATACTGG - Intronic
1116116679 14:40661433-40661455 ACTTCCAGCCTGCTTCTTGCAGG + Intergenic
1117713149 14:58553336-58553358 TCTGCTAACCTGCCTCTTTCTGG - Intergenic
1119481796 14:74962629-74962651 ATTAAGATCCTGCTTCTTACTGG + Intergenic
1121613896 14:95299920-95299942 ACTGCCATTCTGTTTCTTTCAGG - Intronic
1128778494 15:70342117-70342139 AGTGGTATCCTGCTGCTTATAGG - Intergenic
1128930987 15:71704772-71704794 ACTGCCATCATGCTTCTCCCTGG - Intronic
1138339309 16:56278379-56278401 ACTCCTTTCCTGCTCCTCACAGG - Intronic
1139192771 16:64883872-64883894 ACTGCTTTTCTGCTTGTCACAGG + Intergenic
1141099633 16:81187796-81187818 AATGGTATCCTCCTTTTTACAGG - Intergenic
1143180303 17:4980333-4980355 ACTGCTATCCTCCTCCTGACAGG - Exonic
1144673349 17:17145487-17145509 TCTGCCATCCTGCTTCTTGTGGG + Intronic
1147252980 17:39164848-39164870 ACTGCTTTCCTCCATCTTCCCGG - Intronic
1151593265 17:75060951-75060973 TCTGTCATCCTGGTTCTTACTGG + Intronic
1153726488 18:7961685-7961707 ACAGCTAGCCTGCTGCTTGCTGG + Intronic
1153819489 18:8820903-8820925 ACAGCTATCATTCTTCTTAAAGG + Intronic
1154306318 18:13233387-13233409 ACAGCTGTCCCGCCTCTTACTGG - Intronic
1154963677 18:21335154-21335176 CCTGCTGTCCTGCTTATTACGGG - Intronic
1155857654 18:30853444-30853466 ACTTCTATCCTGATTCTAAATGG + Intergenic
1156423006 18:36976451-36976473 ATTGCGTTCCTGCTTTTTACAGG + Intronic
1156987423 18:43364669-43364691 ACTGCTGTTCTGCTTCTGTCAGG + Intergenic
1159183378 18:64939810-64939832 ACTACCATCCTGCGTTTTACAGG + Intergenic
1161672959 19:5624241-5624263 ATTGCTTTTTTGCTTCTTACAGG - Intronic
1162536286 19:11264466-11264488 GATGCTATCCTGCGTCTGACTGG - Intergenic
926136296 2:10339030-10339052 ACTCCCATCCTGCTGCTTCCTGG - Intronic
926851990 2:17208855-17208877 ACTTCTATTCTGCATCATACTGG + Intergenic
929207627 2:39315059-39315081 ACTTCTACCCTGCTTATTCCAGG + Intronic
930423591 2:51184270-51184292 ACTGATATCTTGGTTATTACTGG + Intergenic
931609568 2:64084033-64084055 GCTGTTATTCTGCTTCTTAAAGG - Intergenic
932500569 2:72179522-72179544 ATTGCCATCCTGCTTCCTGCAGG - Intronic
934529324 2:95075247-95075269 TCTGCTGTCCTGCTCCTTCCAGG - Intergenic
939538583 2:143463631-143463653 CCAGCTATCCTACATCTTACTGG + Intronic
939548375 2:143582170-143582192 AGTGCAATCATGCCTCTTACTGG - Intronic
943472813 2:188315970-188315992 ACTCATATCCTGCTTCTTCTTGG - Intronic
948841922 2:240655485-240655507 CCTGCACTCCTGCTTCTAACAGG - Intergenic
1170273955 20:14562727-14562749 CCTGCTCTCCTCCTTCTTGCTGG + Intronic
1171337943 20:24403502-24403524 ACTGCTTTCCATATTCTTACCGG + Intergenic
1173248022 20:41349558-41349580 CCTCCCATCCTTCTTCTTACTGG + Intronic
1174201006 20:48806332-48806354 CCTGCTATCCTGATTCTCAAAGG + Intronic
1174257856 20:49271620-49271642 ACAACCATCCTGCTGCTTACTGG - Exonic
1177446292 21:21200650-21200672 ACTGCTATCTTGTATTTTACAGG + Intronic
1178380032 21:32100095-32100117 ACTCCAATCCTGCTCCTTTCTGG - Intergenic
1182739531 22:32557461-32557483 ACATCTTTCCTGCTTTTTACTGG + Intronic
1184745087 22:46451454-46451476 ACTGCTTTGCTGTTTCTTACGGG + Intronic
952014435 3:28940107-28940129 ACTGCTTTCCTCCTTCCAACAGG + Intergenic
952124636 3:30286215-30286237 ACTGCTATTCTCCTTCTGAATGG - Intergenic
954148012 3:48643842-48643864 ACTGCTCTCCTGTTTCTTTGTGG - Intronic
955484066 3:59418022-59418044 TCTGCTATTCTGCTTCTAAGGGG + Intergenic
956868713 3:73395403-73395425 ACTGGTATCTTGTTGCTTACTGG + Intronic
958148550 3:89658696-89658718 CCAGCAATCCTGCTACTTACTGG - Intergenic
962293739 3:134160983-134161005 ACTGCTTTCATACATCTTACAGG - Intronic
965537367 3:169837072-169837094 CCTGCCTTCCTGCTCCTTACTGG - Intronic
967380880 3:188856408-188856430 ACTTCTATCATTCTTATTACTGG - Intronic
969646292 4:8431429-8431451 ACTGCTGACCTGCATCTGACAGG + Intronic
970519468 4:16867539-16867561 ACTGCTATCCTGTACCTTAGTGG - Intronic
970795699 4:19910305-19910327 AATGCTATCCTGGTGCTTAGTGG + Intergenic
970840123 4:20458677-20458699 ACTGCTATCCTGCTTCTTACAGG - Intronic
972331376 4:38067455-38067477 ACGGCTTTCCTTCTTCTTACTGG + Intronic
979607985 4:122659228-122659250 ACAGCTCTCCTGTTTCTTAAAGG - Intergenic
983851757 4:172589475-172589497 AATGCTTGCCTTCTTCTTACAGG - Intronic
984287510 4:177751374-177751396 ACTGCTATTCAGCATATTACTGG - Intronic
985482619 5:126002-126024 ACTTCTATCTTGCTGCTTTCAGG + Intergenic
986174415 5:5339915-5339937 ACTTCAAACCTGCTTCTTCCAGG - Intergenic
992114736 5:73528944-73528966 CTTACTATCCTGCTTCTTGCAGG - Intergenic
993765766 5:91856238-91856260 TCTGCTATTGTGCTTCTTCCTGG + Intergenic
993848414 5:92974324-92974346 ACTGCTATTCTGGTTAATACAGG + Intergenic
995624914 5:114065784-114065806 ACTGGTATCTTGCTTCTTTTTGG - Intergenic
996415308 5:123204097-123204119 CCTGCTCTCCTGCTTTTGACAGG + Intergenic
998305053 5:141067600-141067622 TCTACTTTCCTGCTTTTTACTGG - Intergenic
1001096444 5:168779180-168779202 AATACTATCCTACCTCTTACGGG - Intronic
1001650394 5:173311661-173311683 ACAGCTATCCTGCTTTTCTCAGG - Intergenic
1002415021 5:179115845-179115867 TCTGATGTCCTGCTTCTTAATGG + Intronic
1006045780 6:31296508-31296530 ACTGCTAGCCTGCTTTCTAAAGG - Intronic
1007273627 6:40657595-40657617 AGTGCTATTCAGCTTCTTCCAGG - Intergenic
1010188846 6:73174017-73174039 AAAGCTTACCTGCTTCTTACCGG + Intronic
1013201822 6:107905208-107905230 ATTTGTTTCCTGCTTCTTACAGG + Intronic
1014602192 6:123427457-123427479 AATGTAATCCTTCTTCTTACAGG + Intronic
1015226066 6:130858974-130858996 GCTCCTATCCTGCTGCTCACAGG - Intronic
1015987829 6:138902705-138902727 ACAGTTATTCTGTTTCTTACTGG - Exonic
1016667572 6:146659818-146659840 ATGGCTAACCTGCTTCTTTCGGG - Intronic
1020988522 7:15166668-15166690 ACTCCCATCCCGCTTCTTACTGG - Intergenic
1021153383 7:17179426-17179448 ACTGCTATACTGCTGCTTCTAGG + Intergenic
1023878166 7:44302872-44302894 ACTGCTATTCGACATCTTACTGG + Intronic
1030650126 7:112108840-112108862 ATTGTAATCCTGCTTCTTAGGGG + Intronic
1030724409 7:112908835-112908857 ACAGGTATCCTGTTTCTTAAAGG - Intronic
1034266987 7:149785842-149785864 ACTGCTGGCCAGCTCCTTACTGG + Intergenic
1034364306 7:150533457-150533479 ACTGCTGACCTGCATCTTTCTGG - Intergenic
1041012288 8:53557228-53557250 ATTGCTCTCCTGCTTCTCAATGG + Intergenic
1042164530 8:65933001-65933023 AATGCTTTTCTGCTTCTAACTGG + Intergenic
1045897418 8:107236405-107236427 ACTGAGATGCTGCTTCTTATAGG - Intergenic
1047290945 8:123530199-123530221 GCTCCTAACCTGCTTCTTGCAGG + Intronic
1048267668 8:133001751-133001773 ACTTCTATTCTGCTTATCACAGG + Intronic
1050540927 9:6669131-6669153 AGTGGTATACTGCTTCTCACTGG + Intergenic
1050631239 9:7560918-7560940 ACTGCTTTCCTGTTTGTTTCTGG + Intergenic
1051077181 9:13252824-13252846 ATTGCTATCATGCTTCCTCCTGG - Intronic
1055500697 9:76899878-76899900 TCTGCTATCCAGCTTCTTTCTGG - Intronic
1055845167 9:80553645-80553667 ATGCCCATCCTGCTTCTTACAGG - Intergenic
1059809941 9:117845066-117845088 ACTGCTATCTTCCTTTTTAAGGG + Intergenic
1059860313 9:118452894-118452916 ACTGGTATTCTCCTTCTTATTGG - Intergenic
1188080541 X:25834179-25834201 ACTACTATCCTGCCTCTAACTGG - Intergenic
1188583850 X:31749084-31749106 AATGCTATCCTGATCCTAACTGG - Intronic