ID: 970848079

View in Genome Browser
Species Human (GRCh38)
Location 4:20566974-20566996
Sequence GTGTCACAGAGTCCCCTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970848079 Original CRISPR GTGTCACAGAGTCCCCTCAT GGG (reversed) Intronic
901933893 1:12615065-12615087 TTGTCCCAAAGTCCTCTCATTGG + Intronic
905239425 1:36572248-36572270 GAGTCACAGTGTCCTCCCATAGG + Intergenic
907290479 1:53409390-53409412 GGGTCCCCTAGTCCCCTCATAGG - Intergenic
911438273 1:97891243-97891265 AGGTCACAGAGTCCCCTCTCTGG + Intronic
912493967 1:110079474-110079496 GGGCCACAGAGGCCCCACATTGG + Intergenic
916249540 1:162723792-162723814 ATGTCACACTTTCCCCTCATAGG + Intronic
916852894 1:168721721-168721743 CTGTCACTGAGTAGCCTCATGGG + Intronic
919627879 1:199929931-199929953 ATTTCCCAGAGTTCCCTCATGGG + Intergenic
921146884 1:212366883-212366905 GTATCACAGAATCCCCACCTGGG + Intronic
923145950 1:231197975-231197997 GTGTCACATATTCAACTCATTGG + Intronic
924381141 1:243465643-243465665 GTGTCACAGATACCCATGATAGG + Intronic
1080858053 11:36129467-36129489 CTGTCCCAGAGTCCCTTCAGAGG + Intronic
1082009099 11:47438332-47438354 GAGTCAGAGAGGCCCCTCAAAGG - Intronic
1082615087 11:55349607-55349629 CTGACACAGAGTCCCTGCATAGG + Intergenic
1083260836 11:61522113-61522135 ATGTCACAGAATCCCGTCCTGGG + Intronic
1084926817 11:72520518-72520540 ATTTCACAGGTTCCCCTCATAGG - Intergenic
1085642270 11:78200045-78200067 GTGTCTCTGAGTCCCCTCTCAGG + Intronic
1088828387 11:113514968-113514990 CTGACACAGAGCCCCCACATTGG - Intergenic
1091196317 11:133733826-133733848 GTGTCACAGGGACCCCTCAGAGG - Intergenic
1091346616 11:134858573-134858595 GTATCACAGAGTTTCCACATAGG - Intergenic
1094488504 12:30943774-30943796 CAGTCACAGTGTCCACTCATCGG + Intronic
1099781419 12:87200545-87200567 GAGTCACAGAGTGCCCTGAAAGG + Intergenic
1102529097 12:113532998-113533020 GTGTCACAATGTCCCCTTTTGGG + Intergenic
1105635455 13:22211528-22211550 AGGCCACAGAGTCCCTTCATGGG + Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1110110342 13:71737323-71737345 GTGTTCCAGAGTTCCCTCAAAGG - Intronic
1111871705 13:93840986-93841008 GTTTCACAGAACCCTCTCATAGG - Intronic
1115231425 14:31164814-31164836 ATGTAACAGAGTTCCCTTATTGG - Intronic
1117469010 14:56023439-56023461 AGGTGAAAGAGTCCCCTCATTGG - Intergenic
1118343214 14:64913861-64913883 GTGTCACAGAAGCACCTCAGTGG - Intergenic
1121499406 14:94421686-94421708 GTGTGACAGAGTCCCTTATTAGG - Intergenic
1202898549 14_GL000194v1_random:23328-23350 GTGTCTCACCTTCCCCTCATGGG + Intergenic
1124337735 15:28869688-28869710 CTCTCAAAGAGTCCCCACATGGG - Intergenic
1125747782 15:42008826-42008848 GTGTCAGAGAGTCCTCTCGATGG + Intronic
1127126750 15:55819512-55819534 GTGTAACAGGGTCTCCTCACGGG + Intergenic
1127213618 15:56801177-56801199 GTCTCCCAGAGTCCCCCAATGGG + Intronic
1127906084 15:63377230-63377252 GAGTTGCACAGTCCCCTCATTGG - Intronic
1131310144 15:91283383-91283405 GTGTCTCAGTGTCACCTGATTGG + Intronic
1134644336 16:15854370-15854392 GTTTCACAGATTACCCTCATGGG - Intronic
1136596718 16:31255714-31255736 TTGTCTCAGAGTCCACTTATAGG + Intergenic
1137483869 16:48875494-48875516 GTGGCTCAGAGTCTGCTCATAGG + Intergenic
1138229587 16:55327369-55327391 CTGCCCCAGAGTCCGCTCATAGG - Exonic
1141160439 16:81625929-81625951 GTGACACACAGTCTGCTCATTGG - Intronic
1141597056 16:85103833-85103855 GTGTCACACAGTGACCTCACAGG + Intronic
1144715543 17:17433017-17433039 GTCTCACAGAGACCTCTCTTAGG - Intergenic
1145934260 17:28705763-28705785 GAGGCGCAGAGTCGCCTCATGGG - Intronic
1146529160 17:33593340-33593362 GTCTCTCTGGGTCCCCTCATTGG + Intronic
1146691303 17:34878009-34878031 GGCTCACTCAGTCCCCTCATGGG + Intergenic
1151570119 17:74921792-74921814 GTGTCACTGTGTGCCCTCCTGGG + Intronic
1152775149 17:82196590-82196612 GTGTGACAGGGTCCCCTCTCTGG - Intronic
1152800586 17:82328940-82328962 GCTTTACAGAGTTCCCTCATGGG - Intronic
1156212305 18:34958105-34958127 GGTTCCCAGAGTTCCCTCATTGG + Intergenic
1157228618 18:45891963-45891985 GTGTCACAGAATCCCCTGGCTGG + Intronic
1161584882 19:5100151-5100173 GTGTCCTGAAGTCCCCTCATTGG + Intronic
1162217823 19:9150780-9150802 GTGTCAAGGAGTTCCCACATAGG + Intronic
1163632309 19:18423816-18423838 GTGACACAGGGAGCCCTCATAGG + Intronic
1164800146 19:31069205-31069227 GTGTCTCAGAGCACCCTGATGGG + Intergenic
1202647703 1_KI270706v1_random:157368-157390 GTGTCTCACCTTCCCCTCATGGG - Intergenic
927701453 2:25271494-25271516 CTGTCACACAGTCTCCTCCTGGG - Intronic
928552050 2:32382312-32382334 GTTTCATAGAGTTCCCTCAGAGG - Intronic
933818635 2:86089593-86089615 ATGTCACATAATCCTCTCATTGG + Intronic
938914996 2:135929104-135929126 GTATCACAGGGTCCCTCCATAGG - Intronic
941433182 2:165436176-165436198 CTGTCTCAGCTTCCCCTCATAGG - Intergenic
942219951 2:173759392-173759414 GTGTCACAGAGTCCCTGCCATGG - Intergenic
944539458 2:200742163-200742185 AAGTCACAGGGTCCCATCATGGG - Intergenic
1170112158 20:12817195-12817217 GTGTTTCTGAGACCCCTCATTGG - Intergenic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1170748789 20:19125075-19125097 TTCTCACTGAGTCCCCACATGGG + Intergenic
1171180445 20:23087246-23087268 CTGTCTCAGGGTCCCCTCCTGGG - Intergenic
1172189042 20:33050471-33050493 GTGTGTCAGAGTCCCCTGTTGGG + Intergenic
1174445143 20:50585919-50585941 GTGCCACAGAGTGCCCATATAGG + Intergenic
1175767780 20:61603207-61603229 GTGTCACAGAGTTCCCACTCTGG + Intronic
1176604149 21:8815363-8815385 GTGTCTCACCTTCCCCTCATGGG + Intergenic
1176618231 21:9039318-9039340 GTGTCTCACCTTCCCCTCATGGG + Intergenic
1179365387 21:40754343-40754365 CTGTCACAGAGTCTCCTTCTGGG - Intronic
1179681606 21:43025417-43025439 GTGGCAGAGGGTCCCCTCATGGG - Intronic
1179921730 21:44510999-44511021 GTGTCTCAGAGTCCCCTTGAAGG - Intronic
1180346433 22:11706941-11706963 GTGTCTCACCTTCCCCTCATGGG + Intergenic
1180354202 22:11825094-11825116 GTGTCTCACCTTCCCCTCATGGG + Intergenic
1181409056 22:22705260-22705282 ATGCCACAGTGTCCCCTCCTTGG - Intergenic
1184186217 22:42867022-42867044 GTGTCCCTGAGTCCCCACCTGGG - Intronic
1184913614 22:47552101-47552123 GTGCCCCAGAGCCCCTTCATGGG + Intergenic
1185019570 22:48366320-48366342 GTGGCACAGAGCCCCAGCATGGG + Intergenic
953695720 3:45157248-45157270 GTGTCTCAGACTCCTCCCATCGG + Intergenic
956735179 3:72232733-72232755 GTGTCCCAGAGGTCCCCCATGGG + Intergenic
959964656 3:112339604-112339626 GTGTCTCACAGTCCCCTAAAGGG + Intronic
961166662 3:124768223-124768245 GTGTCTCAGGCTCCCCTCACTGG - Intronic
963727723 3:148940686-148940708 ATGTCACAGAGACACCTCCTGGG + Intergenic
964529492 3:157651740-157651762 CTCTCACAGAGGCCCCTCAATGG - Intronic
965656371 3:170989393-170989415 GTGCCACAGAGCCCACTCAGGGG - Intergenic
967594680 3:191315335-191315357 GGGTCACAGAACCCCCTCCTTGG - Intronic
967846943 3:194051759-194051781 GTGACACAGAGTCACCTCCCAGG + Intergenic
968046542 3:195626872-195626894 GTGTCACTGCGTCCTCACATGGG - Intergenic
968308111 3:197663169-197663191 GTGTCACTGCGTCCTCACATGGG + Intergenic
970848079 4:20566974-20566996 GTGTCACAGAGTCCCCTCATGGG - Intronic
972220588 4:36950080-36950102 GTGACACAGAGTCCCCACTGGGG - Intergenic
973127669 4:46607973-46607995 TTGTCACAAACTCCCCTCCTAGG - Intergenic
973373968 4:49275557-49275579 GTGTCTCACCTTCCCCTCATGGG - Intergenic
973383444 4:49334682-49334704 GTGTCTCACCTTCCCCTCATGGG + Intergenic
973387051 4:49519696-49519718 GTGTCTCACCTTCCCCTCATGGG + Intergenic
976761307 4:88552317-88552339 GTGTCTCAGAGTCCATTCTTTGG + Intronic
983683043 4:170374584-170374606 GTGCCACAGAGTCCACTCAGAGG - Intergenic
985785050 5:1888959-1888981 GTGCCCCAGAGTCCGCCCATGGG - Intergenic
986372557 5:7094175-7094197 GTGTTACAGAGTTCCCTCTCAGG + Intergenic
991651840 5:68863530-68863552 GTGTCAGAGAGTGCCCTCTGTGG - Intergenic
995538946 5:113165573-113165595 GTGTCACAGAGTCCCTGTAACGG - Intronic
997426912 5:133809480-133809502 GTGTCCCAGCATCCCCTCCTGGG + Intergenic
1007239480 6:40414743-40414765 GTGTCACAGTGACCCCGCCTGGG - Intronic
1010087556 6:71938331-71938353 CTGCCACAGAGTCCCCACAAGGG - Intronic
1014222146 6:118808521-118808543 CATTCACAGAGTCCCCTCAAAGG + Intergenic
1016367384 6:143334297-143334319 GTGTCACAGAGTCCATTTACTGG - Intronic
1020246814 7:6435691-6435713 GTATCACAGAGTACTCTGATAGG + Intronic
1021948954 7:25755308-25755330 GTGGCACAGATTCCCATCCTGGG + Intergenic
1024026455 7:45413785-45413807 GTGTTACTGAGTGCCTTCATGGG - Intergenic
1024197521 7:47073538-47073560 GTGTCACCGAGGCCCAGCATGGG + Intergenic
1034055963 7:148035375-148035397 GAGTCTCAGAGTGCCCTCCTTGG + Intronic
1034394806 7:150814190-150814212 GTATAACAGAGTCCCCAAATGGG + Intergenic
1034536047 7:151726513-151726535 CTGTGACAGAGTGCTCTCATGGG - Intronic
1037493728 8:19419547-19419569 CTTTCACAGACTCCACTCATAGG - Intronic
1037773016 8:21813957-21813979 GTGTCACAGAGTGGCCTTGTGGG - Intergenic
1041699517 8:60772901-60772923 GTGTCTCAGATTCCTCTAATGGG + Intronic
1046876973 8:119265893-119265915 CTGCTAGAGAGTCCCCTCATGGG - Intergenic
1047178245 8:122562449-122562471 GTTTCACACAGTCTTCTCATGGG + Intergenic
1048847048 8:138611748-138611770 GAGTCACAGTCTCCCCTGATGGG - Intronic
1049447967 8:142640275-142640297 GGGTCTCTGAGGCCCCTCATGGG - Intergenic
1052835246 9:33245498-33245520 GTGTGCCAGGGTCCCCTCTTTGG - Intronic
1054350958 9:64016513-64016535 GTGTCTCACCTTCCCCTCATGGG + Intergenic
1054980999 9:71205897-71205919 GTGTGAAAGAGTCACCTCAAAGG + Intronic
1057020395 9:91692899-91692921 GTCTCACAGAGTGGCCTCCTTGG - Intronic
1059697819 9:116745437-116745459 CTGTCACTGAGTCCCTTCTTTGG + Intronic
1060187511 9:121572753-121572775 GAGTCACAGACTCCCCTGACAGG - Intronic
1060380043 9:123160384-123160406 GTGCAACAGAGTCCCCACATGGG - Exonic
1062284864 9:135768373-135768395 GAGTCACAGTGCCCCCTCAGTGG - Intronic
1062378497 9:136275685-136275707 GGGTGACATTGTCCCCTCATGGG + Intergenic
1203697649 Un_GL000214v1:113469-113491 GTGTCTCACCTTCCCCTCATGGG - Intergenic
1203551556 Un_KI270743v1:167518-167540 GTGTCTCACCTTCCCCTCATGGG + Intergenic
1187078577 X:15961900-15961922 GTGTTACAGAGTCCACTAAATGG - Intergenic
1187290442 X:17948296-17948318 ATCTCCCAGAGTCCCCTCGTGGG + Intergenic
1187985428 X:24805383-24805405 GTGACACCGAGTCTCCTGATTGG + Intronic
1194592791 X:95820318-95820340 GTGTTCCACAGTCCCCTAATAGG - Intergenic
1199460974 X:148084480-148084502 GTGACACAGTGTGCTCTCATGGG + Intergenic
1201143124 Y:11044842-11044864 GTGGCACAGAATCCCCTGAGAGG - Intergenic
1201151620 Y:11098155-11098177 GTGTCTCACCTTCCCCTCATGGG + Intergenic