ID: 970848877

View in Genome Browser
Species Human (GRCh38)
Location 4:20577697-20577719
Sequence GACTGATGATCTATAGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970848877_970848879 -4 Left 970848877 4:20577697-20577719 CCCTGTGCTATAGATCATCAGTC 0: 1
1: 0
2: 1
3: 6
4: 83
Right 970848879 4:20577716-20577738 AGTCTCTCTGCCACACTGCATGG No data
970848877_970848880 4 Left 970848877 4:20577697-20577719 CCCTGTGCTATAGATCATCAGTC 0: 1
1: 0
2: 1
3: 6
4: 83
Right 970848880 4:20577724-20577746 TGCCACACTGCATGGTCTGTAGG 0: 1
1: 0
2: 1
3: 5
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970848877 Original CRISPR GACTGATGATCTATAGCACA GGG (reversed) Intronic
903555163 1:24187581-24187603 GGCTGATGATCAATAACCCACGG + Intronic
906867003 1:49432814-49432836 GATTGATGGTCTAGAGCACTTGG + Intronic
907212134 1:52833019-52833041 GACTACTGAGCTACAGCACACGG + Intergenic
912119684 1:106455033-106455055 AACTAATGACCCATAGCACAAGG + Intergenic
915095801 1:153461259-153461281 GACCCAAGACCTATAGCACAGGG - Intergenic
921077125 1:211708781-211708803 CACTGCTGAGCTAGAGCACAGGG - Intergenic
922911292 1:229220057-229220079 GGCTGATGATTGATAGCATAAGG - Intergenic
1067912856 10:50364538-50364560 TACTGAGGACCTAAAGCACAAGG + Intronic
1068092225 10:52446499-52446521 GATTAATGATCTATATCAGACGG - Intergenic
1068274774 10:54779951-54779973 GAATCATAATTTATAGCACATGG + Intronic
1068369066 10:56090634-56090656 GACTGATGACTTATAGTACCAGG + Intergenic
1072247231 10:93554568-93554590 GACAAATGATCTATATCTCAAGG + Intergenic
1080281549 11:30563181-30563203 GACTGCTGATCTATAGGACAGGG - Intronic
1083320063 11:61840313-61840335 GACTGTTGACCAAGAGCACAGGG - Exonic
1085883467 11:80496047-80496069 CTCTGATGATCTATACCAGATGG - Intergenic
1090104676 11:123839958-123839980 GACTGATCATCTATAGCAACTGG - Intergenic
1091316389 11:134616950-134616972 GAGTGATGACCTATAACACCTGG + Intergenic
1091738098 12:2939883-2939905 GAGAGATGATTTAAAGCACAGGG + Intronic
1095385904 12:41649446-41649468 GACTCATGACTTATACCACATGG - Intergenic
1095729827 12:45494293-45494315 CACTGATGTTCTCCAGCACATGG + Intergenic
1098418889 12:70269821-70269843 GACTGAAGATTTATAGAACCTGG + Intronic
1099475885 12:83107093-83107115 GACTGAGGATGTATGGCTCAGGG + Intronic
1100941883 12:99732144-99732166 GACTGATGATATATATAGCAAGG + Intronic
1106721809 13:32442238-32442260 GAGTGAGGATCCATAGCAAACGG - Intronic
1110187537 13:72692700-72692722 GAGTGATGATTTATAGCATCTGG + Intergenic
1111106162 13:83648379-83648401 AACTCAAGATCTCTAGCACAAGG - Intergenic
1112963341 13:105156209-105156231 GATTAATGAGCTATAGAACAGGG + Intergenic
1113108327 13:106795271-106795293 AATTCATGATTTATAGCACAAGG + Intergenic
1122100162 14:99402137-99402159 GACTGAAGACCTTTAGCATAGGG - Intronic
1125151944 15:36542499-36542521 GTCTGATGATCAATTGGACATGG + Intergenic
1129958480 15:79661297-79661319 GACTGACCATCTAAAGCACATGG + Intergenic
1131913961 15:97241380-97241402 GACTGGGGATTTAGAGCACACGG - Intergenic
1138210664 16:55160335-55160357 GTCTGATTATCTCTAGGACATGG - Intergenic
1139640555 16:68288546-68288568 GACTGATGACCTAGAGAACTGGG - Intronic
1140719277 16:77756487-77756509 CACTGATGATCAATAGCCAAAGG - Intergenic
1140827331 16:78718903-78718925 GACTCATGACCTAAAGAACATGG + Intronic
1145818299 17:27811443-27811465 GCCGGATGATCTAATGCACATGG + Intronic
1155755061 18:29482596-29482618 GACTGAAGATCTATTCCAAATGG - Intergenic
1156618410 18:38817533-38817555 CATTGGTGGTCTATAGCACATGG + Intergenic
1156636298 18:39033852-39033874 GACTTCTGATCTATAACATATGG + Intergenic
1159479928 18:68976944-68976966 CACTGATAATTTATACCACAAGG + Intronic
1165650594 19:37485221-37485243 GACTCAGGATCTATAGGACTTGG - Exonic
927801065 2:26100084-26100106 TACTGATGATCTGTTGCCCAGGG + Intronic
934519686 2:95012164-95012186 GACTGATGACCAAGAGAACAAGG - Intergenic
945205825 2:207331153-207331175 GAGCAATGAGCTATAGCACAGGG + Intergenic
945351071 2:208781228-208781250 GACTGATGATCTGAAACTCAGGG - Intronic
1178170521 21:30034934-30034956 AACTGGTGATGTATAGGACAGGG - Intergenic
949538443 3:5013507-5013529 GACTGATTATCTACATCACTGGG + Intergenic
951127594 3:19002056-19002078 GACTGATGATTTAAATTACAGGG + Intergenic
951244137 3:20320695-20320717 GGCTCATGTTCTACAGCACAGGG + Intergenic
957403235 3:79743858-79743880 GACTGCAGAACAATAGCACACGG + Intronic
960631421 3:119735790-119735812 GGCTGATTATATATAGCACTTGG - Intronic
964241719 3:154601943-154601965 GAGTGATGATCTATGGTACCTGG - Intergenic
964714778 3:159710460-159710482 TTCTGATGATCTATTGCACAAGG + Intronic
966990278 3:185222787-185222809 GAATGATGATCTAAATCTCAGGG - Intronic
967156048 3:186693354-186693376 GACTGCCAAGCTATAGCACATGG + Intergenic
967993353 3:195148220-195148242 GACTTCTGATCTCTACCACAGGG + Intronic
969511920 4:7623002-7623024 GACTGATGACCGATGGCATATGG + Intronic
970848877 4:20577697-20577719 GACTGATGATCTATAGCACAGGG - Intronic
971135596 4:23864763-23864785 GGCTGTTAATCTTTAGCACAAGG - Intronic
977495164 4:97766187-97766209 GACAGTTGGTCTATAGGACATGG - Intronic
977642912 4:99377500-99377522 GCCTGATGATCTAAAACAGATGG - Intergenic
979657187 4:123209163-123209185 GACTGATGAGCTATAAATCAGGG - Intronic
983682342 4:170368251-170368273 GTGTGGTGATCTACAGCACATGG - Intergenic
988575643 5:32421356-32421378 GATTAATGGTCTATAGTACAAGG + Intronic
989300406 5:39884919-39884941 GACTTTTGACCTATAGCACTGGG + Intergenic
989627472 5:43444099-43444121 GACTGCTGATTTAGAGGACAAGG + Intergenic
993241266 5:85389378-85389400 AATTGATGATCTATAGTACTTGG + Intergenic
1001110553 5:168892791-168892813 GACTGATCATCTCCAGCAAATGG + Intronic
1002863296 6:1099004-1099026 GAGTGATGATATATAGGAGAAGG - Intergenic
1003302285 6:4894360-4894382 GACTGATGAGCTATAGTCCGTGG + Intronic
1005795512 6:29357110-29357132 GATTGATGATCTATAGCAATAGG - Intronic
1009920982 6:70060895-70060917 GACCGATGCTCTAGAGCTCACGG + Intronic
1011309447 6:85966049-85966071 AACTGATGAACTATAGCATAGGG + Intergenic
1013661835 6:112305894-112305916 AACTAATGATCTATAACACCTGG - Intergenic
1015124134 6:129733722-129733744 AACTGATTGTCTATAACACATGG + Intergenic
1015479601 6:133693096-133693118 TACTGATGATTTAGAGCAAATGG - Intergenic
1028883127 7:95902434-95902456 GCATGATGTTCTACAGCACAAGG + Intronic
1043595208 8:81877800-81877822 GACTGCTGATCTTTAGTAGAGGG + Intergenic
1044914564 8:97098632-97098654 CACTGATGTTCTCTGGCACAAGG + Intronic
1044949257 8:97419285-97419307 CACTGATGTTCTGTGGCACAGGG - Intergenic
1047813751 8:128439373-128439395 TACTCATGATCTATATCCCATGG + Intergenic
1055917904 9:81425582-81425604 GAGGGAGGATCTATAGGACATGG - Intergenic
1058709376 9:107666218-107666240 GAATGATGATCTATTAGACATGG - Intergenic
1058935752 9:109767846-109767868 GGCAGCTGATCTCTAGCACATGG + Intronic
1186625855 X:11292713-11292735 TACTGATGATCTATACTACAAGG - Intronic
1187006294 X:15236058-15236080 ATCTGATGATCTAGAGCAGAAGG + Intronic
1188098469 X:26051822-26051844 GAATGAGGCCCTATAGCACAAGG + Intergenic
1188402754 X:29767565-29767587 GACTTATGTTCTATATCACTTGG - Intronic
1192224849 X:69221292-69221314 GACTGATGCTGGAGAGCACATGG + Intergenic
1199419457 X:147627497-147627519 GACTCAGGATCCATAGGACAAGG - Intergenic