ID: 970849467

View in Genome Browser
Species Human (GRCh38)
Location 4:20583868-20583890
Sequence CTAAAATGAAGCAGAAGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 378}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970849467 Original CRISPR CTAAAATGAAGCAGAAGGTA AGG Intronic
900515645 1:3081005-3081027 CTAAAAAAAAGCAGAGAGTAAGG + Intronic
904546793 1:31280578-31280600 TTACTATAAAGCAGAAGGTAAGG + Intronic
905889088 1:41508537-41508559 CAAAAATGAGACAGAAGGCAGGG - Exonic
905903774 1:41601805-41601827 CTAAAATCAGGAAGAAGCTAAGG - Intronic
905971112 1:42143183-42143205 ATAAAATGAGGCAGAAGCAATGG - Intergenic
907101265 1:51838661-51838683 CTAAAATCACGCAGAAAGAAAGG + Intronic
907736955 1:57122760-57122782 CTAGAATGAAGAACAAGGAAGGG + Intronic
907848642 1:58233123-58233145 TTAATGTGAAGCAGAAAGTAGGG + Intronic
908681600 1:66667905-66667927 ATAAAATGAATAAGAATGTAAGG + Intronic
908701581 1:66908058-66908080 CTGAAATGAAGGGAAAGGTATGG - Intronic
910496493 1:87834808-87834830 CCAAAAGAAAACAGAAGGTATGG + Intergenic
911029924 1:93475820-93475842 CTAAAAGGAAACATAAAGTAAGG + Intronic
912757408 1:112335914-112335936 CTATAATGCAGGAGAAGGAAGGG - Intergenic
912770676 1:112461882-112461904 CTAAGATGAACCAGAAAGCAAGG + Intronic
912808689 1:112776894-112776916 ATAGAATGAAGCAGAAGTGATGG + Intergenic
913273324 1:117115447-117115469 CTAAAGTGAAGAAGAAGACATGG + Intronic
916148213 1:161760410-161760432 CTAATACGATACAGAAGGTAGGG - Intergenic
916205722 1:162314481-162314503 ATAAAATGAAGCACAGAGTAAGG - Intronic
916826579 1:168447725-168447747 CTAAAATGAAGGACTTGGTAGGG + Intergenic
917215325 1:172672224-172672246 CTAAAAAGAAAAACAAGGTAAGG + Intergenic
917831270 1:178890006-178890028 CTTAAATGAACCAGAACTTAAGG - Intronic
918662566 1:187107342-187107364 CTGAAATGAAGAAGGAGGCAAGG - Intergenic
918867919 1:189927089-189927111 CAAAAATTAAGCAAAAGGTGCGG + Intergenic
919441280 1:197636378-197636400 CTATATTGGGGCAGAAGGTAAGG + Intronic
919540342 1:198837470-198837492 CTAAAATGCTGCAGAGGATATGG + Intergenic
920341551 1:205278272-205278294 AGAAAATGAAGAAGAAGGAAGGG - Intergenic
920737941 1:208552240-208552262 AGAAAAGGAAGCAGAAGGAAGGG - Intergenic
920761597 1:208788343-208788365 TTATAAGGAAGCAGAAGGAAGGG - Intergenic
921758104 1:218882399-218882421 CTGAGATGACCCAGAAGGTATGG - Intergenic
922710805 1:227829865-227829887 CTAAGATGAAGAACAAGGCAAGG - Intronic
922990525 1:229906626-229906648 TTAAAAGGAGGCAAAAGGTATGG + Intergenic
923071695 1:230571076-230571098 CTAAAATGGAGCAGGAGGCAGGG - Intergenic
924274850 1:242375274-242375296 TTAAAATGAGGCAGACGGCACGG - Intronic
924556464 1:245123192-245123214 CCAAAATGAAGCAAAACCTACGG - Intronic
1063441255 10:6075197-6075219 CCAAAGTGGAGCAGAGGGTATGG + Intergenic
1063535091 10:6875761-6875783 TTAAAATGAAGTAGAAGGAGGGG - Intergenic
1063651389 10:7941113-7941135 CAAATATGAAGCTGAAGGTAAGG + Intronic
1063961311 10:11307635-11307657 ATACAATGAAACAGAAGGTTGGG + Intronic
1065619251 10:27562823-27562845 CTAAAATCATGAAAAAGGTAAGG - Intergenic
1065873563 10:29977291-29977313 CAGAAATTAAGCAGAAGGGAGGG + Intergenic
1069178823 10:65330206-65330228 ATAAAATGAAGCAGATGGAATGG + Intergenic
1070095101 10:73329677-73329699 TTAAAAGGAATCAGAAGCTATGG + Intronic
1070126290 10:73625221-73625243 CTAAAATAAAGCGCAGGGTAGGG - Intronic
1070217378 10:74400888-74400910 AGAAAATGAAGAAGAAGGTTTGG - Intronic
1070542367 10:77425417-77425439 CAAACATGAAGGAGAAGGCAGGG - Intronic
1071112698 10:82178805-82178827 CTAAAATGGTGCAGATGCTATGG - Intronic
1071714813 10:88084958-88084980 CAAAAAAGTGGCAGAAGGTAGGG + Intergenic
1071734635 10:88284612-88284634 ATAAAATATAGCAAAAGGTAAGG + Intronic
1074194571 10:111171067-111171089 CTAAACTGAAGCAGAGAGAAGGG - Intergenic
1074358066 10:112803361-112803383 CTAAAATGAAGAAGGAGGCTGGG - Intronic
1074379833 10:112970349-112970371 CTAAGACCAAGCAGAAGGTTAGG - Intronic
1074562928 10:114550425-114550447 GCAAAATTGAGCAGAAGGTACGG + Intronic
1074919416 10:117992359-117992381 GTAAAATGAAGAAGTAGGTTGGG - Intergenic
1074952533 10:118352815-118352837 CTCAGAAGAAGCAGAAGGCAAGG - Intergenic
1075270018 10:121041549-121041571 CTAAAATGAAAGAAAAAGTAGGG + Intergenic
1076337963 10:129721836-129721858 CTAAAATGTAAAAGAAGATAGGG + Intronic
1076895701 10:133310272-133310294 CCAAAGAAAAGCAGAAGGTAGGG + Exonic
1077470509 11:2757035-2757057 CTAAAATAAAAAAGAAGGCAAGG + Intronic
1078647705 11:13157331-13157353 CTAAAATGCATCAGAAGTTACGG + Intergenic
1078685576 11:13527791-13527813 AGAAAGTGTAGCAGAAGGTAGGG + Intergenic
1078725071 11:13923035-13923057 CAAAAATGACTCAGACGGTAAGG + Intergenic
1078735986 11:14021405-14021427 CAGAAATGAAGCAGAAGTCAGGG + Intronic
1079139727 11:17800201-17800223 GTAAAATTAAGCAGAAAGTATGG + Intronic
1079170086 11:18085125-18085147 CTAAAATCAGGAAGAAGGTAAGG + Intronic
1079333906 11:19554624-19554646 ATAAAATGAGGGAGTAGGTAAGG + Intronic
1080768580 11:35319481-35319503 TTCAAATGAAGCAGAAGGCAAGG - Intronic
1086033284 11:82385444-82385466 CAAAAATGAAGGATAAGGAAAGG + Intergenic
1087942726 11:104118594-104118616 CTAAAATGAAGAGCAAGGCAAGG - Intronic
1088007440 11:104960147-104960169 CAAGAATGAATGAGAAGGTAGGG - Intronic
1088677464 11:112209000-112209022 GAAAAATCAAGCAGAAAGTATGG + Intronic
1089894743 11:121918860-121918882 GGAAGATGAAGCAGAAGGCACGG - Intergenic
1092762137 12:11819751-11819773 CTGAACTAAAGCAGAAGGGATGG - Intronic
1093013338 12:14131105-14131127 CTAAAACCAAGCAGAAAATAGGG - Intergenic
1093405556 12:18800255-18800277 CTAAGATGAAGAACAAGGAAAGG - Intergenic
1094784832 12:33835791-33835813 CTATAATAATGAAGAAGGTATGG + Intergenic
1095136137 12:38606318-38606340 CTAAGATGAAGAATAAGGCAAGG + Intergenic
1097410033 12:59240745-59240767 CCAAAATAAAGCAGAATCTATGG - Intergenic
1098611762 12:72467464-72467486 CTAAAATGTAGCGGAAGATGGGG + Intronic
1098785305 12:74745862-74745884 CTAAAATGAAACAGAACATTAGG - Intergenic
1098868659 12:75790483-75790505 CTAAAATGAAGGTGAAAGAAAGG - Intergenic
1099100115 12:78428932-78428954 ACAAAATGAAACAGAAGTTATGG + Intergenic
1099810096 12:87569469-87569491 ATAAAATGAAGCAAAAGAGATGG - Intergenic
1100147349 12:91694169-91694191 CTAAGATCAAGAACAAGGTAAGG + Intergenic
1101031272 12:100662716-100662738 CTAAGATGAAGCATAAGTTTTGG + Intergenic
1101133606 12:101715312-101715334 CTAAAAAGAATCAGTAGGCATGG - Intronic
1101136174 12:101745375-101745397 CTAAAATTAAGTGGAAAGTAAGG - Intergenic
1101869464 12:108552294-108552316 CTAAAATCAAGAACAAGGCAAGG + Intronic
1101973987 12:109338798-109338820 AGAAAATGAAGCAGAAAGCAAGG - Intergenic
1102109887 12:110357053-110357075 TTAGAATGCAGCAGAAGGTGAGG + Intergenic
1102799825 12:115722426-115722448 CTAATCTGTAGAAGAAGGTAGGG - Intergenic
1103682391 12:122704759-122704781 GCAAAATGGAGCAGAAAGTACGG + Intergenic
1105736687 13:23278771-23278793 CAAAAGTGAAACAGAAGGCATGG + Intronic
1105952055 13:25238049-25238071 CTAAGATCAAGAAGAAGATAAGG + Intergenic
1106149069 13:27080369-27080391 GGAAAATGAAGCAAAAGGTAGGG + Intronic
1106960943 13:34997091-34997113 ATAAACTGGAGAAGAAGGTAAGG - Intronic
1106970168 13:35130181-35130203 GTAAAATTGAGCAGAATGTAGGG - Intronic
1108987173 13:56606682-56606704 CTAAAATTAAACAGCAGTTATGG + Intergenic
1109089550 13:58023242-58023264 CTTAAATTGAGCAGAATGTAGGG + Intergenic
1109869760 13:68319249-68319271 TTCAAATGCAGCAGAAGGTCGGG + Intergenic
1111404680 13:87787981-87788003 ATGAAATGAAGCAGAGGGGAAGG - Intergenic
1111528080 13:89499319-89499341 TTAAAAGTAAGCAGTAGGTATGG - Intergenic
1111658055 13:91176289-91176311 CAAAAATGAAGGACAGGGTAAGG - Intergenic
1112639157 13:101253465-101253487 CTATAATGATGCAGTATGTAAGG - Intronic
1113001901 13:105648933-105648955 CTAAAATGAGGGAGAAATTAAGG + Intergenic
1114568670 14:23650401-23650423 CTAAATTGTATCAGAAGGTGTGG + Intergenic
1115208694 14:30942443-30942465 ACAAAATGAAGCCAAAGGTAAGG + Intronic
1115341562 14:32298184-32298206 CCAAAAAGAAGGAGAAGGAAAGG - Intergenic
1116030092 14:39560974-39560996 CTGAACTGAAGCTGGAGGTATGG + Intergenic
1119253753 14:73180278-73180300 CTAAAATGAAGGATAAGGCTGGG - Intronic
1120067902 14:80066173-80066195 TTAAAAAGAAGCAGGAGCTAGGG + Intergenic
1120234174 14:81871768-81871790 CTACAATGAATAAGAAGGGAAGG - Intergenic
1120304980 14:82758243-82758265 CTAAACTGAAGAGGAAAGTATGG - Intergenic
1120747695 14:88166788-88166810 CTAAAATGGAACAGACGGGAGGG + Intergenic
1124258224 15:28163252-28163274 CCAAAATAAAGCAGCAGGTCCGG - Exonic
1125926483 15:43567451-43567473 CTGAAATGAGGAAGATGGTATGG - Intronic
1125939627 15:43667016-43667038 CTGAAATGAGGAAGATGGTATGG - Intronic
1126342259 15:47654095-47654117 CTAAAATGAAGAAGAAAGAAGGG + Intronic
1127102504 15:55581863-55581885 CTAAAATAAAGCAGCAGCTATGG + Intronic
1127278827 15:57471451-57471473 CCAATAAGGAGCAGAAGGTAGGG + Intronic
1127326842 15:57904055-57904077 CTAAATTGGAGCAGAGGGTCAGG + Intergenic
1127408207 15:58675878-58675900 CCAAAAAGAAGCAAATGGTAGGG - Intronic
1127641866 15:60923737-60923759 CATAAATGACACAGAAGGTATGG - Intronic
1128808297 15:70551127-70551149 CTCAAATGAAGCAGAAGGGAAGG + Intergenic
1129095747 15:73205659-73205681 CTTACATGAAGCAGAAGCCATGG - Intronic
1129928933 15:79392532-79392554 CTAAAATTAAGATGAAGGAAAGG - Intronic
1131335366 15:91543941-91543963 CTAAAATGTACCTGAAAGTAAGG + Intergenic
1133336851 16:5011874-5011896 CAGAAATGAAGGAGAAGGTCTGG + Intronic
1133584314 16:7177644-7177666 CTAGATTGAACCAGGAGGTAGGG + Intronic
1134289749 16:12894437-12894459 ATAAAATGTAGCAGAAGTGATGG + Intergenic
1134911723 16:18033103-18033125 CTAAGAGGAAGGAGAAGGAAGGG - Intergenic
1137336594 16:47555212-47555234 ATAAAATGAAGCAGAATGGTTGG - Intronic
1137362851 16:47835509-47835531 CAAAAATGAAGGAGAAATTAAGG + Intergenic
1137940794 16:52681905-52681927 ATAAAATGAAGCAAAAAGTGGGG - Intergenic
1140642871 16:76997476-76997498 CTAGCATGAAGCAGAAGAGATGG - Intergenic
1140993595 16:80238451-80238473 CTAAGATCAAGCATAAGGCAAGG - Intergenic
1141072773 16:80973235-80973257 TTAATATGAGGCAGAAGGAAGGG - Exonic
1141280003 16:82622877-82622899 ATGAAATGAAGCAGAAGGGATGG - Intergenic
1143005922 17:3833919-3833941 CTAGAATGCAGCAGAAAGCAAGG - Intronic
1143877473 17:10003104-10003126 GTAACATGAAGCAGAAGGCTGGG + Intronic
1144115674 17:12087540-12087562 ATAATACGTAGCAGAAGGTAAGG + Intronic
1145834308 17:27942518-27942540 ATAAAATATAGCAGAAGTTATGG + Intergenic
1147795505 17:43039573-43039595 CTGAAAAGGAGCAGCAGGTAAGG + Intergenic
1147813312 17:43189563-43189585 AGAATATGGAGCAGAAGGTAGGG - Intronic
1148822635 17:50368454-50368476 CAATAAAGAAGCAGAAGGTTTGG - Intronic
1149487049 17:57050666-57050688 ATAGAATGCAGCAGAAGGGATGG - Intergenic
1149767674 17:59293215-59293237 CTAGAATGAAGAATAAAGTAAGG - Intergenic
1149961778 17:61117728-61117750 GCAAAATTAAGCAGAAGGTGGGG + Intronic
1150517060 17:65824887-65824909 GTAAAATGATGCAGATGCTATGG + Intronic
1150529451 17:65961457-65961479 CTGAAATGAAAGAGCAGGTAAGG - Exonic
1151132319 17:71909872-71909894 GTAAAATAGAGCAGAAGATAAGG - Intergenic
1153095865 18:1402137-1402159 CTGAAATGAAGCAAAAGGTCTGG + Intergenic
1154471406 18:14705885-14705907 CTAAAAGGAAGTGGAAAGTAAGG - Intergenic
1156045130 18:32869532-32869554 ATAAAATGAGGAAGAAGGAAGGG + Intergenic
1156518447 18:37700718-37700740 CTAGACTGTAGCAGCAGGTAGGG - Intergenic
1156838372 18:41582670-41582692 ATAAAATGATGCAGAATGAATGG - Intergenic
1156850358 18:41718787-41718809 GTAAAATGCAGCACAAGGTCAGG + Intergenic
1158171801 18:54608024-54608046 CTAAAATGAAGTAGAAAGATGGG - Intergenic
1158415484 18:57246503-57246525 CTAAAAAAAAGAAGAAGGAAGGG + Intergenic
1158820185 18:61150421-61150443 CTAAGATGGAGCAGAAAGTCAGG - Intergenic
1161553015 19:4924638-4924660 GCAAAATTGAGCAGAAGGTACGG + Intronic
1163793005 19:19319279-19319301 CAAGGATGAAGCAGAAGGGAGGG - Intronic
1165292117 19:34895102-34895124 CTAAAATTAAGAACAAGGCAAGG + Intergenic
1166516713 19:43452625-43452647 GTGAAAGGAAGCAGAGGGTAGGG + Intergenic
1166759609 19:45216279-45216301 CTAAAATGTAGCAGAAACCAGGG + Intronic
924997023 2:371069-371091 CTAAAATCCAAAAGAAGGTAAGG - Intergenic
925534284 2:4900009-4900031 CTTAATTGAAGGAGGAGGTAGGG - Intergenic
930322358 2:49872539-49872561 CTAAAATTCAGAACAAGGTATGG - Intergenic
930373554 2:50535615-50535637 TAAAAATAAAGCAGAAGGGAAGG + Intronic
930530590 2:52583374-52583396 TTAAAAAGAAGCAGAATGTTTGG - Intergenic
931318171 2:61151777-61151799 CTAAAATGAAGCAAAAGTGAGGG - Intronic
931387304 2:61809227-61809249 CTGAGAAGAAGCAGCAGGTAAGG - Intergenic
931657164 2:64520131-64520153 CTAGAATAAAGAAGAAGGTTGGG + Intergenic
932521531 2:72419530-72419552 CAAAAGTGAAGGAGAAAGTAAGG - Intronic
932857705 2:75254827-75254849 CTAAAAGTAAGCAGAGTGTAAGG - Intergenic
933263006 2:80151031-80151053 CAAAAATGAAGAAGTAGGCAGGG + Intronic
933397150 2:81747631-81747653 CTTAAAGGCAGCAGAAGGTTAGG + Intergenic
933555634 2:83826925-83826947 GGAAAATGGAGCAGAAGGTCCGG - Intergenic
933599552 2:84315803-84315825 GAACAATGAACCAGAAGGTAGGG + Intergenic
933982460 2:87563030-87563052 CTAAAATCAAGAATAAGGCAAGG + Intergenic
935158826 2:100511182-100511204 CCCAAATCAAGCAGAAGGAAGGG + Intergenic
935282845 2:101534055-101534077 TTAAAACGAAGCAGTAGGCATGG + Intergenic
935428845 2:102950976-102950998 CTAAATTGAAGCAAAGGGTCTGG - Intergenic
936311383 2:111387763-111387785 CTAAAATCAAGAATAAGGCAAGG - Intergenic
936736733 2:115453080-115453102 TTAAAATCAAACATAAGGTAAGG - Intronic
937595759 2:123671120-123671142 ATAAAATCATGCAGAAGATATGG + Intergenic
938111008 2:128565002-128565024 CTAATATGAAGCACTAGTTATGG + Intergenic
940968940 2:159872889-159872911 ATAAAATGAACCAGGAGGCAAGG + Intronic
941480560 2:166004530-166004552 ATTAAATGAAGGAGAAGGTTAGG - Intronic
941570577 2:167164754-167164776 GAAAAATTAAACAGAAGGTATGG + Intronic
941573253 2:167197792-167197814 CTCAAGTGAAGTAGAAGATAAGG - Intronic
942413927 2:175738689-175738711 TTTAAATGAAGCAGAGGCTATGG - Intergenic
943022150 2:182588401-182588423 TTAAAATGTAGCAGAATTTATGG - Intergenic
943506192 2:188761784-188761806 GTAAAATGAAGTACAATGTATGG + Intronic
944381951 2:199120886-199120908 GTAAAAGGAAACAGAATGTATGG - Intergenic
944548388 2:200821289-200821311 CAAAAATGCTGAAGAAGGTAAGG + Exonic
944930974 2:204518831-204518853 CTAAAATGATTGAGAAGCTATGG + Intergenic
945829845 2:214770520-214770542 TTAAAATGAGGCACAAGGCAAGG + Intronic
946309653 2:218876325-218876347 TTCAAATGAAACAGAAGGAAAGG + Intergenic
948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG + Intronic
948424558 2:237878827-237878849 CTGAACTGGAGCAGAGGGTACGG - Intronic
948435983 2:237954919-237954941 CTAAAACGAAAAAGATGGTAAGG - Intergenic
949057458 2:241936427-241936449 CTAAACAGAAGCAGAGGGAAGGG + Intergenic
1169333011 20:4731115-4731137 CAAGAACGAAGCAGAGGGTAAGG + Intergenic
1169479662 20:5967571-5967593 CTCAAATGCGGAAGAAGGTAGGG + Exonic
1170147152 20:13188129-13188151 CTAAGATTAAGAAGAAGATAAGG + Intergenic
1172016206 20:31874952-31874974 CTAAAATGAAGGTGACGGCAGGG - Intronic
1172397164 20:34616579-34616601 CTAAATTGATGCAGCAGGTAAGG - Intronic
1173132427 20:40407316-40407338 ACAAAATGATGCAGAATGTAGGG - Intergenic
1174889030 20:54369596-54369618 ATAGAATGCAGCAGAAGTTATGG - Intergenic
1175255298 20:57641442-57641464 CTAAAATTAGGAAGAAGGCAAGG + Intergenic
1176965708 21:15209341-15209363 CCAAAAGGAAGAAGAAGGGAAGG + Intergenic
1177383203 21:20372179-20372201 CTAAAATCAAGGTGTAGGTAAGG - Intergenic
1178558914 21:33619452-33619474 CTAAAATGAAGCAGGAGGATAGG - Intronic
1180556124 22:16576978-16577000 CTAAAATCAAGCAGAAGAAATGG - Intergenic
1180893188 22:19306555-19306577 CTAAAATTCAGCAGAAAGTACGG - Intergenic
1181777314 22:25169021-25169043 CTCAAATGGAACAGAACGTAAGG + Intronic
1182183902 22:28381485-28381507 CTAAAATGCAGCAGACAGGAAGG - Intronic
1184303299 22:43576865-43576887 CTTAAAGGAAGTAGAATGTAAGG - Intronic
1185238983 22:49731155-49731177 GTAAAATGATGCAGCAGCTATGG - Intergenic
950108180 3:10401540-10401562 GTAAGGTGAGGCAGAAGGTAGGG - Intronic
951043975 3:18018055-18018077 TTAAAATGTAGCAGAAGGGATGG + Intronic
951255888 3:20448618-20448640 CTCAAAAGAAACAAAAGGTATGG - Intergenic
951924519 3:27893298-27893320 CAAAAATGAAGAAGAAATTAAGG + Intergenic
951927482 3:27924468-27924490 CTAAAATAAAGCAGAAGAAGAGG + Intergenic
952156877 3:30653088-30653110 CTAAAATGCTCCAGAAGGTAGGG + Intronic
952272768 3:31848781-31848803 TTAAAATGAAACAGAAGGAAAGG + Intronic
952626042 3:35404678-35404700 TAAAAATGAAGCAGCACGTAGGG + Intergenic
952976874 3:38704181-38704203 CCACCATGAAGCAGAAGGCAAGG - Intronic
955374135 3:58380065-58380087 GTAAAAGAAAGCAGAAGGCATGG + Intronic
955445437 3:59005095-59005117 ACAAAATGAGGCAGAAGGGATGG + Intronic
957320908 3:78629103-78629125 CTAACATGAAACACACGGTAGGG - Intronic
958126160 3:89357572-89357594 CTAAAATGAAGTACATGTTATGG + Intronic
959626250 3:108455233-108455255 CTAAGATGAAGTAGAATTTAGGG + Intronic
960055580 3:113274344-113274366 CCAACAGGAAGCAGAAGGAAAGG - Intronic
960606708 3:119513377-119513399 CAAAAATGAAGCAGAATGAATGG + Intronic
961206344 3:125085457-125085479 CTAAGAAGAAGAAGAATGTAGGG - Intronic
961518444 3:127453068-127453090 CAAAAAGGAAGCAGAGGGTTAGG + Intergenic
962415698 3:135179674-135179696 CTAGAATGACCCAGAAGGAAGGG + Intronic
963330229 3:143905717-143905739 GGAAAATTGAGCAGAAGGTATGG + Intergenic
963886829 3:150592546-150592568 TTAAAATGAAGGAAAAAGTATGG + Intronic
964828831 3:160860487-160860509 ACAAAAGGAAGCAGATGGTAAGG + Intronic
966369873 3:179238967-179238989 CTAAAATCAAGCAGAAGAAATGG - Exonic
966926285 3:184646641-184646663 CTAGAAGGAAGGAGAAGGGAAGG + Intronic
966963733 3:184968464-184968486 GTAAAATGAAGCAGCAACTAGGG - Intronic
967394637 3:188993394-188993416 CTCAGATGGAGCAGAAGGTGTGG + Intronic
967444751 3:189554214-189554236 CTAATATTAAGAAGAAGGCAAGG + Intergenic
967515799 3:190366888-190366910 ATCAAATAAAGCAGAAGCTATGG - Intronic
967941382 3:194769065-194769087 CTAAAATGCAGCAGAACCTGTGG - Intergenic
969471463 4:7391754-7391776 CTAAAATGAAGCAGTGGTGATGG + Intronic
970025273 4:11617203-11617225 TTAAAATGAGACACAAGGTATGG + Intergenic
970449036 4:16148928-16148950 CTAAAATCATGCAGCAGGTGGGG - Intergenic
970849467 4:20583868-20583890 CTAAAATGAAGCAGAAGGTAAGG + Intronic
971090258 4:23334981-23335003 GTAAAATGAAACAGAGGGAATGG + Intergenic
971627127 4:28935944-28935966 CAAAATTGAAGGAGCAGGTAAGG + Intergenic
972021800 4:34324769-34324791 CAAAAATCAAGCATAAGGAAAGG + Intergenic
972944248 4:44234672-44234694 CTAAAAGGAAGCAAGAGGGAGGG - Intronic
974236928 4:59193468-59193490 CTAATCTAAAGCAGAAGGCAGGG - Intergenic
974240782 4:59243773-59243795 CTAAAATGAAGAACAAAGTGAGG - Intergenic
975028805 4:69586722-69586744 CTAAAATGCAGGATAAGGAATGG - Intergenic
975280211 4:72553438-72553460 CTAAAAAGACCCAGAAGTTAGGG + Intronic
975322359 4:73023190-73023212 CTAAAATGGAGAAGGAGGGAGGG - Intergenic
975718555 4:77228580-77228602 CCAAAATGAAGTAAAAAGTAAGG - Intronic
975773890 4:77761698-77761720 CTAAAATCAAGAACAAGGTAAGG + Intronic
977120804 4:93098633-93098655 CTAGAATGAAGCAAACAGTAAGG + Intronic
978365485 4:107976837-107976859 CTAAAATGAAGAAACAGGTTTGG - Intergenic
978666273 4:111186466-111186488 CAAAAATGAAGCTGAAAATATGG + Intergenic
979041474 4:115802768-115802790 AAAAAATGAAGCAAAATGTAAGG + Intergenic
979220183 4:118214226-118214248 TGAAGATGAAGAAGAAGGTAGGG + Intronic
980233677 4:130076159-130076181 TTTAAATGAAACAGAATGTAAGG - Intergenic
981431437 4:144665830-144665852 CTAAAATTTAGGAGAAGGCAGGG - Intronic
981558829 4:146024802-146024824 CTAAAATGAAGGAGAAGAAAAGG - Intergenic
981565120 4:146092987-146093009 AGAAAATGAACCAGAAGATAAGG + Intergenic
983255232 4:165391895-165391917 CTTAAAAGATGCATAAGGTATGG + Intronic
984218936 4:176949289-176949311 CTAAAATGAAGCTGTGGGCAGGG - Intergenic
985370882 4:189284341-189284363 CTAAAAGGAAAAAAAAGGTAGGG - Intergenic
986289785 5:6390543-6390565 CCCAAGTAAAGCAGAAGGTATGG - Intergenic
988830882 5:34986252-34986274 CTAAAAAGAAGAAGAAGGGTGGG + Intergenic
989245494 5:39249727-39249749 ATAAAATGACTCAGAAGGTGAGG + Intronic
989699615 5:44247024-44247046 TTTAAATGTAGCAGAAGGAAGGG - Intergenic
989724316 5:44570007-44570029 TTAAAATAAAGCAAAAGGAAGGG + Intergenic
991698050 5:69291696-69291718 AAAAAATGAAGCAGAAGTTTAGG - Intronic
992097210 5:73373896-73373918 CTAAGCTGAAGCAGAAGGACTGG + Intergenic
993378015 5:87172743-87172765 CTAAGATAAATCAGAAGGTTAGG + Intergenic
993774994 5:91982557-91982579 TCAAAATGTAGGAGAAGGTAAGG - Intergenic
994864813 5:105254128-105254150 CTATAATGAAGAAAAAGGTATGG + Intergenic
995219155 5:109628450-109628472 TTAAAATGAAATAGAAGATATGG - Intergenic
995639636 5:114239752-114239774 GTAAAATAAAGGAGAAGGAAGGG - Intergenic
995844599 5:116480278-116480300 CTAAAATGAAACAAAGGGTGAGG + Intronic
995857696 5:116610779-116610801 CTAAAATCAAGTAGCAGGTTAGG - Intergenic
996637062 5:125705066-125705088 CAGAAATGAAGAAGAATGTAAGG + Intergenic
996930908 5:128885670-128885692 TTAAAATGAAGGAGCAGGCAGGG + Intronic
997182857 5:131849759-131849781 CTAAGATGAAGAAAAAGGCAAGG + Intronic
997382946 5:133450414-133450436 CTAAAAGGAAGCAGCAGGGCCGG - Intronic
997601001 5:135138313-135138335 CTTAAATGAAGGAGCAGGTCTGG + Intronic
999056167 5:148579595-148579617 CTAAAATTAAGATGTAGGTAGGG + Intronic
999593144 5:153171121-153171143 TTAAAATGAAGCACAAGGGGAGG + Intergenic
999978029 5:156931533-156931555 CTAATATTAACCAGAAGGTTTGG - Intronic
1001962688 5:175889657-175889679 ATAAAATACTGCAGAAGGTATGG - Intergenic
1002847455 6:960741-960763 CTTTAATGAAGGAGAAGTTAAGG - Intergenic
1002964170 6:1946115-1946137 CTAAAATGAAAAATAAGGAAAGG + Intronic
1003783671 6:9458609-9458631 CTCTAATGAAGTAGAGGGTAAGG - Intergenic
1004018266 6:11752157-11752179 CTAAAATAAAGCAGAATAAAAGG - Intronic
1005130831 6:22505848-22505870 ATAGAATTAAGCAGAAGGAATGG + Intergenic
1005372423 6:25148874-25148896 CTAAAATCAAGAAGAAGATAAGG + Intergenic
1005954243 6:30652544-30652566 CTAATATGTAGCAGAATTTAGGG + Intronic
1005965341 6:30722629-30722651 CTACAATGAAGCCACAGGTAAGG + Exonic
1008312110 6:49989454-49989476 CTATCCTGAAGCAGAAGGAAAGG - Intergenic
1008376999 6:50803138-50803160 CTGAAAGGAAGCAGAAGAGAGGG - Intergenic
1008808673 6:55464697-55464719 CTAGAAAGAAGGAGAGGGTAGGG - Intronic
1009774838 6:68193407-68193429 CTTTAATGAAGCAGAAGTAAAGG - Intergenic
1009791571 6:68408106-68408128 CTATAATGAAGCAGATGATTGGG - Intergenic
1010832011 6:80542505-80542527 CTAAAATAAAACAGAAGCTTAGG - Intergenic
1011994709 6:93570766-93570788 ATAAAATGAAGCAGTATGTGTGG + Intergenic
1013306980 6:108857571-108857593 CTAAGATGAGGAAGAAGGCAAGG - Intronic
1014122280 6:117739276-117739298 GTCAACTGAAGCAGTAGGTAAGG + Intergenic
1014602152 6:123426669-123426691 CTAAAATACACCAGAAGGAAAGG - Intronic
1015185894 6:130415157-130415179 CTCAAGGGAAGCAGAAGGAAAGG + Intronic
1015424706 6:133052331-133052353 TTAAAATGAAGATGAAGGTAAGG + Intergenic
1015659016 6:135552825-135552847 ATAAAAGGAAGAAGAAGCTATGG - Intergenic
1016672547 6:146725975-146725997 CTCAAATGAAGTAAAAGGTTAGG - Intronic
1017262780 6:152406570-152406592 CTAAAAAGAAGAATAAGGTCTGG + Intronic
1020378044 7:7510032-7510054 AGAAAATGAGGCAGAAGGTTAGG - Intronic
1020480342 7:8652003-8652025 CCAAAAAGAAGCAGAAAATAGGG - Intronic
1020539922 7:9448923-9448945 GTAGAATCAAACAGAAGGTAAGG + Intergenic
1020552778 7:9627684-9627706 TTAAAATGTAGCAGAAAGTTAGG - Intergenic
1022376686 7:29819558-29819580 CCTAAAGGAAGCAGAAGGGAAGG - Intronic
1022883370 7:34614437-34614459 CAAAAGTGAAGCAGAAATTAAGG + Intergenic
1023157954 7:37270039-37270061 CTAAAATGAAATAAAAGGCAAGG + Intronic
1023933054 7:44718477-44718499 CTCAAAAGAAACAGAAGGGATGG - Intergenic
1024475874 7:49809939-49809961 CTAAAATCTAGGAGAAGGTAAGG + Intronic
1024561216 7:50647011-50647033 CTAAAAAGAGGCAGAAAGTGTGG + Intronic
1027196289 7:76032814-76032836 CTAAACTGAGACAGAAGGTTGGG + Intronic
1027489306 7:78802867-78802889 GCAAAATTGAGCAGAAGGTATGG - Intronic
1027757599 7:82234387-82234409 CTAAAATGTCACAGAGGGTAGGG + Intronic
1028296982 7:89145703-89145725 CTAACATGGAGCATAAGGTCTGG - Intronic
1028328190 7:89553198-89553220 CTAAAAATAAGCAGAAGGAATGG + Intergenic
1028443475 7:90891589-90891611 ATTAAATGAAACAGAAGTTAAGG + Intronic
1028539603 7:91927464-91927486 CTACAATGTAACAGTAGGTAAGG + Intergenic
1029038231 7:97545373-97545395 CTAAAATGAGGAATAAGGCAAGG + Intergenic
1029914721 7:104197173-104197195 ATGAAATGATGCTGAAGGTAAGG + Intronic
1030470375 7:109955583-109955605 TTAAAAGGAAGCAGAAGGCCAGG + Intergenic
1030538922 7:110804459-110804481 CTAAAACCAATCAGAAGGCAGGG + Intronic
1031523754 7:122798831-122798853 CAAAAATCAAGCAGAAGTTGAGG - Intronic
1031550291 7:123102895-123102917 CTAAAATAAAGAAAAAGGCATGG + Intergenic
1031778780 7:125936424-125936446 CTAAAGTCAAACAGGAGGTACGG + Intergenic
1031822043 7:126514335-126514357 TTAAAATGAAGCAGTGGGTATGG + Intronic
1033100643 7:138468070-138468092 CTAAGATGAGGAATAAGGTAAGG - Intronic
1033845345 7:145425369-145425391 ATAAACTGAAGCAAACGGTAAGG - Intergenic
1033884625 7:145930220-145930242 CTAAAAGGAAGAAGAACCTAAGG - Intergenic
1034922119 7:155091971-155091993 TTAAAATGAACCAAAAAGTAGGG + Intergenic
1035188533 7:157144730-157144752 TTACAATCAAGCAGAGGGTAGGG + Intronic
1036408535 8:8477495-8477517 CTAAAAAGGAGAAGAAGGCAGGG + Intergenic
1037287359 8:17315585-17315607 GCAAAATTGAGCAGAAGGTACGG - Intronic
1037369531 8:18160456-18160478 CTAAGATGAAGAAAAAGGCACGG + Intergenic
1037380092 8:18275834-18275856 CTAACTGGAAGCAGAAGGCAAGG - Intergenic
1037449360 8:19001346-19001368 GTAAAATTAAGCTGAAGGTGAGG + Intronic
1040507086 8:48058623-48058645 CTAAGATGAAGAATAAGATAAGG - Intronic
1040525498 8:48220107-48220129 CTAAAATAAAGAATAAGGTAAGG + Intergenic
1042717690 8:71792598-71792620 TTAAAATGAAAAACAAGGTAAGG - Intergenic
1043059526 8:75482363-75482385 TAAAAATGGAGCAGAAGGGAGGG - Intronic
1044389407 8:91631881-91631903 TTAATAACAAGCAGAAGGTATGG + Intergenic
1045523900 8:102927213-102927235 ATAAATTAAAGCAGAAGGTAAGG - Intronic
1045871350 8:106930670-106930692 CTAAAATCAGACAGAAGGGAGGG + Intergenic
1046854270 8:119012027-119012049 CTAAAATCAAGAATAAGGCAAGG - Intronic
1046932003 8:119850960-119850982 TTGAAATGAGGCAGAAGTTAAGG + Intronic
1047137088 8:122091721-122091743 GAAAAATCAAGCAGAAAGTATGG + Intergenic
1048829646 8:138463741-138463763 CTAAGATGCTGCAGAAGGGAAGG + Intronic
1050882429 9:10719752-10719774 TGAAAAGGAAGCAGAAGGAATGG + Intergenic
1051049860 9:12918927-12918949 GCAAAATGAAGCAGAAGACAAGG + Intergenic
1051317621 9:15858949-15858971 CTAAAATCATGAACAAGGTAAGG - Intronic
1052265027 9:26562052-26562074 CTATAATGAAAGAGAAAGTATGG + Intergenic
1052460634 9:28758080-28758102 CTGAGCTGAAGCAGAAGGAAAGG + Intergenic
1052788182 9:32849484-32849506 ATAAAAGGAAGCAGAAGGATGGG + Intergenic
1053240676 9:36492330-36492352 CTATTATGAAGAAAAAGGTAGGG - Intergenic
1055854018 9:80664328-80664350 ATAAAATGAAACAGAAGGGTGGG - Intergenic
1056060591 9:82881862-82881884 ATAAAATGAAGGAGAAGGGCCGG + Intergenic
1056165938 9:83940964-83940986 CAAAACTGAAGAGGAAGGTATGG - Intronic
1056491508 9:87112518-87112540 CTAAAGAGAACCAGAAGGTAGGG - Intergenic
1058455413 9:105133705-105133727 GTAAAAAGAAGCAGAGGCTAGGG + Intergenic
1059592472 9:115677085-115677107 CAAAAATGATGCAGAATTTAGGG - Intergenic
1060610157 9:124956740-124956762 CTAAAATCAGGAAGAAGGCAAGG + Intronic
1187106762 X:16251372-16251394 CAAAAATGAGGCAGTAGGTGGGG + Intergenic
1187341989 X:18429601-18429623 CTAAAGAGAAGCAGAAAGCATGG - Intronic
1187787023 X:22903209-22903231 CTAAAATGCAGCATAAGGTAAGG - Intergenic
1187948132 X:24446357-24446379 CTAAAATCAAGGAGTAGGCAGGG - Intergenic
1188025032 X:25199387-25199409 CTCAACTGAAGTAGAAGGGAAGG + Intergenic
1188054313 X:25523821-25523843 CTAAAATGACGGAGAAGATGAGG + Intergenic
1188293194 X:28413857-28413879 GAAAGATGAAGCACAAGGTATGG - Intergenic
1188437488 X:30178993-30179015 CTAATATGAAAGAGAGGGTAAGG - Intergenic
1188926301 X:36048842-36048864 GTAAAATGAAGCATGAGGTATGG + Intronic
1188940944 X:36236700-36236722 ACAAAATGAAGTAGATGGTAGGG + Exonic
1189058462 X:37726338-37726360 AAAAAATGAAGCAGCAGGCATGG + Intronic
1189631200 X:42955235-42955257 CTAAAATCAAGATGTAGGTAAGG - Intergenic
1189646317 X:43136475-43136497 GTAAAATGAAGCACCAGCTAAGG + Intergenic
1189648053 X:43155878-43155900 CTTAAATCAACCATAAGGTATGG - Intergenic
1190464238 X:50709666-50709688 CTAAAATGCAGCTGGAGCTAAGG + Intronic
1190607311 X:52158200-52158222 CTAAGATGAAGAATAAGATAAGG + Intergenic
1191223036 X:58011290-58011312 CTACATTAAAGCAGAAGATATGG - Intergenic
1191749553 X:64527228-64527250 CTAAACTGAAGAATAAAGTAGGG + Intergenic
1192470134 X:71391280-71391302 ATAAAATGAAGCAGAAAATGAGG + Intronic
1193097662 X:77569203-77569225 CTAAGATCAGGAAGAAGGTAAGG + Intronic
1193321841 X:80131911-80131933 TTGAAATGAATCAGAATGTATGG + Intergenic
1193415325 X:81215518-81215540 CCAGAATGAAGGAGAAAGTATGG + Intronic
1193750547 X:85337571-85337593 CTAATATGAACCAGGAGGTGGGG - Intronic
1194145141 X:90253482-90253504 CTCAAAGCAAGCAGAAGGAAAGG + Intergenic
1194658912 X:96606598-96606620 CTAAAATAAAGAAGCAGGAATGG - Intergenic
1195656271 X:107334205-107334227 TTAAACTGGAGCAGTAGGTATGG + Intergenic
1195737182 X:108024468-108024490 CTCAAAGCAAGCAGAAGGAAAGG - Intergenic
1196684480 X:118498559-118498581 CTTAAAAGAATCAGAAGTTATGG - Intronic
1197159450 X:123307309-123307331 CTAAATTGGGGCAGAAGGGAGGG + Intronic
1197657828 X:129136693-129136715 CTAAAATCAAGATGCAGGTAGGG - Intergenic
1198745297 X:139883676-139883698 CTAAAATGATGTACAAAGTAAGG + Intronic
1199472745 X:148212707-148212729 ATAATATGTGGCAGAAGGTAAGG + Intergenic
1199926317 X:152468483-152468505 GTAATATTGAGCAGAAGGTACGG - Intergenic
1200580658 Y:4946159-4946181 ATAAAATGATGAAGAAAGTAAGG + Intergenic