ID: 970852535

View in Genome Browser
Species Human (GRCh38)
Location 4:20618170-20618192
Sequence CAGACAAAGGAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1576
Summary {0: 1, 1: 2, 2: 9, 3: 161, 4: 1403}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970852535_970852541 13 Left 970852535 4:20618170-20618192 CCTTCCTCCTTCTCCTTTGTCTG 0: 1
1: 2
2: 9
3: 161
4: 1403
Right 970852541 4:20618206-20618228 CGCCTGGCCTCCAGCTGGCACGG 0: 1
1: 0
2: 2
3: 24
4: 276
970852535_970852540 8 Left 970852535 4:20618170-20618192 CCTTCCTCCTTCTCCTTTGTCTG 0: 1
1: 2
2: 9
3: 161
4: 1403
Right 970852540 4:20618201-20618223 GAGCTCGCCTGGCCTCCAGCTGG 0: 1
1: 0
2: 2
3: 17
4: 193
970852535_970852539 -3 Left 970852535 4:20618170-20618192 CCTTCCTCCTTCTCCTTTGTCTG 0: 1
1: 2
2: 9
3: 161
4: 1403
Right 970852539 4:20618190-20618212 CTGCGTGATCAGAGCTCGCCTGG 0: 1
1: 0
2: 1
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970852535 Original CRISPR CAGACAAAGGAGAAGGAGGA AGG (reversed) Intronic
900690442 1:3977498-3977520 GTGACAAGGGAGAAGGTGGAAGG + Intergenic
900816745 1:4853205-4853227 AGGATAAAGGAGGAGGAGGAAGG - Intergenic
900932879 1:5747793-5747815 GAGAGAAAGGAGAAAGAGGGAGG + Intergenic
900977146 1:6025059-6025081 GGGAGAAGGGAGAAGGAGGAAGG - Intronic
901040190 1:6358874-6358896 CAGAGAAAGGCGAGGGAGCAGGG + Intronic
901420325 1:9146338-9146360 CAGGAAGAGGAGGAGGAGGAAGG - Intergenic
901751728 1:11414211-11414233 CAGACAAAGCAGGGTGAGGAGGG - Intergenic
902088744 1:13884935-13884957 AAGAAAAAGAAGAAGAAGGAAGG - Intergenic
902150524 1:14439227-14439249 AATACAAAAGAGAAGGAGGAAGG - Intergenic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
902618971 1:17639547-17639569 GAGAGAAGGGAGATGGAGGAAGG - Intronic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
902733789 1:18386769-18386791 CAGACAATGGGGCTGGAGGAAGG + Intergenic
902977553 1:20099880-20099902 AAGACAAAAGAGAAGGATGAGGG - Intergenic
903389922 1:22956389-22956411 GAGAAAGAGGAGGAGGAGGAAGG + Intronic
903548632 1:24142625-24142647 CTGACAGGGGAGGAGGAGGAAGG - Intronic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
903918544 1:26782645-26782667 CAGGCAAAGCAGAAGCAGGGAGG - Intergenic
903947458 1:26972656-26972678 CAGAAATGGGAGGAGGAGGATGG + Intergenic
903959445 1:27047468-27047490 CAGGCCAAGGGGAAGGAGGTGGG + Intergenic
903959885 1:27050227-27050249 CAGATACAGGAGAAGGTGGAGGG + Intergenic
904021719 1:27471711-27471733 CTGACAAAGGAGGATCAGGAAGG + Intronic
904233371 1:29096332-29096354 GAGACAGAAGAGAAGGAGGAGGG + Intronic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904462255 1:30687023-30687045 CAGGCAAAGGAGGCTGAGGAGGG - Intergenic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
904846056 1:33417494-33417516 CAGACAAAATAGACTGAGGAAGG + Intronic
904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG + Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905266151 1:36755609-36755631 CGGAGAAAGGAGAGGCAGGAGGG - Intergenic
905341979 1:37284677-37284699 CAGACTAAGAAGATGCAGGATGG - Intergenic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906191973 1:43904758-43904780 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906191991 1:43904827-43904849 CAGGAATAGGAGCAGGAGGAGGG - Intronic
906192249 1:43905754-43905776 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192337 1:43906081-43906103 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192381 1:43906225-43906247 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906273924 1:44501940-44501962 GAGAAAAAGAAGGAGGAGGAAGG + Intronic
906687563 1:47772324-47772346 CAGAGAGAGGAGCAGGACGAAGG + Intronic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
906892264 1:49730214-49730236 CAGACACTGGAGAATGAGCAAGG - Intronic
906994621 1:50778662-50778684 CAAACTGAAGAGAAGGAGGAAGG + Intronic
907099057 1:51811176-51811198 CAGGGAAAGGTAAAGGAGGAAGG - Intronic
907231270 1:53001272-53001294 GAGAAAAAGGGAAAGGAGGATGG + Intronic
907327599 1:53650740-53650762 CAGACTAAAGAGATGGCGGAAGG + Intronic
907703223 1:56810018-56810040 GAGAGAAAGAAGGAGGAGGAAGG + Intronic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
908012433 1:59792544-59792566 CACACAAAGAAGAAAGAGAAAGG + Intergenic
908679439 1:66643400-66643422 CATACAAAAGTAAAGGAGGAAGG - Intronic
908792703 1:67798582-67798604 TAGGCTGAGGAGAAGGAGGAAGG - Intronic
909286840 1:73830275-73830297 CAGAAAAAGGAGAGAGGGGAAGG + Intergenic
909493286 1:76248795-76248817 CAAACAAAGGAAAAGAAAGAGGG - Intronic
909525660 1:76619853-76619875 CAGAGGAGGGAGAAGAAGGAGGG - Intronic
909686550 1:78355217-78355239 CAAAAAAAGGAGGAGGAGAAAGG - Intronic
909975472 1:82041732-82041754 CAGACTCATGAGAGGGAGGAAGG + Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910054011 1:83009844-83009866 CAGAGAAAGGAAAGGAAGGATGG - Intergenic
910161852 1:84280890-84280912 AAAAGAAAGGAGAAAGAGGAAGG - Intergenic
910238020 1:85055805-85055827 CGGAGAAAGGAGAATGAGGAAGG + Intronic
910286120 1:85556141-85556163 GAGAAGGAGGAGAAGGAGGAAGG - Intronic
910340837 1:86185087-86185109 CAGGCAATGGAGAAGGATCAAGG + Intergenic
910549848 1:88463205-88463227 GGGAGAAAGGAGGAGGAGGAGGG - Intergenic
911215240 1:95185930-95185952 GAGACAAAAGTGAATGAGGAAGG + Intronic
911584059 1:99669810-99669832 ATTAAAAAGGAGAAGGAGGAGGG + Intronic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912509089 1:110176294-110176316 GAGACATGGGAGAATGAGGAGGG + Intronic
913085168 1:115430113-115430135 CAGAGAATGGAGAAAGAGAATGG - Intergenic
913114667 1:115685126-115685148 CAGAGAGTGGAGAGGGAGGAAGG - Intronic
913200963 1:116495156-116495178 CGGAGGAAGGAGCAGGAGGAGGG - Intergenic
913234165 1:116765731-116765753 TAGTCAATGGAGAAGGAGCATGG - Intronic
913242278 1:116839411-116839433 CAGTCAAAAGACCAGGAGGATGG + Intergenic
913452779 1:119003389-119003411 GAGACAGAGGAGAAAGAGAAAGG + Intergenic
913453700 1:119009395-119009417 TAGAGAAAGGAGAAAGATGAAGG + Intergenic
913530167 1:119728293-119728315 CAGACAAAACAAAAGCAGGAAGG - Intronic
913705652 1:121419485-121419507 GAAACAAAGGAGGAGAAGGAAGG - Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914196779 1:145451871-145451893 CAGGCAAAGTGGGAGGAGGAGGG + Intergenic
914803665 1:150977301-150977323 GAGACAAAAGAGAAGGTGGATGG + Intergenic
914851271 1:151316125-151316147 CAGCCAAAGGAGCAAGAAGACGG - Exonic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
914932742 1:151949472-151949494 CAGCCACAGGAGCAGGAGGCTGG + Intergenic
915032630 1:152896723-152896745 TAGACAAAGGTGGAGGGGGAGGG - Intergenic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915342516 1:155184306-155184328 CAGACACGGGAGAAGGAGCAGGG - Exonic
915622491 1:157094323-157094345 GAGACAGAGAAGAAGGAGGCTGG - Intronic
915724927 1:158010719-158010741 CAGGCAAAGGGGAGGGAGGAGGG - Intronic
916024734 1:160823819-160823841 TAGACATGGGAGGAGGAGGAAGG - Intronic
916084093 1:161255783-161255805 AAGCCAAAGGAGAAGGAGAGGGG + Intergenic
916149335 1:161771206-161771228 AGGAGAAAGGAGGAGGAGGAGGG - Intronic
916216333 1:162398114-162398136 CAGACAGAGTAGAATGGGGATGG + Intronic
916593633 1:166219781-166219803 CACACAAAGGAGAAAGAGAAAGG - Intergenic
917090803 1:171351347-171351369 GTGACAGAGGAGAAGGAGGAGGG + Intergenic
917166145 1:172115373-172115395 GAGAAAGAGGAGAAGCAGGAGGG - Intronic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917454481 1:175174289-175174311 CAGACAAATGATAAGGATGAGGG + Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
918264249 1:182825828-182825850 CAGACAAAGCAGAAGATGGGTGG - Intronic
918350682 1:183652725-183652747 CAGACAAAGCAAAAGGAAAAGGG - Intronic
918371364 1:183864761-183864783 TAGAGAAAGGAGCAGGTGGATGG + Intronic
918434836 1:184500716-184500738 CAGTTAAAGGAGAAGGAGCTGGG + Intronic
918448269 1:184635358-184635380 GGGAGAAAGAAGAAGGAGGAAGG - Intergenic
918546210 1:185687452-185687474 GAGAGAAAAGAAAAGGAGGAAGG - Intergenic
918550166 1:185733742-185733764 CGTAGAAAGGACAAGGAGGAGGG - Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919611999 1:199756946-199756968 CAAACAAAGCAGGAGGAAGAAGG - Intergenic
919759361 1:201087681-201087703 GAGAGAAGGGAGGAGGAGGAAGG - Intronic
919851925 1:201678838-201678860 GAGAAAAAGTCGAAGGAGGAAGG + Intronic
919928850 1:202208386-202208408 GAGAGAGAGGAGAAGGAGGGGGG + Intronic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920217926 1:204374686-204374708 CAGACAGAGGAGGAGGATAAAGG - Intronic
920383940 1:205554009-205554031 AAGACAGATGAGAAGGTGGAGGG + Intergenic
920616274 1:207495936-207495958 CAGACAAAGGCGGTGGATGATGG - Intergenic
920632778 1:207669111-207669133 CAGACAAAGGCGGTGGATGATGG - Intronic
920691545 1:208150664-208150686 CAGACAAGGGTGGATGAGGATGG + Intronic
920951817 1:210579128-210579150 CAGACACGGGAGATGGAGGGTGG + Intronic
921037530 1:211396085-211396107 TAGAAAATGGAAAAGGAGGACGG - Intergenic
921131225 1:212221695-212221717 AAGACAATGGAGAAGGTGGCTGG + Intergenic
921256855 1:213349389-213349411 CACAGTAAGGAGAAGCAGGATGG + Intergenic
921787220 1:219245074-219245096 AAGAGAAAGAAGAAAGAGGAAGG - Intergenic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
921921284 1:220672910-220672932 AGGAAAGAGGAGAAGGAGGAGGG + Intergenic
922004659 1:221517615-221517637 AAGACAATGAACAAGGAGGAGGG + Intergenic
922020783 1:221702351-221702373 GAGACAATGAGGAAGGAGGATGG - Exonic
922174739 1:223188735-223188757 GAGATAAAGAAGGAGGAGGAAGG + Intergenic
922213263 1:223501200-223501222 GAGGGAAAGGAAAAGGAGGAGGG - Intergenic
922226848 1:223652871-223652893 CTGCCAATGGAGAAGGAGGCTGG - Intronic
922386339 1:225087616-225087638 CAGACCTTGGAGAAGGAAGATGG + Intronic
922471131 1:225877993-225878015 CAGGCAGAGGAGAGGGAGAAAGG + Intronic
922570317 1:226630879-226630901 AGGAGAAAGGAGAAGAAGGAAGG + Intergenic
922572001 1:226639850-226639872 CAGACACAGGAGAACGCAGAGGG + Intronic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922628408 1:227077542-227077564 GAGACAAGAAAGAAGGAGGATGG - Intronic
922643485 1:227260765-227260787 CAGATAAGGGAGAAGAAGAATGG - Intronic
922879022 1:228965243-228965265 CAGGCTGAGGAGGAGGAGGATGG - Intergenic
923192283 1:231630857-231630879 CACACCAAGTAGAAGCAGGAAGG + Intronic
923237846 1:232051650-232051672 GAGACAGAGGAGGAGGAGGTAGG + Intergenic
923405572 1:233655690-233655712 CTCACAAGGCAGAAGGAGGAAGG - Intronic
923699695 1:236288159-236288181 CTGACAAAGAAGAGGGAAGATGG - Intergenic
924215966 1:241822884-241822906 CATAGAATGGAGAAGAAGGATGG - Intergenic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1063034004 10:2267371-2267393 TATAAAGAGGAGAAGGAGGAAGG + Intergenic
1063173371 10:3529760-3529782 CAGTCAGAGGAAGAGGAGGAGGG - Intergenic
1063345327 10:5306606-5306628 AGGACACAGGAGAAGGAGAAAGG + Intergenic
1063542231 10:6945392-6945414 AAGAGAGAGGAGAAGGAGGGTGG - Intergenic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1063721679 10:8588658-8588680 CCGGCAAAGGAGAAAGAGGCAGG + Intergenic
1063832982 10:9977886-9977908 TAGACACTGGAGAAGGAGGAAGG + Intergenic
1064048181 10:12037937-12037959 AAGAAAAAGGAGAAGGAAAAAGG - Intronic
1064297370 10:14090518-14090540 CAGACACAGGTGAAGGAGCACGG + Intronic
1064402517 10:15033479-15033501 AAGAAAAAGGAGAAGAAAGAGGG + Intronic
1064443772 10:15375569-15375591 CACACAGAGGAAAAAGAGGAGGG - Intergenic
1064494232 10:15890976-15890998 GAGACAAAGAAAAAGGAGGAAGG + Intergenic
1064617896 10:17181560-17181582 CAGAAACAGGAGAACAAGGAGGG - Intronic
1064697018 10:17976895-17976917 CAGAGAAAGGAGAAAGAGAAAGG - Intronic
1064927274 10:20582691-20582713 CAGAGAAAGTAGGAGGAGGGGGG - Intergenic
1065031382 10:21589909-21589931 CAGACAAAGGGGAAGGGGAAGGG - Intronic
1065321864 10:24517564-24517586 AACAAAAAGGAGAACGAGGAGGG - Intronic
1065334944 10:24647476-24647498 AAGACAAAAGAAAAGTAGGAGGG + Intronic
1065414384 10:25468541-25468563 CAGGTAGAGGAGAAGGAAGAAGG - Intronic
1065830959 10:29613184-29613206 AAAAAAAAGAAGAAGGAGGAGGG + Intronic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1066248008 10:33603316-33603338 GAGAGGCAGGAGAAGGAGGAAGG + Intergenic
1066397587 10:35041249-35041271 CTGAGAGAGGTGAAGGAGGATGG + Intronic
1066615641 10:37290973-37290995 CTGCCAATGGAGATGGAGGAAGG + Intronic
1066782144 10:38963069-38963091 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1067324660 10:45255984-45256006 CAGACACAGGAGGAGGATGGTGG + Intergenic
1067581034 10:47446151-47446173 TACACAAAGGAGAAAGAGAAAGG + Intergenic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068231862 10:54178103-54178125 CAGCCAACAGAGAAGTAGGATGG + Intronic
1068278801 10:54839557-54839579 CAGAAAAAGGAGAGAGAGAAGGG + Intronic
1068303387 10:55175138-55175160 AAGACACAGGAGAATGAAGAAGG + Intronic
1068331450 10:55576358-55576380 CAGGCTGAGGAGAAAGAGGAAGG + Intronic
1068719419 10:60227509-60227531 CAGGCAAAGGAGAAAGAGAATGG - Intronic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1069694400 10:70376213-70376235 CAGTCAAAGGACAAGCAGGCAGG + Intronic
1070205145 10:74251278-74251300 AAGAGAAAGGAGGAGGAGTAGGG + Intronic
1070226518 10:74513869-74513891 TGTACAAAGGAGAAGGAGAAAGG - Intronic
1070326122 10:75390395-75390417 GAGAAAAAGGAAGAGGAGGAGGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070363819 10:75716698-75716720 GAGACACATGAGAAGGAGGCAGG - Intronic
1070444615 10:76484153-76484175 GAGAGGAAGAAGAAGGAGGATGG - Intronic
1070457487 10:76631793-76631815 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1070483610 10:76909507-76909529 GAGACAAGGGTGCAGGAGGATGG - Intronic
1070498564 10:77048480-77048502 GAAACAAAGGAGAATGGGGAGGG + Intronic
1070637092 10:78137709-78137731 GAGAAAGAGGAGAAAGAGGAAGG - Intergenic
1070641016 10:78169924-78169946 GAGACAAAGAACAAAGAGGAAGG - Intergenic
1070711665 10:78687432-78687454 CAGAGACTGGAGATGGAGGAAGG + Intergenic
1070835865 10:79446480-79446502 CAGAAATAGGAGAAGGGGGGGGG - Intergenic
1070902928 10:80046712-80046734 CATACAATGTAGAAGAAGGAAGG + Intergenic
1070963089 10:80512580-80512602 CAGAAAAAGGACAGGGAAGAGGG - Intronic
1071160687 10:82742109-82742131 CAGACGAGAGAGAGGGAGGAAGG - Intronic
1071288159 10:84167846-84167868 CAGACAAAGGAGCAGTAAGCAGG + Intergenic
1071379767 10:85046654-85046676 CAGATATGGGAGAAGGAGAAAGG + Intergenic
1071584996 10:86811456-86811478 CAGATAAATGAGAGGCAGGAAGG - Intronic
1071835927 10:89416647-89416669 CAGCCCAAGGAGGATGAGGAGGG - Intronic
1071920739 10:90347194-90347216 CAGACAAGGAAGAAGGAACAAGG + Intergenic
1072197483 10:93128796-93128818 GAGAGAAAGGAAAAGAAGGAAGG - Intergenic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072519521 10:96218775-96218797 CAGAAAGAGGAGGGGGAGGATGG - Intronic
1072613046 10:97031681-97031703 CGGAGGAAGGAGATGGAGGAAGG + Intronic
1072830195 10:98649264-98649286 AATAGAAAGGAGAAAGAGGAAGG + Intronic
1072888038 10:99297511-99297533 AAGACAAAGGAGTGGGAGAAGGG - Intergenic
1072943119 10:99785267-99785289 CACTCACAGTAGAAGGAGGAGGG + Intronic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073451692 10:103613395-103613417 CAGGCAAAGAAAAAGGAGCATGG - Intronic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1073677519 10:105665253-105665275 CTGACAAACGAGAGGGTGGAGGG + Intergenic
1073909378 10:108323499-108323521 GAGACATAGTGGAAGGAGGAGGG + Intergenic
1074022934 10:109603215-109603237 TAGACAACGGAGAGGGAAGAGGG + Intergenic
1074374517 10:112928273-112928295 CTGACAAAGGAGCTGGAGGCGGG - Intergenic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074691141 10:116005100-116005122 GAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1075334832 10:121601069-121601091 AAGAGAAAGGAGAAGGGGGTGGG + Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075338017 10:121622738-121622760 TAGAGAAAGGGGAAGAAGGAGGG - Intergenic
1075445212 10:122508294-122508316 TAGACATGGGAGAAGCAGGAAGG + Intronic
1075762701 10:124869059-124869081 CAGACGGAGGAAAAGAAGGAAGG - Intergenic
1075861028 10:125676761-125676783 CACACAAAGGAGGAAGAGAAAGG - Intronic
1076252719 10:128996600-128996622 CAGACACAGGAGGATGGGGATGG - Intergenic
1076992256 11:281547-281569 GAGCCAGAGGAGGAGGAGGAGGG + Exonic
1076992537 11:282945-282967 CACACAGAGCAGAGGGAGGAGGG + Intronic
1077066975 11:645675-645697 CAGAGAAAGGAGGTGGGGGATGG + Intronic
1077150767 11:1072172-1072194 GAGGGAAAGGAGGAGGAGGAAGG - Intergenic
1077495855 11:2886163-2886185 CAGACAAAGGAGCCGGCGGGGGG - Intergenic
1077819197 11:5719468-5719490 CAGACAGAGGAGCAGGAACATGG - Intronic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1078048552 11:7940775-7940797 GAGAAAAAGCATAAGGAGGAAGG + Intergenic
1078255626 11:9656101-9656123 AAGAAAAAGGAAAAGGTGGAGGG + Intergenic
1078369603 11:10734083-10734105 AGGACAAAGGAGGGGGAGGAAGG + Intergenic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1078657962 11:13260033-13260055 AAAACAGAGGAGAAGGAGGGAGG + Intergenic
1078824966 11:14920760-14920782 CAGGCAAAGGAAAAAGGGGAGGG - Intronic
1079115279 11:17636660-17636682 AAGACAGAAGAGAAGGAGAAAGG - Intronic
1079303080 11:19296749-19296771 GACAAAGAGGAGAAGGAGGATGG + Intergenic
1079518782 11:21300321-21300343 ATTACAGAGGAGAAGGAGGAAGG + Intronic
1079524953 11:21374972-21374994 CAAACAGAGAAGAAGGAAGAAGG + Intronic
1079533917 11:21487532-21487554 CACACAAATGAGAAAGAGGAAGG + Intronic
1079659501 11:23021006-23021028 CAGACAACCCAGAAGGAAGAAGG - Intergenic
1079697081 11:23495355-23495377 AAGAAAGAAGAGAAGGAGGAAGG + Intergenic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1080068631 11:28051242-28051264 CAGACAAAGAATAATGAAGAAGG + Intronic
1080159778 11:29159912-29159934 AAGAGAAAAGAGGAGGAGGATGG + Intergenic
1080295297 11:30720326-30720348 AAGAGAAAGAAGAAGGAAGAAGG - Intergenic
1080843177 11:36003677-36003699 CAAATAAAGTAGAAGGAGAATGG + Intronic
1081659487 11:44879267-44879289 TAGGGAAAGAAGAAGGAGGAAGG - Intronic
1081728972 11:45355264-45355286 CTGAGAAAGGAGAGGGAGGGGGG + Intergenic
1081871079 11:46382751-46382773 CAGCGAAAGGAGAAGGGGGTGGG + Intronic
1082887465 11:58102338-58102360 CAGAAAGAGCAGAAGGAGAAAGG - Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083553728 11:63609644-63609666 CAGAGAGAGAAGGAGGAGGAGGG + Intronic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1084104869 11:66974969-66974991 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
1084270104 11:68024520-68024542 CATACAAAGGAGGAAGAGAAAGG - Intronic
1084453610 11:69254588-69254610 CAGCCAAAGGGGAATGAGGAGGG + Intergenic
1084685379 11:70691320-70691342 AAGGCAAGGGAGAATGAGGAGGG + Intronic
1084860508 11:72014930-72014952 GAGGCAAAGGAGAAGGTGGCAGG - Exonic
1084918358 11:72448756-72448778 CAAACAAATGAAAGGGAGGAAGG + Intergenic
1085042479 11:73334755-73334777 CAGACCCAGGAGCAGGGGGAAGG - Intronic
1085134421 11:74073022-74073044 CAGGCAAAAGAGAAGGGTGACGG + Intronic
1085300161 11:75453170-75453192 CAGACTGGGGAGGAGGAGGAAGG + Intronic
1085300322 11:75454600-75454622 CAGACCAGGGAGCAGGAGCAAGG + Intronic
1085362491 11:75903093-75903115 AAGAGAGAGGAGGAGGAGGAAGG - Intronic
1085532228 11:77198649-77198671 CAGACAGAGGGGAAGGAGAGGGG + Intronic
1085532341 11:77199375-77199397 CAGGCAAAGGAGAAGTAGGCCGG + Intronic
1085895854 11:80638692-80638714 AAGGCAAAGGAGAAGAAGAAGGG + Intergenic
1085954421 11:81374034-81374056 GAGACAAAGGAAAGGAAGGAAGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086274124 11:85104905-85104927 GAGAGAAAGGAGAAAGAGGTGGG + Intronic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1086464458 11:87038371-87038393 CCTGCAAGGGAGAAGGAGGAGGG + Intronic
1086597397 11:88589734-88589756 TAGACATAGGAGCATGAGGAGGG - Intronic
1086827630 11:91519047-91519069 GAGAAAGAGGAGAAGGAGGAGGG + Intergenic
1086858239 11:91892654-91892676 AGGAAAAAGGAGAGGGAGGAAGG - Intergenic
1086990795 11:93302144-93302166 CAAAAAACGGAGGAGGAGGAGGG + Intergenic
1087074053 11:94112106-94112128 CAGAAAAAGGAGAATGGGCATGG + Exonic
1087307073 11:96500597-96500619 CAGCTGAATGAGAAGGAGGAGGG - Intronic
1087419420 11:97901963-97901985 AAGACAAAGGAAGAGGAGAAAGG - Intergenic
1087512419 11:99114462-99114484 GAAGAAAAGGAGAAGGAGGAAGG - Intronic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1087672848 11:101127893-101127915 AAGATAAAGGAGGAGGAGGAAGG - Exonic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088070178 11:105773627-105773649 CAGACAAAGCAAAAGGAAAAGGG + Intronic
1088181655 11:107120180-107120202 CAGAAAAAGGAGAGAGAGTAAGG + Intergenic
1088630774 11:111772019-111772041 CAGAGGTAGGAGATGGAGGAGGG - Intergenic
1089089720 11:115861209-115861231 AAGAAAAAGTAGAAGGAGTAAGG + Intergenic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090013155 11:123062515-123062537 CGGAAAAAGGAGGAGGAAGAGGG + Intronic
1090029445 11:123194914-123194936 TAGCAAGAGGAGAAGGAGGAGGG + Exonic
1090380290 11:126321924-126321946 AAGACAAAAGAGATGGAAGATGG + Intronic
1090461997 11:126899431-126899453 CTGACAAAGGAAAGGAAGGAGGG + Intronic
1090480277 11:127061760-127061782 CAAAGAAAGGAGAAGGGGGAAGG - Intergenic
1090591475 11:128274862-128274884 CAGAGAATGGAGAAGCGGGAAGG - Intergenic
1090840559 11:130484212-130484234 AAGAAAAACGAAAAGGAGGAAGG + Intergenic
1090861429 11:130656205-130656227 GTGACAAAGGAAAAGTAGGAGGG + Intergenic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1091874072 12:3919183-3919205 TAGACAAAGAAGAAGAGGGAAGG - Intergenic
1092027540 12:5255326-5255348 TAGACACAGGAGTAGGATGACGG - Intergenic
1092127407 12:6084634-6084656 CTGACAAAGGAGAAGGGAGGGGG + Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1092714368 12:11373293-11373315 AAGAGAAATGAGCAGGAGGAAGG + Intronic
1092860063 12:12712609-12712631 CAAAGCAAGGAGAAAGAGGAAGG - Intergenic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093091109 12:14921348-14921370 CAGATAAATGAGGATGAGGAAGG + Intronic
1093125252 12:15321712-15321734 CAGGCAGAGGAGGAGGAAGAGGG + Intronic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093425148 12:19020257-19020279 AAGACAAAGCAGAAGCGGGAAGG + Intergenic
1094094499 12:26688539-26688561 CAGAGGAAGAAGAAGGAGAAGGG + Intronic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094173725 12:27521292-27521314 CAGCCACAGGAGATGGGGGAGGG - Intergenic
1094201878 12:27803417-27803439 CTGATGGAGGAGAAGGAGGATGG + Intergenic
1095404187 12:41849511-41849533 TAGGCAAAGAAGAAGGAGGTGGG - Intergenic
1095410294 12:41914117-41914139 AAGATAAAGGAGAATGAGAATGG + Intergenic
1095611023 12:44128218-44128240 CAGACAAAGGAAGAGAAGGCTGG - Intronic
1095662282 12:44751185-44751207 CAGACTAAGTGGAAGGGGGAAGG + Intronic
1095728372 12:45476809-45476831 CAGTCAAAGGAGGAAGAAGAGGG - Intergenic
1096016480 12:48280747-48280769 CAGATACCAGAGAAGGAGGAAGG - Intergenic
1096077952 12:48816558-48816580 CAGAGATATGAGAAGAAGGAGGG + Intronic
1096378168 12:51131825-51131847 CAGAAAAAGGAGAGGAAAGAAGG - Intronic
1096766980 12:53899321-53899343 AGGAAAAAGGAGAAGGAGGGAGG + Intergenic
1097594866 12:61616658-61616680 CAGGCAAAGGAGAAGGAGATTGG - Intergenic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1098051561 12:66459302-66459324 CACCCAAAGTAGAATGAGGATGG - Intronic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098504854 12:71237612-71237634 TAGAAAAAAGAGGAGGAGGAGGG - Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098826813 12:75306959-75306981 CACTCAGAGGAGAAGGAGTAAGG + Intronic
1098917866 12:76275899-76275921 CAGAGAGAGGGGAGGGAGGAAGG + Intergenic
1098971244 12:76859028-76859050 CCTACAAAGGAAAGGGAGGAAGG + Exonic
1099064911 12:77963917-77963939 CAGAAGGAGGAGAAGAAGGAAGG - Intronic
1099192351 12:79573487-79573509 CACACAAAAGAGAAAGAGAAAGG + Intergenic
1099351510 12:81575885-81575907 GAAACAAAAGAGAAGGAGTATGG - Intronic
1099398439 12:82170982-82171004 AAGAAAAAGAAGGAGGAGGAGGG + Intergenic
1099616430 12:84941516-84941538 AAGGAAAAGGAGAAGGAGAAGGG + Intergenic
1099869624 12:88330476-88330498 AAGAGAAAGGGGATGGAGGAGGG + Intergenic
1100455176 12:94744795-94744817 CAGAAATCGGAGAAGGGGGAGGG - Intergenic
1100647229 12:96544460-96544482 GAGAAAAAGGAGCAGGAGAAAGG - Intronic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1101011144 12:100450850-100450872 AAGACAAAGGAGAGGGAAAACGG + Intergenic
1101273882 12:103178056-103178078 CAGACACAGGAGAAGAGCGACGG + Intergenic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1101585739 12:106083984-106084006 GAGAGAAAGAGGAAGGAGGAGGG + Intronic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102201113 12:111058614-111058636 CAGATACAGGAGAAGCTGGAGGG + Intronic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1102230406 12:111257776-111257798 CAGGAAGAGGAGGAGGAGGATGG - Intronic
1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG + Intronic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102983723 12:117262448-117262470 CAGAGAGAGGAGAGGGAGGGAGG + Intronic
1103044826 12:117727395-117727417 CAGAAAAAGAAGAAAGAAGAAGG + Intronic
1103132644 12:118482490-118482512 GAGACACAGGAGAAGGCTGAAGG + Intergenic
1103162840 12:118744492-118744514 GAGAGAAAAGAGAAAGAGGAAGG + Intergenic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1103710939 12:122912192-122912214 CAGAAAAAGGAAAAGCAAGAGGG - Intergenic
1103795207 12:123498623-123498645 CAGACCAAGGAGCAGGAGATGGG - Exonic
1103964930 12:124632650-124632672 CAAAGAGAGGAGAGGGAGGAAGG - Intergenic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104512994 12:129398569-129398591 CAGGCAAAGGAGGAGGGGGTTGG + Intronic
1105299841 13:19123302-19123324 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
1105313514 13:19235444-19235466 CAGACAATGGAGAGGCAGCAAGG - Intergenic
1105524174 13:21160290-21160312 CTGACAAAGGAGGAGGAAGACGG + Intronic
1105572846 13:21620348-21620370 AAGAGAAAGGAGAAGGAGATTGG - Intergenic
1105575812 13:21650574-21650596 CAGAGAAAGAGGAAGAAGGAGGG - Intergenic
1105939774 13:25137373-25137395 CAGTCAAAGGAGAATGCTGATGG + Intergenic
1106021950 13:25924107-25924129 CAGACAACGTGGAAGGAGGAGGG - Intronic
1106466233 13:30016813-30016835 GAGGCAAAGGAGATGGGGGAGGG - Intergenic
1106538154 13:30666178-30666200 CAGCCAAAGGAGCAGGGGCAGGG + Intergenic
1106666863 13:31860433-31860455 CAGAAGAAAGAAAAGGAGGATGG - Intergenic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1106784897 13:33096901-33096923 TAGACTGAGGAGGAGGAGGAGGG + Intergenic
1107136564 13:36950926-36950948 CAGATAAAGTATCAGGAGGAAGG + Intronic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107316767 13:39140874-39140896 CAGACAAAGGAAAAAGAATAGGG - Intergenic
1107766643 13:43742473-43742495 TAGACAAATAAGATGGAGGAAGG - Intronic
1107826327 13:44332010-44332032 CTGACAAAGGAGGTGGTGGAGGG - Intergenic
1107971907 13:45651256-45651278 CAGTCAAGGGAAAAGGAGGTTGG - Intergenic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1108454552 13:50599717-50599739 AAGACAGAGGAGAAGTGGGAGGG - Intronic
1108596448 13:51954144-51954166 CAGGCAAAGGTTAAGGAAGAAGG + Intronic
1108854630 13:54777249-54777271 GAGAGAAGGAAGAAGGAGGAAGG + Intergenic
1109169789 13:59081250-59081272 CACACAAAGAAGGAAGAGGAAGG + Intergenic
1109218794 13:59619472-59619494 CACATAAAGGAGAAAGAGAAAGG + Intergenic
1109842645 13:67940101-67940123 CAGAAAAAGGAGAAAGACCATGG + Intergenic
1110862608 13:80359520-80359542 CAGACAAAGGGGCGGGATGATGG + Intergenic
1111277337 13:85967208-85967230 CAGACAATGGAGAGTGAGCAAGG + Intergenic
1111467049 13:88627336-88627358 CACTCACAGGAGAAAGAGGAAGG + Intergenic
1111523506 13:89435586-89435608 TAGACAGAGGACAAGGAAGATGG + Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1111622851 13:90746719-90746741 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
1112207302 13:97337429-97337451 TGGGCAAAGGAGACGGAGGAAGG - Intronic
1112221784 13:97498424-97498446 AATAGAAAGGAGAAGGAGGATGG - Intergenic
1112247836 13:97750552-97750574 CAGAGAGGGGAGAAAGAGGAGGG - Intergenic
1112371971 13:98802160-98802182 CAGACAAAGCAAAAGGAGACTGG - Intronic
1112404611 13:99107889-99107911 GAGAAAGAGGAAAAGGAGGAAGG + Intergenic
1112489090 13:99845835-99845857 AAAACGAAGGAGAAGAAGGACGG - Intronic
1113088419 13:106592236-106592258 TAGGCCAAGGAGGAGGAGGAGGG - Intergenic
1113167386 13:107457473-107457495 CAAGCACAGGAGAAGCAGGAAGG + Intronic
1113618064 13:111695039-111695061 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623597 13:111780300-111780322 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1114164300 14:20203301-20203323 GAAACAAAGGAAAAAGAGGATGG - Intergenic
1114408808 14:22481504-22481526 AAGACGAAGGGGGAGGAGGAAGG + Intergenic
1114441129 14:22748902-22748924 CTGTCAAAGGAGAAGGGGCACGG + Intergenic
1114525388 14:23364771-23364793 AAGAAAAAGGAGAATGGGGAGGG + Intronic
1115011935 14:28559278-28559300 CAGACACTGGAGTATGAGGAAGG - Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115318046 14:32046941-32046963 CAGAAAAATGTGAAGGAGGAAGG + Intergenic
1115365132 14:32549378-32549400 CAGATAAAGGAAAAGGAAGGTGG + Intronic
1115447287 14:33505856-33505878 CAGACAAGGGAGAGGGTGGTGGG - Intronic
1115451887 14:33557364-33557386 AAGACAGAGGGGAAGTAGGATGG - Intronic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1115873467 14:37833743-37833765 CACACAAAGGAGAAGGTGAAAGG - Intronic
1116149133 14:41116230-41116252 CAGACAGACAAAAAGGAGGAGGG + Intergenic
1116628404 14:47297387-47297409 GAGAGAAAGAAGAAAGAGGAAGG + Intronic
1117184342 14:53225187-53225209 TAAACAAAGGAGAAGGAGAAAGG - Intergenic
1117275019 14:54184694-54184716 CAGCAAAAGGAAAAGGAGAAAGG + Intergenic
1117416819 14:55504471-55504493 AAAACAAAGGGGAAGCAGGATGG - Intergenic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117553334 14:56858110-56858132 GAGAGAAAGAAGGAGGAGGAGGG + Intergenic
1117920122 14:60720902-60720924 CTGCCAAAGGAGCAGGAGGTAGG + Intronic
1118205599 14:63720324-63720346 GAGAAAAAGGAAAAGAAGGATGG + Intronic
1118245287 14:64104350-64104372 CAAGAAAAGGAGATGGAGGAGGG - Intronic
1118465098 14:66023671-66023693 GAGACAGAGGAGAAGGAAGATGG - Intergenic
1118621776 14:67620266-67620288 CAGAGAATGGAGAGGGAGGGAGG + Intronic
1118626080 14:67660578-67660600 CAGAAAGAGGAGCAGGAGAAGGG - Intronic
1118656244 14:67952706-67952728 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1118810268 14:69268031-69268053 AAGAGAAAGGGGAAGGATGAGGG - Intronic
1118857732 14:69637169-69637191 CAGACAGAGCAGAAAGAGGTGGG - Intronic
1119038252 14:71248795-71248817 CTTTCAAAGGAGGAGGAGGAGGG - Intergenic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119476773 14:74934977-74934999 CAGAGAAGAGAGAAGGAGAAGGG + Intergenic
1119573029 14:75693119-75693141 CTGAAAGAGGAGAAGGAAGAAGG + Intronic
1119865034 14:77966298-77966320 CAGGCAAAGGGGAGGGAGGCAGG - Intergenic
1120133264 14:80832674-80832696 CAAGCAAAGGAGAAGGAGTTGGG + Intronic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120306945 14:82782845-82782867 CAGACAGAGGAGGAGGAAGAAGG - Intergenic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1120778627 14:88464987-88465009 CAGAAACAGGAGGAGGAGGGAGG - Intronic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121085011 14:91139251-91139273 GAGAACAAGGAGGAGGAGGAAGG - Intronic
1121533728 14:94676799-94676821 AAAACAAAGGAGAACAAGGAAGG - Intergenic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1121760006 14:96436772-96436794 CAGAGAGAAGGGAAGGAGGAGGG - Intronic
1121787705 14:96674837-96674859 GAGACAAAGGAGGAGTGGGAGGG - Intergenic
1122029360 14:98901341-98901363 CAGACATAGAAGAGGGAAGAGGG + Intergenic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1122200415 14:100119156-100119178 CAGACAAATGAAAAAGAGAAAGG - Intronic
1122860483 14:104580270-104580292 CAGTCCCAGGAGAAGGGGGAAGG - Intronic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1124904708 15:33857742-33857764 CAGAGAAAGGAAAAGGAGTGGGG - Intronic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125065894 15:35486134-35486156 AAGGCAAAGGAGAAGCAGGCAGG + Intronic
1125286263 15:38095852-38095874 GATTCAAGGGAGAAGGAGGAAGG - Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125825290 15:42671459-42671481 CAGCCAATGGGGAAGGAGAAAGG - Intronic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1126811457 15:52409927-52409949 CTGAAAGAGGAGAAGAAGGAAGG + Intronic
1127267428 15:57373637-57373659 CACCCAAGGGAGAAAGAGGAGGG - Intergenic
1127296232 15:57610972-57610994 AAGACCAAGAAGAAGGTGGACGG + Intronic
1127410705 15:58703790-58703812 CAGTCATAGCAGAAGGAGAAGGG - Intronic
1127585100 15:60370889-60370911 CAGACACACGAGGAAGAGGATGG - Intronic
1127585873 15:60377253-60377275 AATATCAAGGAGAAGGAGGAAGG + Intronic
1127882805 15:63173005-63173027 CAGACAACAGAGGAGCAGGAAGG - Intergenic
1127953584 15:63833784-63833806 CACACACAGGACCAGGAGGACGG + Intronic
1127966799 15:63928779-63928801 CAGGCAAAGAGGAAGGAGAAAGG + Intronic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128310519 15:66629169-66629191 CAGACCCAGGGGAAGGAGGAGGG + Intronic
1128576242 15:68777191-68777213 CAGACAAAGGAGAGGAGAGAGGG - Intergenic
1128647253 15:69386909-69386931 CTGACTCAGGAGAAGGAGTAGGG - Intronic
1128818648 15:70632195-70632217 CTGACAAAGGAAAAGGAAGCTGG - Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1128930986 15:71704768-71704790 CAGACCAGGGAGAAGCATGATGG + Intronic
1128940860 15:71786733-71786755 GAAAGAAAGAAGAAGGAGGAGGG + Intergenic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129448331 15:75634454-75634476 CATAGAAAGGAGATGGAGGGAGG + Intergenic
1129499987 15:76026621-76026643 TATACAAAGGAGAAAGAGAAAGG + Intronic
1129522696 15:76195939-76195961 CAGAGAGAGGAGGAGCAGGAGGG - Intronic
1129601575 15:77001863-77001885 GAGAGAAAGGAGATGGATGAGGG + Intronic
1129648277 15:77458934-77458956 CACAGAAAGGAGAAGGGGGTGGG - Intronic
1129797255 15:78387227-78387249 CAGACCTAGGAGAAGTGGGAAGG + Intergenic
1130226006 15:82058867-82058889 GAGAGGAAGGAGAAGGGGGAAGG - Intergenic
1130424969 15:83787826-83787848 TTGAGAAAGGAGAAAGAGGAGGG - Intronic
1130795137 15:87199860-87199882 AAGAAAAAGAAGAAAGAGGAAGG + Intergenic
1131014207 15:89043710-89043732 AAGAGGAGGGAGAAGGAGGAGGG + Intergenic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131334459 15:91534407-91534429 CATAAAAAGGAGAGGGAGAATGG + Intergenic
1131591845 15:93758336-93758358 GAAACAAAGAAGGAGGAGGAAGG + Intergenic
1131660325 15:94507295-94507317 CAAACAAAGGAGAAAAAGAAAGG + Intergenic
1131776138 15:95800935-95800957 CAGAAAGATGAGAAGGAGCATGG + Intergenic
1131792069 15:95975800-95975822 CAGAAAAGAGGGAAGGAGGAAGG + Intergenic
1131901131 15:97088768-97088790 AAAAGGAAGGAGAAGGAGGAGGG - Intergenic
1132014204 15:98301493-98301515 AAGACAAAGAAGAAAAAGGAGGG + Intergenic
1132481787 16:169945-169967 CAGTCAGTGGGGAAGGAGGAAGG + Intergenic
1132482655 16:174202-174224 CAGTCAGTGGGGAAGGAGGAAGG + Intergenic
1132538816 16:497687-497709 AAAACAAATGAGAAGGAAGACGG - Intronic
1133392761 16:5422795-5422817 AAGAAAGAGGAGGAGGAGGAGGG + Intergenic
1133392825 16:5423007-5423029 AGGAGAAAGGAGAGGGAGGAAGG + Intergenic
1133634107 16:7649988-7650010 GGGAGAAAGGAAAAGGAGGAGGG + Intronic
1134068687 16:11247068-11247090 AAAAAAAAGGAGAAGGAGAAGGG - Intergenic
1134287185 16:12872041-12872063 AAGAGGAAGAAGAAGGAGGAGGG - Intergenic
1134329395 16:13236625-13236647 CAGAAAAAGAAGAGGAAGGAAGG - Exonic
1134377864 16:13695169-13695191 CAGACTAAGGAAAAAGAGGAGGG + Intergenic
1134657302 16:15956797-15956819 GAGGCTAAGGAGGAGGAGGAAGG + Intronic
1134745858 16:16587726-16587748 GAGAGAGAGGGGAAGGAGGATGG + Intergenic
1134999621 16:18766016-18766038 GAGAGAGAGGGGAAGGAGGATGG - Intergenic
1135190329 16:20349020-20349042 CAGACGCAGGAGAAGGAGCCTGG + Exonic
1135218507 16:20593019-20593041 AAGAGAAAGGAAAAGAAGGAAGG - Intergenic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1135271498 16:21073637-21073659 AAGATAAAGGAGCAGGAGAAAGG - Intronic
1135516292 16:23138449-23138471 CAGACTAGGGACATGGAGGATGG - Intronic
1135568852 16:23532806-23532828 GAGATAAAGTGGAAGGAGGAAGG - Intronic
1135728185 16:24873192-24873214 AAGGGAAAGGAGAAGAAGGAAGG + Intronic
1135795971 16:25442858-25442880 AAGGGAAAGGAGAAGGAGAAGGG - Intergenic
1135816451 16:25638725-25638747 CAGACAAAGAAGCAAAAGGATGG - Intergenic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1135939591 16:26809742-26809764 AATGCAAGGGAGAAGGAGGAAGG + Intergenic
1136589080 16:31206353-31206375 GAAAGAAAGAAGAAGGAGGAAGG - Intergenic
1136641772 16:31570859-31570881 CACACAAAGGAGGAAGAGAAAGG + Intergenic
1137333765 16:47527858-47527880 AGGACAAAGCAGCAGGAGGATGG + Intronic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137589023 16:49682208-49682230 GAGAAAAAGGGGCAGGAGGAAGG - Intronic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137640257 16:50022814-50022836 CTGACAAATGGGAAGGAGGAAGG + Intergenic
1137754850 16:50893102-50893124 CAGACATAGGAGGAAGAGGCAGG + Intergenic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1137938806 16:52660869-52660891 TATACAAAGGAGAAAGAGAAAGG + Intergenic
1138234499 16:55370558-55370580 CAGCCGCTGGAGAAGGAGGAAGG - Intergenic
1138282527 16:55783016-55783038 CAGAAAAAGGAGAAGGAAATTGG + Intergenic
1138286414 16:55813603-55813625 CAGAAAAAGGAGAAGGAAATTGG - Intronic
1138319403 16:56099056-56099078 CAGCAAAAAGAGAAGGAGGTGGG + Intergenic
1138396589 16:56709343-56709365 GAGACAAAGGGAAAGGTGGAGGG + Intronic
1138579404 16:57930546-57930568 GAGAGAGAGGGGAAGGAGGAGGG + Intronic
1138901964 16:61283090-61283112 AAAACAAAGAAAAAGGAGGAGGG - Intergenic
1139003524 16:62542779-62542801 CAGAGAAAGGTGAAGGTGAAAGG + Intergenic
1139193467 16:64891595-64891617 GAAAGAAAGGAGAAGGAAGAGGG + Intergenic
1139264306 16:65624693-65624715 GAGACAGAGGAGAAAGAGGGTGG - Intergenic
1139330319 16:66183550-66183572 AGGAGAGAGGAGAAGGAGGAAGG + Intergenic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1140170403 16:72598700-72598722 CAGACAATGGAGTGGGAGAAGGG + Intergenic
1140178301 16:72687699-72687721 GAGAGAAAGGAGAAAGAGAATGG - Intergenic
1140345517 16:74209315-74209337 CAGACAAAGGAGAAAGAAAATGG + Intergenic
1140693125 16:77503858-77503880 GAGACAGAGAAGAGGGAGGAGGG + Intergenic
1140939702 16:79709892-79709914 CAGCCAATGGAGAAAAAGGAAGG - Intergenic
1140973203 16:80033349-80033371 GAGAAAAAGGGGAAAGAGGAAGG + Intergenic
1141165136 16:81655296-81655318 CAGACCAACCAGAAGGTGGAAGG + Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141446462 16:84061811-84061833 CAGACACAGGAGAAACAAGATGG - Intronic
1141931631 16:87208500-87208522 CAGCAAAAAGAGAAGGAGAAAGG + Intronic
1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG + Exonic
1142441662 16:90102383-90102405 CAAACAAAAAAGAAGGAAGACGG + Intergenic
1142749695 17:1979812-1979834 CAGTCAAGGGGGGAGGAGGAGGG - Intronic
1142883965 17:2901365-2901387 CAGAGAAGGGAAAAGGAGGATGG - Intronic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1142958162 17:3535196-3535218 GACAGAAGGGAGAAGGAGGAGGG - Intronic
1143007632 17:3847116-3847138 AAGAAAGAGGAGAGGGAGGAAGG - Intergenic
1143254629 17:5546520-5546542 CAGACAAAGGAGAAATTGGCGGG - Intronic
1143276125 17:5712226-5712248 GAGACAGATGAGCAGGAGGAGGG + Intergenic
1143364381 17:6396317-6396339 CAGAGAAGGAAGAAGGAGAAAGG + Intronic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1143701118 17:8660913-8660935 AAGAGAAAGAAGAGGGAGGAAGG - Intergenic
1144212320 17:13025916-13025938 AAGAGAAAGGAAAAAGAGGAAGG - Intergenic
1144218925 17:13082627-13082649 CATATAAAGAAGGAGGAGGAGGG + Intergenic
1144783341 17:17818662-17818684 CAGAGAAAGCAGGAAGAGGATGG - Intronic
1144796419 17:17894406-17894428 CAGACAAGGGAGGAGCAGGCAGG - Intronic
1145262420 17:21362432-21362454 CAGATAAAGGAGAAGATGGATGG + Intergenic
1145324032 17:21783580-21783602 AAGACAAATGAGAAGGGGGCAGG - Intergenic
1145326580 17:21835215-21835237 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1145891171 17:28416841-28416863 CAGCCCAAGGAGAAGGATAAAGG + Intergenic
1146132191 17:30287880-30287902 CAGAGAAAGGAGCCTGAGGATGG - Exonic
1146314809 17:31798422-31798444 CAGCCAAGGGAGAGGGAGGCAGG + Intergenic
1146529100 17:33592690-33592712 CGGACCAAAGTGAAGGAGGAGGG + Intronic
1146557950 17:33842781-33842803 CATTCAGAGGAGAAGAAGGATGG + Intronic
1146673679 17:34758586-34758608 AGGAGAAAGAAGAAGGAGGAAGG + Intergenic
1146848543 17:36201673-36201695 CTGCCAAAGGAGATAGAGGAGGG - Intronic
1146947232 17:36882155-36882177 GAGACAAAAGAGCAGGTGGAGGG - Intergenic
1147035748 17:37679123-37679145 CAGAGAAACGTGAAAGAGGAGGG - Intergenic
1147195360 17:38762921-38762943 AAGTAAAAGGACAAGGAGGATGG - Intronic
1148006770 17:44438569-44438591 AAGACCAAGCAGAAGGATGAAGG + Intronic
1148118443 17:45192425-45192447 AAGAAAAAAGAAAAGGAGGAAGG - Intergenic
1148383901 17:47220935-47220957 CAGCCAGAGGAGAAGGGGGACGG - Intronic
1148511004 17:48169777-48169799 TAGATAATGGAGAAGGAGCAGGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1149170276 17:53801384-53801406 GAGAGAAAGGGGGAGGAGGAAGG + Intergenic
1149190946 17:54061011-54061033 CAGCCAGAGAAGAAGGAGTAAGG - Intergenic
1149430383 17:56592776-56592798 CCGGCCAAGGAGGAGGAGGATGG + Intergenic
1149455633 17:56785881-56785903 TTGACAAAGGAGATGGAGGTGGG - Intergenic
1149696968 17:58623714-58623736 CACAAATAGGAGGAGGAGGAAGG + Intronic
1149731342 17:58949664-58949686 CAGAGAAAGAAGAAAGAGAAAGG - Intronic
1150421614 17:65041683-65041705 GAGACAAAGGTGAAGGAAGAGGG + Intronic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150430350 17:65110689-65110711 AAGACAAAAAAGAAGGAGGCCGG - Intergenic
1150465196 17:65386681-65386703 AAGAGAAAGAGGAAGGAGGATGG - Intergenic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151084438 17:71364457-71364479 CACAGTAAGGAGAGGGAGGAGGG - Intergenic
1151412437 17:73940175-73940197 CAGAGAAGGGGGAAGGAGGGAGG + Intergenic
1151468040 17:74300355-74300377 CAGACATAAGAGAGGGAGGGAGG - Intronic
1151537524 17:74747416-74747438 CAGACACTGAGGAAGGAGGATGG - Intergenic
1151956505 17:77382822-77382844 GAGGCAAAGGCGAGGGAGGAGGG + Intronic
1152042745 17:77915072-77915094 CAGAGAAAAGGGCAGGAGGATGG - Intergenic
1152198993 17:78934307-78934329 CACACGGAGGAGGAGGAGGAAGG - Intergenic
1152302032 17:79500640-79500662 CGGGAAAAGGAGAAGGGGGATGG - Intronic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1203190770 17_KI270729v1_random:185806-185828 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1153655799 18:7281046-7281068 TAGACAAAGAGGAAGGAGGCAGG + Intergenic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1153815401 18:8786120-8786142 CAGAAAAAGGAGGGGGAGGGCGG - Intronic
1154370814 18:13761784-13761806 CAGGCAAAGCTCAAGGAGGAAGG - Exonic
1154989182 18:21583997-21584019 GAGAAAAAGGAGATGGTGGAAGG + Intronic
1155096517 18:22560685-22560707 CAGCCAAAGGAGAAAGTGGAGGG - Intergenic
1155530050 18:26757936-26757958 CTGACAAAGGAGAAGGAAAATGG - Intergenic
1155969617 18:32070005-32070027 GAGAGAGAGAAGAAGGAGGAAGG - Exonic
1155972993 18:32099244-32099266 AAAACAAAGCAGAAGTAGGAAGG - Intronic
1156135664 18:34034125-34034147 CAGACAAATGAGGAAGAGAAAGG + Intronic
1156192747 18:34738568-34738590 AAGAGAAAGGAGTAGAAGGAGGG - Intronic
1156480154 18:37431117-37431139 CAGACAGAGGAGAGCAAGGAGGG - Intronic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1156996744 18:43478380-43478402 TTGACAATGGATAAGGAGGAAGG - Intergenic
1157583178 18:48785113-48785135 AGGACAAAAGAGAAGGAAGAAGG - Intronic
1157638607 18:49188411-49188433 CAGACAATGGAAAAGGAAAATGG + Intronic
1157654189 18:49369263-49369285 CAGGCAATGGGGAAGGAGGGTGG - Intronic
1157775350 18:50390682-50390704 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
1159132293 18:64292672-64292694 CAGAGAGAGGAGAAGGGGTAAGG - Intergenic
1159271240 18:66153814-66153836 AAGACGAAGAAGGAGGAGGAGGG + Intergenic
1159420079 18:68206392-68206414 CAGACAATGGAGAATGTGTAGGG - Intergenic
1159502803 18:69295431-69295453 CAGAAAGAAGAGAAGGAGCAAGG + Intergenic
1159517675 18:69478401-69478423 GAGAAAAAGGAGGAGAAGGAAGG - Intronic
1159540303 18:69766241-69766263 TAGACACTGAAGAAGGAGGAGGG + Intronic
1159595156 18:70376146-70376168 CTGACAAAGGGAAGGGAGGATGG - Intergenic
1159669363 18:71203870-71203892 GAGACAGAGGAGAACAAGGAAGG - Intergenic
1159837666 18:73358792-73358814 CTGACCAAGGAGAAGGCAGAAGG - Intergenic
1160095032 18:75863512-75863534 CAGAGAAAGGAGTGGAAGGAAGG + Intergenic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1161016137 19:1984626-1984648 CAGGCAATGGAGATGGAGGCTGG - Intergenic
1161195438 19:2983752-2983774 AGGACAGAGAAGAAGGAGGAGGG + Intronic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161771740 19:6234434-6234456 CAGATAAAGGGGAACGAGGTGGG + Intronic
1161800575 19:6415101-6415123 AGGAGAAAGGAGGAGGAGGAGGG + Intronic
1162076466 19:8191154-8191176 CAAACAAAGAAGAAGAAGAAAGG - Intronic
1162320165 19:9966840-9966862 GACACAAATGAGAAAGAGGAGGG + Intronic
1162541110 19:11296503-11296525 CAGACGGAGGAGGAGGAGCAGGG + Intronic
1162768756 19:12936793-12936815 CTGACACAGGAACAGGAGGAAGG + Intergenic
1162823015 19:13234790-13234812 CTGCCAGAAGAGAAGGAGGAGGG + Intronic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163433959 19:17284062-17284084 AAGTCAAGGGAGATGGAGGAAGG - Intronic
1163668084 19:18612443-18612465 CAGGGAACGGAGAGGGAGGAAGG - Intronic
1164211940 19:23106207-23106229 AAGAAAAAAGAGGAGGAGGAAGG + Intronic
1164292311 19:23879573-23879595 GAGAAAAAGGAGAGGGAGGTGGG + Intergenic
1164521289 19:28982174-28982196 GAGAGGGAGGAGAAGGAGGAAGG + Intergenic
1164566025 19:29326689-29326711 AAGACAGTGGGGAAGGAGGATGG - Intergenic
1164631764 19:29766507-29766529 CAAAAAAAGAAGAAGGAAGAAGG - Intergenic
1164662060 19:29983292-29983314 AAGACAAAGTAGAAGGAAGATGG - Intronic
1164696574 19:30249337-30249359 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1164794293 19:31014015-31014037 GAGAAACAGGAGAAAGAGGAGGG + Intergenic
1164858646 19:31545021-31545043 GAGAAAGAGAAGAAGGAGGAGGG - Intergenic
1164864436 19:31592231-31592253 TAGACAGGGGTGAAGGAGGATGG - Intergenic
1165895718 19:39139708-39139730 CAGCCAAAGGATAAGGAGATTGG - Intronic
1166514458 19:43435944-43435966 CAGATAAAGAAAAAGAAGGAAGG + Intergenic
1166672423 19:44718931-44718953 AAGAGAAGGGAGTAGGAGGAGGG + Intergenic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1166854004 19:45773464-45773486 TAGACAAAGTAGCATGAGGAAGG + Intronic
1166965086 19:46524985-46525007 CAGAAAAAGAAAAAGAAGGAAGG - Intronic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167349856 19:48967894-48967916 CAGACCCAGGGGAAGGAGAAGGG - Intergenic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1168024211 19:53631985-53632007 CAGAGAAAGGTGGAGGAGGTGGG + Intergenic
1168105007 19:54161168-54161190 CAGACCCAGGAGAAGGACCAAGG + Exonic
1168136617 19:54356210-54356232 CAGGTAAAGGGGGAGGAGGAGGG - Exonic
1168141579 19:54391511-54391533 CAGACAGAGGGGTAGGAAGAGGG + Intergenic
925031615 2:654199-654221 CAGACACTGGAGAAGGTGGGAGG + Intergenic
925177670 2:1796752-1796774 CAGACACGGGAGGTGGAGGAGGG - Intronic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
925541440 2:4971989-4972011 GAGAGGGAGGAGAAGGAGGAAGG - Intergenic
925668646 2:6289027-6289049 CAGAGAAAGGAGATGCAGGAAGG - Intergenic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
926209311 2:10857525-10857547 GAGACGAAGGAAGAGGAGGAGGG - Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926558302 2:14386558-14386580 CAGAAGGAGGAGAAGCAGGAGGG + Intergenic
926718066 2:15940448-15940470 CAGACAAGGGGGAGGGAGAAAGG - Intergenic
926726928 2:16005675-16005697 AAGAAAGAGGAGAAGGAGGGTGG - Intergenic
926798441 2:16638143-16638165 CAGACAGAGGAGCAGTAAGAAGG + Intronic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
927292923 2:21422282-21422304 CAGGGAGAGGAGAAGAAGGAGGG + Intergenic
927471974 2:23384191-23384213 CAGACAGGGGTGGAGGAGGAGGG + Intergenic
927789992 2:26002259-26002281 CAGACAAATGGGAAGGAAGTTGG - Intergenic
927924431 2:27000623-27000645 GAGAGACAGGAGGAGGAGGAGGG + Intronic
928109000 2:28491274-28491296 CAGACAATGGAGAAGTAACATGG - Intronic
928136789 2:28693795-28693817 CATCCAAGGGGGAAGGAGGATGG - Intergenic
928323028 2:30298449-30298471 TAAAGAAAGGGGAAGGAGGATGG + Intronic
928324829 2:30311157-30311179 CAGGAAAATGAGAGGGAGGAGGG + Intronic
928389258 2:30896800-30896822 GAGACAGAGGAGAAGAGGGAGGG - Intergenic
929029147 2:37634769-37634791 CAAGCACAGGAGAAGGAGGATGG + Intergenic
929237745 2:39624428-39624450 AAGGCAGTGGAGAAGGAGGAGGG + Intergenic
929619989 2:43344936-43344958 CAGACAAAGAATAAGGACAAGGG + Intronic
929734615 2:44533735-44533757 CACACAAATGAGGAAGAGGAAGG + Intronic
929818054 2:45251613-45251635 CAATGAAAGGAGAAGGAGGTTGG - Intergenic
929908263 2:46065439-46065461 CGGACAAATGAGAAGATGGAAGG - Intronic
930225684 2:48790194-48790216 CAGACACAGCAGATGGAAGAAGG + Intergenic
930233373 2:48865307-48865329 CAGTCAAAGGAGAGGCTGGAGGG + Intergenic
930355974 2:50320647-50320669 AACACAGAGGGGAAGGAGGAGGG + Intronic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930684086 2:54289215-54289237 GTGACAAAGTAGAAGAAGGAAGG - Intronic
931174075 2:59835325-59835347 AAGAAAAAAGAGAAGGGGGAAGG - Intergenic
931471438 2:62541688-62541710 CAGACAGGAGAGAAGGAGAAGGG + Intergenic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
931852956 2:66271665-66271687 GAGAGAAAGGAGAAACAGGAGGG + Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932155799 2:69416020-69416042 CAGAAAAAAGGAAAGGAGGAAGG + Intronic
932300570 2:70664070-70664092 CAGAGAAAGGAGAAGGCGTGAGG + Intronic
932555380 2:72819489-72819511 CAGAGAAAGGAGGAGGAGATAGG - Intronic
932624526 2:73286771-73286793 AACAGAAAGGGGAAGGAGGAGGG - Intergenic
933161106 2:79026140-79026162 CTGACACAGGAGAATGAGGCAGG - Exonic
933231071 2:79808263-79808285 AGGAGAAGGGAGAAGGAGGAAGG + Intronic
933789208 2:85870422-85870444 ATGAAAAAGGAGAACGAGGAGGG - Intronic
933808558 2:86017849-86017871 GGGAAAAAAGAGAAGGAGGAGGG - Intergenic
933895373 2:86806437-86806459 CAGGCCAAGGACAAGGAGGAAGG - Intronic
934046492 2:88176988-88177010 AAGACAAGGGAGTAGGAGGCAGG - Intronic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
935079486 2:99778199-99778221 CAGAGGAAGGAGGAGGAGAAGGG - Intronic
935354728 2:102187668-102187690 CAGACGAAGGAGACAGGGGAAGG + Intronic
935733712 2:106089022-106089044 CATAGAAAGAAGAAAGAGGATGG - Intergenic
936379439 2:111970828-111970850 GAGAAGGAGGAGAAGGAGGAGGG - Intronic
936559130 2:113521127-113521149 GATAGAAAGGAGAGGGAGGAGGG + Intergenic
936658476 2:114515723-114515745 CAGAAAAAGAAGAAGGAAAAGGG - Intronic
936838619 2:116740889-116740911 CTGGCAAAGGAGAAAGGGGAAGG + Intergenic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937268638 2:120633139-120633161 CAGAAAAAGGAGGGGGAGGAGGG + Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937633493 2:124129537-124129559 AAGACAAAGGGCAAGGAAGAGGG + Intronic
937887962 2:126913235-126913257 ATGAAAAAGGAGAAGGATGATGG - Intergenic
937927613 2:127179228-127179250 CAGACTCTGGAGATGGAGGAAGG - Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938154502 2:128921411-128921433 AAAGAAAAGGAGAAGGAGGAAGG - Intergenic
938287984 2:130134574-130134596 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
938427604 2:131204303-131204325 CAGAGAGAAGAGAAAGAGGAAGG + Intronic
938468541 2:131538325-131538347 CAGAGAGAAGAGAAAGAGGAAGG + Intergenic
938676066 2:133635207-133635229 CAGACAGAGGAAAAGGAAGGGGG + Intergenic
938736594 2:134191669-134191691 GAGAAAGAGGAGGAGGAGGAGGG - Intronic
938975876 2:136478181-136478203 GACACAAAGGGGAAAGAGGAAGG - Intergenic
939059825 2:137408315-137408337 AAGATAAAGGAGAAGGGGGAAGG - Intronic
939095596 2:137830203-137830225 CGCAGAAAGGAGAAGCAGGAAGG - Intergenic
939136065 2:138295781-138295803 AAGAAAAAGGAAGAGGAGGAGGG - Intergenic
939427376 2:142056813-142056835 AAGATATGGGAGAAGGAGGAAGG - Intronic
939524227 2:143272283-143272305 CAGAAAAAGCAGAAAGAGTATGG - Intronic
939855385 2:147352758-147352780 CAGAGAGAGAAGAATGAGGAAGG + Intergenic
939966951 2:148619639-148619661 GGGAAAAAGGAGGAGGAGGAGGG - Intergenic
939967367 2:148623682-148623704 CAAGAAAAGGAGAAGAAGGATGG - Intergenic
940018635 2:149133399-149133421 AAGTCAAAGGACAGGGAGGAAGG - Intronic
940164056 2:150748397-150748419 AAGAAAAAGAAGAAAGAGGAAGG - Intergenic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
940332468 2:152490178-152490200 CAAAAAAAGGGGAAAGAGGAGGG + Intronic
940430640 2:153586059-153586081 CACACAAAGGAGGAAGAGAAAGG + Intergenic
941231967 2:162921466-162921488 AAGAAAGAGGAGAAAGAGGAAGG + Intergenic
941325008 2:164103530-164103552 AAGACAAGGAAGAAGGGGGATGG + Intergenic
941712748 2:168731609-168731631 GGGACAAAGGAGAAGTAGCAGGG + Intronic
942339373 2:174927079-174927101 CAGATATTGGGGAAGGAGGAAGG - Intronic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
943034484 2:182725206-182725228 GAGAAAAGGGAGAAGGAAGAGGG - Intronic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
943736062 2:191355853-191355875 CTCACAATGGAGATGGAGGATGG + Intronic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944218568 2:197279655-197279677 CAAACTAGGAAGAAGGAGGAAGG - Intronic
944686325 2:202121087-202121109 AAGTCCAAGGAGAACGAGGAGGG - Intronic
944748258 2:202680269-202680291 CTGACAAGGGAGAGGGGGGAGGG + Intronic
944882388 2:204026682-204026704 AAGCCACAGGAGAATGAGGAAGG + Intergenic
945147135 2:206750204-206750226 GAGGCAGAGGAGAAGCAGGAAGG - Intronic
945155438 2:206832850-206832872 TAAATGAAGGAGAAGGAGGAAGG - Intergenic
945175983 2:207043931-207043953 AAGAGAGAGGAGAAGGAAGAAGG + Intergenic
945287376 2:208096088-208096110 CTGACAAATGAGAGGAAGGATGG - Intergenic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945685248 2:212960971-212960993 GAGACAAGGAAGAGGGAGGAAGG + Intergenic
945805290 2:214482986-214483008 TGGTCAAAGGAGAGGGAGGAAGG - Intronic
945893855 2:215459991-215460013 GAGACAGAAGAGAAGGAGGGAGG - Intergenic
946076651 2:217079211-217079233 TACAAAAAGGAGAAGAAGGAGGG + Intergenic
946144427 2:217718339-217718361 CAGAGAGAGGAGAAGAAGGGAGG - Intronic
946237354 2:218332365-218332387 CAGAAAGAGAAGAAGCAGGATGG + Intronic
946239787 2:218346486-218346508 CAGACAAGGCAGGAGGAGCAGGG - Exonic
946683096 2:222238589-222238611 CAGACATGGGAGGAGGTGGAGGG + Intronic
946919637 2:224565388-224565410 CAGGCACAAGAGATGGAGGAGGG + Intronic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
947530868 2:230907938-230907960 CAGAGAAAGAAGTGGGAGGAGGG + Exonic
947823484 2:233088777-233088799 CAGGCACAGGGGAAGGAGAAAGG + Intronic
948533180 2:238626523-238626545 CTGAGAAAGGAGAACAAGGAGGG - Intergenic
948538971 2:238672223-238672245 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
948857908 2:240738835-240738857 CAGACAGGAGAGAAGGAAGAGGG - Intronic
948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG + Intergenic
948999697 2:241606214-241606236 AAGACAAAGGCCAAGCAGGAAGG - Intronic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1168904341 20:1391807-1391829 TTGAGAAAGGGGAAGGAGGAGGG + Intronic
1169384978 20:5141077-5141099 GAGAGAAAGGAGCAGGAGAAAGG - Intronic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1169987926 20:11467655-11467677 CACACAAAGAAGAAAGAGAAAGG - Intergenic
1170160606 20:13306540-13306562 CAGCAAATGGAGAAGGAGAAAGG + Intergenic
1170306354 20:14942441-14942463 AAGAAAAAGGAGGAGGAGAAAGG - Intronic
1170462065 20:16586677-16586699 CAGCCAAAGGAGAAGGTGAAGGG + Intergenic
1170505841 20:17024959-17024981 CAGAGAAAGCAGAAGAAGGTGGG + Intergenic
1170706499 20:18749010-18749032 CAGGCAAAAGAGGAGGAAGAGGG + Intronic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1171094619 20:22319493-22319515 GAGAAAGAGGAAAAGGAGGAGGG + Intergenic
1171109247 20:22465242-22465264 CTGCCAGAGGAGAAGGAGGTGGG - Intergenic
1171283896 20:23922368-23922390 GAGACAAAGGAAAAAGAGGAGGG - Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171339920 20:24419817-24419839 CAGACCTAGTAGAAGGAGGCAGG + Intergenic
1171349672 20:24492766-24492788 AAGGCAAAGGGGAAGGAAGATGG - Intronic
1171796754 20:29572446-29572468 AAGGCAGAGGAGGAGGAGGAAGG + Intergenic
1171851493 20:30311720-30311742 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1172208182 20:33179574-33179596 CGGAGAAAGGAGGAAGAGGAGGG - Intronic
1172392367 20:34574595-34574617 CAGGCAGAGGAGAAGGGGGCCGG - Intronic
1172981595 20:38946553-38946575 TATATAAAGGAGCAGGAGGAGGG - Intronic
1173408192 20:42785792-42785814 GAGACAAAGGGGAAGGAGGAAGG - Intronic
1173594629 20:44250785-44250807 CCCACAAAGGAGGAGGAGGCTGG - Intronic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1173900384 20:46583447-46583469 CAGTGAAAGGAGAAGCAGGAAGG + Intronic
1173952772 20:47006326-47006348 TTCACAAAGGAGAAGGAGGCAGG + Intronic
1174583573 20:51590660-51590682 CAGACAAAGGAGAAGGCAAAGGG - Intergenic
1174602523 20:51736226-51736248 AAGATAAAGGACAAGGAGGGAGG + Intronic
1174638543 20:52023020-52023042 CAAAGAAAGCAGAAGGAAGAAGG - Intergenic
1174687085 20:52466358-52466380 CAGACAGAATAGAGGGAGGATGG + Intergenic
1174709528 20:52690275-52690297 AAGAAAAAGGAGAAGGGGAAGGG - Intergenic
1174795885 20:53522339-53522361 CAAACAAAGGAAAAGAATGATGG - Intergenic
1174805699 20:53602691-53602713 CACACAAAGCAGTAGCAGGATGG - Intronic
1174832720 20:53827786-53827808 GAGACAAAGAGGGAGGAGGATGG - Intergenic
1174908858 20:54584309-54584331 CACACAAAAGAAAATGAGGAAGG - Intronic
1175298882 20:57928758-57928780 AAGAGAAAGGAGGAGGAAGATGG - Intergenic
1175374708 20:58516043-58516065 CAGAAAAAAGAGAACCAGGAAGG + Intergenic
1175657805 20:60787023-60787045 GGGAGAAAGGAGGAGGAGGAGGG - Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1176733112 21:10520051-10520073 CACACAAAGCAGTAGCAGGATGG + Intergenic
1176952894 21:15065865-15065887 AAGACAAGGGAAAAGGAGCAGGG + Intergenic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177182517 21:17758461-17758483 GAGACAGAGGAACAGGAGGATGG - Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1177833942 21:26170203-26170225 CAGACAGGGGGGAAGGGGGAAGG - Intronic
1178123793 21:29496033-29496055 CAGGAAAAGGATAAGAAGGAAGG - Intronic
1178165700 21:29973609-29973631 TAGACTATTGAGAAGGAGGAAGG - Intergenic
1178457855 21:32772203-32772225 CAGATGAGGGAGGAGGAGGAGGG + Intergenic
1178536575 21:33414852-33414874 GAGAAAAAGAAGAGGGAGGAAGG - Intronic
1178679420 21:34660083-34660105 CAGACACTGGGGAGGGAGGATGG - Intergenic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1178721713 21:35016591-35016613 CAGAAGAAGGAGCAGGATGAGGG - Intronic
1178741545 21:35206612-35206634 CAGAGAGAGGAGGGGGAGGAGGG - Intronic
1178837097 21:36108011-36108033 CAGCCATAGGAGGTGGAGGAGGG - Intergenic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179092839 21:38283888-38283910 CAGGCAAAGGAGACTGAGGAGGG - Intronic
1179151994 21:38816977-38816999 CAGACACAGGAGACGTAAGATGG - Intronic
1179353433 21:40635160-40635182 CAGACAAGGCAGAAGAAAGAAGG + Intronic
1179638904 21:42734021-42734043 AAGGCAACGGAGAAGCAGGAGGG - Intronic
1180798613 22:18620595-18620617 CAGAGAATGGAGTAGAAGGAAGG + Intergenic
1181223103 22:21374669-21374691 CAGAGAATGGAGTAGAAGGAAGG - Intergenic
1181255635 22:21560965-21560987 CAGAGAATGGAGTAGAAGGAAGG + Intronic
1181534212 22:23533385-23533407 GAGACAAAGGCTGAGGAGGAAGG + Intergenic
1181675548 22:24449226-24449248 AAGACAGAGGATTAGGAGGAGGG + Intergenic
1182329647 22:29542047-29542069 CTGAGAGATGAGAAGGAGGAAGG - Intronic
1182522875 22:30894030-30894052 CAGGCAAAGGAGAGGGAAGGAGG + Intronic
1182679872 22:32070308-32070330 CAAAGAAAGTAGAAGGAAGAAGG - Intronic
1183029859 22:35095473-35095495 CTGGCAATGGAGAAGGAGGTTGG + Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183690817 22:39387431-39387453 GAGAGAGAGGAGAATGAGGAAGG + Intergenic
1183718929 22:39550937-39550959 CAGAGAAACGCCAAGGAGGAAGG + Intergenic
1184245306 22:43232817-43232839 CCGACAAGGGAGCAGGAGCATGG - Intronic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1184959365 22:47917906-47917928 GGGAGGAAGGAGAAGGAGGAAGG - Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185304942 22:50109852-50109874 AAGAGAAAGGAAAAGGAGGCTGG + Intronic
1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG + Intergenic
949127947 3:469091-469113 GAGGAAAAGGAGAAGGGGGACGG - Intergenic
949159403 3:861493-861515 CAAACAAAGGAGCAATAGGAGGG - Intergenic
949165325 3:933670-933692 GAGTTAAAGGAGAGGGAGGATGG + Intergenic
949214281 3:1546583-1546605 CAAGCAAGGGAGAATGAGGAGGG + Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949567239 3:5256265-5256287 GAGAAAAAAGAGAAGGAGAAGGG - Intergenic
949657345 3:6235823-6235845 CAGACAAAGGAGCATGTAGAGGG - Intergenic
949665736 3:6337489-6337511 AAGATAAAAAAGAAGGAGGAGGG + Intergenic
950115589 3:10448684-10448706 CAGACAAAGCAGTAGGAAGATGG - Intronic
950283318 3:11725246-11725268 GAAGAAAAGGAGAAGGAGGAGGG - Intergenic
950394016 3:12719684-12719706 GAGACAGAGGAGAAGGAGAGAGG + Intergenic
950841660 3:15973949-15973971 GAGGAAGAGGAGAAGGAGGAAGG - Intergenic
950850176 3:16054747-16054769 CAGATAAAGGAGAAAGAAAATGG - Intergenic
951269700 3:20608784-20608806 CATCCATAGGAGAAGGAGGAAGG + Intergenic
951554432 3:23906537-23906559 TAGACTGAGGAGAAGGAGGAGGG - Intronic
951679936 3:25284060-25284082 CAGCAAAATGAGAAGGAGGGAGG - Intronic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
951947755 3:28160525-28160547 CACACAAAGGAGGAAGAGAAAGG + Intergenic
951963217 3:28352070-28352092 GAGACAAAGGAGACGGGGGAAGG - Intronic
951995727 3:28726092-28726114 CAGACAAAGGATGAGAATGAAGG - Intergenic
952320621 3:32274507-32274529 CAGACAGACAGGAAGGAGGAAGG - Intronic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
953145539 3:40271164-40271186 GAGACCAAGCAGAAAGAGGAAGG + Intergenic
953164234 3:40450245-40450267 CAGAAAAATAAAAAGGAGGATGG - Intergenic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
953365400 3:42340417-42340439 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
953472130 3:43176721-43176743 CGGAGAAAGGAAATGGAGGAAGG + Intergenic
953530632 3:43736777-43736799 GAGACAAATGAGAAGGATTAAGG + Intergenic
953664932 3:44918585-44918607 CAAACACAGCAGAAGGACGATGG + Intronic
953677527 3:45014876-45014898 CAGTCAAAGGGGATGGGGGATGG + Intronic
953784158 3:45897755-45897777 CAGACAAGGAAGAAAGAAGAAGG - Intronic
953806223 3:46070908-46070930 TACACAAAGGAGGAAGAGGAAGG - Intergenic
953955203 3:47226688-47226710 AAGAGAAAGGAGCTGGAGGAGGG + Intergenic
954626315 3:52023865-52023887 CAGCCAGGGGAGAAGGAGGGAGG - Intergenic
954634592 3:52064695-52064717 CAGGCAGAGGAGAAGGGGAAAGG + Intergenic
954945709 3:54422417-54422439 CAGACAAAGGACCAGTATGAAGG + Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955347659 3:58173108-58173130 GAGACAGAGGAGGAGGAGGTGGG - Intergenic
955475336 3:59330384-59330406 AGGAGAAAGGAGAAGGAGAAAGG + Intergenic
955514294 3:59711510-59711532 GAGAAGGAGGAGAAGGAGGAGGG - Intergenic
955566225 3:60249715-60249737 CACACACGGGAGAAGGGGGAAGG + Intronic
955703123 3:61701913-61701935 AAGAGGAAGGAGAGGGAGGAAGG + Intronic
955850996 3:63219785-63219807 TAGACTGAGGAGGAGGAGGAAGG + Intergenic
956147837 3:66210116-66210138 TAGAAAAGGGAGAAGGAGGGAGG - Intronic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
956682275 3:71791880-71791902 CAGACCTAGGAAAAGGAGGTGGG - Intergenic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
956768556 3:72505293-72505315 AGGACAAAGGAGAAGGAGGAAGG + Intergenic
957470139 3:80648723-80648745 TAAACAAAGGAGAAAAAGGAAGG - Intergenic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
957768280 3:84655453-84655475 CACAGAAAGGTGAAGGTGGAAGG + Intergenic
957787142 3:84897696-84897718 CACACAAATGAGAAAGAGAAAGG - Intergenic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
957998681 3:87725075-87725097 TATACAAAGGAGAATGAGAAAGG - Intergenic
958157765 3:89776246-89776268 AAGAAAGAGGAGGAGGAGGAGGG - Intergenic
958827075 3:99042946-99042968 CATACAAAGGAGAAAGAGAAAGG + Intergenic
958906602 3:99948621-99948643 GAGAGGAAGGAGGAGGAGGAGGG + Intronic
959002529 3:100981404-100981426 GAGAGAAGGGAGAAAGAGGAGGG + Intronic
959248367 3:103904963-103904985 CAGAAAAAGGAAAAGTAAGAAGG + Intergenic
959314846 3:104790412-104790434 CAGACAAAGGAGTTGAAAGAAGG + Intergenic
959421161 3:106130839-106130861 CTGACAAATGAGAAAGACGATGG - Intergenic
959518218 3:107294802-107294824 CTCACAAACTAGAAGGAGGATGG - Intergenic
959578213 3:107957703-107957725 CAAGGAAAGGAGGAGGAGGAGGG + Intergenic
959963810 3:112332213-112332235 AAGACGAAGGAGGAGGAGGAGGG + Intergenic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960121677 3:113953672-113953694 CAGAAAAAGCACAAAGAGGAGGG - Intronic
960243295 3:115371142-115371164 GAGAGAAAGGAGAATGTGGAAGG - Intergenic
960333240 3:116388287-116388309 CACCCAAAGGAAAAGGTGGAGGG + Intronic
960350383 3:116585757-116585779 AAGAAAGAGGAGAAGGAGGAGGG + Intronic
960598666 3:119432870-119432892 CAAAGACAGGATAAGGAGGAAGG + Intronic
960715033 3:120566716-120566738 AAGAGAAAGGAGCGGGAGGAGGG - Intergenic
960942027 3:122941164-122941186 CAGGCAGAAGAAAAGGAGGAAGG + Intronic
961379980 3:126490746-126490768 CTGACTAAAGAGAAGGAGTAGGG + Intronic
961646490 3:128395420-128395442 CATTCAGAGGAGGAGGAGGAAGG - Intronic
961812578 3:129530400-129530422 CCGAGAAGGGAGAGGGAGGAAGG + Intronic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
962417270 3:135194457-135194479 CAGACAAGCGAGAAGCAGGTAGG + Intronic
962462760 3:135629914-135629936 CAGAGAACGGGGAGGGAGGAAGG - Intergenic
962501501 3:135998340-135998362 CAGACAAAGGACATGAAGAAAGG + Intronic
962598747 3:136974196-136974218 CACACAAAGGAGGAAGAGAAAGG - Intronic
962876997 3:139542731-139542753 CAGAGAGATGAGGAGGAGGAAGG + Intergenic
962938075 3:140100000-140100022 AAAACGAAGGAGAAAGAGGATGG - Intronic
962952186 3:140229486-140229508 GAGAAAAAGGAAAAGGAGGGTGG - Intronic
963234301 3:142941365-142941387 CAGACAGAAGGGAAAGAGGAAGG - Intergenic
964236002 3:154528592-154528614 AAGAAAAAGGAAAAGGAGGAAGG - Intergenic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964555717 3:157936020-157936042 CTGCCAGAGGTGAAGGAGGAGGG + Intergenic
965027616 3:163323656-163323678 CACACAAAGGAGAAATAGAAAGG - Intergenic
965611359 3:170547131-170547153 GAGGAAAAGGAGAAGAAGGAAGG - Intronic
965888099 3:173474129-173474151 AAGGAAAAGGAAAAGGAGGAGGG - Intronic
965906494 3:173713980-173714002 AAGAAAAAGGAGAAAGATGAAGG + Intronic
966211447 3:177457590-177457612 CAGACAAGGGAGGGGAAGGAAGG - Intergenic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966744160 3:183259835-183259857 GAGACCAAGAAGAAGAAGGAGGG + Intronic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
966954738 3:184864120-184864142 AAGAGGAAGGAGAAGGAGAAGGG + Intronic
966958564 3:184910093-184910115 CAAAGAAAAGAGAAAGAGGAAGG - Intronic
967146793 3:186613149-186613171 AAGACAAAGGAGCAGGACGAGGG - Exonic
967407883 3:189137758-189137780 CAGAGACACGAGAAGGGGGAAGG - Intronic
967465286 3:189798016-189798038 CAGTCAAAGGATAGGGAGGAAGG - Intronic
967627767 3:191705560-191705582 CAGACAAATAAGAAAGAGAAAGG + Intergenic
967676481 3:192305058-192305080 CAGAGAAGGGAGAGGAAGGAGGG + Intronic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
968223972 3:196961025-196961047 CAGTCAAAGCAGCAGGAAGATGG - Intronic
968361918 3:198153350-198153372 CAAACAAAAAAGAAGGAAGACGG + Intergenic
968945008 4:3658964-3658986 GAGACAAAGGAGAGGAGGGAAGG - Intergenic
969199308 4:5589971-5589993 TAGAGAAAAGAGAAGGTGGAGGG + Intronic
969273419 4:6118408-6118430 CAGACAAATGACATGGAGGCTGG + Intronic
969372633 4:6743515-6743537 AAGAAAAAGAAGAAGGGGGAGGG - Intergenic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
969594943 4:8143534-8143556 CAGACAAAGCAGTGGGAGAAGGG - Intronic
969692899 4:8715435-8715457 CAGAAAATAGAGGAGGAGGAAGG - Intergenic
969722058 4:8897613-8897635 CAGACAGGAGAGAAGGAGGAGGG - Intergenic
970326833 4:14934513-14934535 CAGGCTGAGGAGGAGGAGGACGG + Intergenic
970506730 4:16738384-16738406 CAGGAAGAGGAGGAGGAGGAAGG + Intronic
970571979 4:17392373-17392395 CAGACAAAGGGAAGGAAGGAAGG + Intergenic
970597341 4:17612530-17612552 CAGAGAGAGAAGGAGGAGGAGGG + Intergenic
970735781 4:19165870-19165892 CAGACAAATCAGAAGGAGTCTGG + Intergenic
970802572 4:19991488-19991510 GAGACTAAGGAGGATGAGGAGGG - Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971055924 4:22912396-22912418 GAGAGAAAGGGGAAGGAGGAAGG - Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971919800 4:32923107-32923129 AAGACAAAGGAGCAGGTGGCTGG - Intergenic
972092244 4:35301659-35301681 CAGACAAAAGAGCAGCAGCAGGG - Intergenic
972156784 4:36172892-36172914 CACAGAAAGGAGCAGCAGGATGG - Intronic
972485484 4:39536193-39536215 CAGCTAGAGGAGAATGAGGAGGG - Intergenic
972652191 4:41028908-41028930 TAGAAAAGGGAAAAGGAGGAGGG - Intronic
972660349 4:41110139-41110161 CATACAGAGGCCAAGGAGGAGGG - Intronic
972990497 4:44817683-44817705 GAGGAAGAGGAGAAGGAGGAAGG + Intergenic
973246049 4:48012510-48012532 CAGCAAAAGGAAAAAGAGGAAGG - Intronic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
975374092 4:73622138-73622160 CAGACAATGGAGGTGGAGCATGG - Intergenic
975495904 4:75035631-75035653 GAGATAAAAGGGAAGGAGGAGGG - Intronic
976143258 4:82015283-82015305 GAAGAAAAGGAGAAGGAGGAGGG + Intronic
976153863 4:82121299-82121321 CAGGCAGGCGAGAAGGAGGAAGG + Intergenic
976217503 4:82729015-82729037 CAGGCAGAGGAGAGGGAGAAAGG + Intronic
976283604 4:83349278-83349300 GAGAAAAATGAGTAGGAGGATGG - Intergenic
976823176 4:89230374-89230396 CTGACACAGGTGAAGAAGGAAGG - Intergenic
976890416 4:90039766-90039788 CAGACAAAGAGAGAGGAGGAAGG - Intergenic
976895430 4:90104304-90104326 CAGTCAAACGAGAAGGAACATGG + Intergenic
977205247 4:94158613-94158635 AAGACAAAGCAGGAGGAAGAAGG - Intergenic
977328353 4:95605504-95605526 ATGACAAAGAAGAAGGAGAACGG - Intergenic
977534176 4:98237795-98237817 CAGAAAAGGGTGAAGGAAGAAGG + Intergenic
977566872 4:98589457-98589479 CAGACAAAGGAAAGGGAAGGAGG + Intronic
977718025 4:100205878-100205900 CATACAAAGGAGAAAGATTAAGG + Intergenic
977745174 4:100538475-100538497 CAGAGAAATGAGCAGGAGGGTGG + Intronic
978138068 4:105287531-105287553 CACACAAAGGAGGAAGAGAAAGG - Intergenic
978277343 4:106967871-106967893 AAGCAAAAGGAGAAGAAGGAAGG + Intronic
978572786 4:110157121-110157143 AAGGCCAAGAAGAAGGAGGAGGG + Intronic
978844638 4:113258194-113258216 GAGAAAAAGGAAAGGGAGGAAGG - Intronic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
979286329 4:118929115-118929137 GAGATAAAGGAAAAGTAGGAAGG + Intronic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
980559838 4:134459071-134459093 CACAGAAAGGAGAAGAATGAAGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981166998 4:141572141-141572163 TAGACAAAAGAAAGGGAGGACGG - Intergenic
981379523 4:144056906-144056928 CAGAGAGAGGAGAAGGAGTGAGG + Intergenic
981468702 4:145103676-145103698 CTGAAAAAGGGGAAGCAGGATGG - Intronic
981816426 4:148835877-148835899 CCCAGAAAGGAAAAGGAGGATGG - Intergenic
981902206 4:149879850-149879872 CAAACAAATAAGAAGGAGAAGGG + Intergenic
982050737 4:151498882-151498904 CAGAAAAACAATAAGGAGGAAGG - Intronic
982216211 4:153084689-153084711 CAACCAAATGAGAAGGAGCAGGG - Intergenic
982316527 4:154037546-154037568 ATGGCAAAGGAGAAGGAGGTTGG - Intergenic
982340476 4:154293075-154293097 CAGCCAAGGGTGAAGGAAGAGGG - Intronic
982663961 4:158238318-158238340 CAGATAAAGGAGAATTTGGAGGG + Intronic
983019134 4:162653529-162653551 AAGAAAAAGGACAAGGAGGTTGG - Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983523413 4:168734937-168734959 GAGAGAGAGGAGAAAGAGGAGGG + Intronic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
983659288 4:170116889-170116911 CAGAACAAAGAGTAGGAGGACGG - Intergenic
984257052 4:177401643-177401665 TAGAAACAGGAGAGGGAGGAGGG - Intergenic
984479072 4:180275715-180275737 GGGACAGAGAAGAAGGAGGAAGG + Intergenic
984703982 4:182834573-182834595 AGGGGAAAGGAGAAGGAGGAGGG - Intergenic
985341467 4:188959219-188959241 CAGCCAAAGCAGCAGCAGGAAGG - Intergenic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
986129375 5:4912731-4912753 GAGAGAAAGGAGAAGGAAGAAGG + Intergenic
986211595 5:5678730-5678752 GAGAGAAAGGAAAAGGATGAGGG + Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
986461822 5:7980356-7980378 CAGACACATGAGAAGGAAAAGGG - Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986865516 5:11981859-11981881 CAGAGAAAGTAGAATGTGGAAGG - Intergenic
987011787 5:13773854-13773876 CAGACAAAGGAGGAGTGGGTGGG + Intronic
987114971 5:14718925-14718947 GAGACAGAGCAGAAGGATGAAGG + Intronic
987214638 5:15721535-15721557 CAGAGAGAGGAGAAAGGGGAAGG - Intronic
987384550 5:17316714-17316736 GAGACAGAGGAGGAGGATGAAGG - Intergenic
987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG + Intergenic
987849632 5:23333736-23333758 AAAACAAAGGAGAAAGAGGAAGG - Intergenic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988426620 5:31072690-31072712 CAGAAATAGGAGAAGAAGAAGGG - Intergenic
988484447 5:31656954-31656976 GATACACTGGAGAAGGAGGAGGG + Intronic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
989142325 5:38213879-38213901 TAGAGAAAAGAGAATGAGGAGGG + Intergenic
989411911 5:41129301-41129323 GAGAGAAAGAAGAAGGAAGAAGG - Intergenic
989512697 5:42306533-42306555 CAGACAAAGGAGAAGTTGGAAGG + Intergenic
989553577 5:42764384-42764406 AAAACAGAGGAGGAGGAGGAGGG + Intronic
989813802 5:45711062-45711084 CAGACATACGAGAAGGTGGTTGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990140277 5:52695249-52695271 CTGAGAAAGGAGATGAAGGAAGG - Intergenic
990779012 5:59337107-59337129 CAAAAAGAGGAGAAGGATGAAGG + Intronic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
991258997 5:64646490-64646512 CATGCAAAGCAGCAGGAGGAGGG + Intergenic
991508111 5:67346037-67346059 TATACAAAGGGGAAAGAGGAAGG + Intergenic
992384423 5:76270044-76270066 GAGACAAAGGAGAAAGGGGATGG + Intronic
992595225 5:78339925-78339947 CAGACTCAGGAAAAAGAGGAAGG - Intergenic
992761260 5:79952626-79952648 CACACATGGGAGGAGGAGGATGG - Intergenic
992861813 5:80918949-80918971 AAGAAAAAAGTGAAGGAGGAAGG + Intergenic
992975324 5:82111100-82111122 CAGAAATAGGAAAGGGAGGAAGG - Intronic
993015169 5:82527322-82527344 CCGACAAAGGAGAAAATGGATGG + Intergenic
993055099 5:82971797-82971819 CAGCCATAGGAGGTGGAGGAGGG + Intergenic
993361508 5:86982168-86982190 CAGCAAAAGGGGAAAGAGGAAGG - Intergenic
993457236 5:88141201-88141223 CAGACGAGGGAAAGGGAGGAAGG - Intergenic
993579486 5:89641608-89641630 CAGACAAAGGAGAGAAAGAAAGG + Intergenic
993634687 5:90329749-90329771 CACACAAAGGAGAAAGAGAAAGG - Intergenic
993765362 5:91849596-91849618 CAGAAAAAGGAAAAGCAAGATGG - Intergenic
993900818 5:93583438-93583460 GAGAGAAAGGAGAAGAAGAAGGG - Exonic
994038113 5:95225817-95225839 CAAACAAAAGGGAGGGAGGAAGG - Intronic
994130839 5:96225893-96225915 AAGAAAAAGGAGAAGAAGAATGG - Intergenic
994688285 5:102984093-102984115 CACACAAATGAGAAAGAGAAAGG + Intronic
994770599 5:103976193-103976215 CACACAAAGGAGAAAAAGAAAGG + Intergenic
994804234 5:104422531-104422553 TAGGCTAAGGAGAAAGAGGAGGG + Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
994976780 5:106818379-106818401 CAGGTAAAGAAGGAGGAGGAAGG - Intergenic
995528070 5:113066685-113066707 CAGACAAAGGGGGAGGAGCGGGG + Intronic
995749494 5:115439172-115439194 CAGACAAAAGAGCACCAGGAGGG - Intergenic
996019916 5:118579627-118579649 GAGACAAGGAAGAAGGGGGAAGG - Intergenic
996116461 5:119625430-119625452 CAGAAAGAAGAGGAGGAGGAGGG - Intronic
996393241 5:122986480-122986502 CAGAAAAAAGAGAAGTGGGAGGG + Intronic
996501395 5:124220560-124220582 AAGAAAAAGAAGAAAGAGGAGGG - Intergenic
996587580 5:125107739-125107761 TAGAAGGAGGAGAAGGAGGAGGG - Intergenic
996656095 5:125938386-125938408 AAGGCGAAGGAGAAGGAAGAAGG - Intergenic
997093682 5:130886386-130886408 CAGAAAAGGGAGGGGGAGGAGGG - Intergenic
997159805 5:131595571-131595593 TACACAAAGGAGAAAGAGAAAGG + Intronic
997184091 5:131864299-131864321 CACACAAAGGAGGAGGAGAAAGG - Intronic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
997506539 5:134422019-134422041 AAGAGAAAGGAGAAGAAGGAAGG - Intergenic
997619530 5:135276564-135276586 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
997632541 5:135379721-135379743 CACTGAAAGGAGAAGGAAGAAGG - Intronic
997681096 5:135751232-135751254 CAGGCCCAGGAGAAGGAGGAGGG - Intergenic
998165804 5:139842881-139842903 CAGAGGAAGGAGGAGGAGAAAGG - Exonic
998174773 5:139894997-139895019 CAGATAAAGAAGAAGGGGAAGGG + Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998359633 5:141573803-141573825 CAGGCAAAGGAGGAGGTGGGGGG + Exonic
998359653 5:141573875-141573897 CAGGCAAAGGAGGGGGTGGAGGG + Exonic
998451149 5:142235597-142235619 TGGGCAAAGGAGCAGGAGGAGGG - Intergenic
998453244 5:142250724-142250746 CAGACAAAGTAAGTGGAGGAAGG + Intergenic
998706201 5:144764316-144764338 CAGACAAGAGAGAAGGTAGATGG - Intergenic
998910953 5:146959705-146959727 CAGGCAAGGGAAGAGGAGGATGG + Intronic
998925635 5:147122671-147122693 CACACAAAGGAGGAAGAGAAAGG - Intergenic
998947482 5:147355322-147355344 CAGACAAAGGAGAAGAGAGAAGG - Intronic
998991582 5:147823220-147823242 AAGAGAGAGGAGGAGGAGGAGGG - Intergenic
999154876 5:149450916-149450938 CAGACCCAGCAGAAGGAAGAGGG - Intergenic
999355879 5:150930132-150930154 CAAACAAGGGGGAGGGAGGATGG - Intergenic
999375976 5:151086865-151086887 AAGACAGTGGAGAAGGAGGCTGG + Intronic
999863094 5:155669400-155669422 GAGACAAAGCAGAAGGAGAGGGG + Intergenic
1000143857 5:158433742-158433764 AAGAGAAAGGAGAGGGAGAAAGG - Intergenic
1000261383 5:159591717-159591739 CTGACAAGGGAAAAGGAGCAGGG - Intergenic
1000451524 5:161394808-161394830 CAGAAAATAGAGAAGGAAGATGG + Intronic
1000743430 5:164998792-164998814 GAGATAAAGGAGAAGCAGGTGGG - Intergenic
1000831876 5:166111982-166112004 AAGATAAAGGAGAAGGCAGAAGG - Intergenic
1001092051 5:168748755-168748777 GAAAGAAAGGAGAAAGAGGAAGG - Intronic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1002198543 5:177514059-177514081 CTGACCCAGGAGAAGGGGGAAGG - Intronic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002400554 5:178989409-178989431 CAGACAGGGAAGAAGGGGGAGGG + Intronic
1002551847 5:179999993-180000015 TACACAAAGGAGAAAGAGAAGGG - Intronic
1002795100 6:465644-465666 AGGAGAAAGGAGAAAGAGGATGG - Intergenic
1003335584 6:5168899-5168921 GTGATAAAGGAGAGGGAGGAGGG + Intronic
1003337159 6:5185045-5185067 AAGACAAAGGGCAAGGAGGAAGG - Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003754390 6:9100461-9100483 GAGAGGAAGGAGAGGGAGGAAGG - Intergenic
1004208076 6:13611028-13611050 TAGAAAAAAGAGAAAGAGGAAGG - Intronic
1004313272 6:14564582-14564604 GAGTCAAAGTAAAAGGAGGATGG + Intergenic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1004603515 6:17173423-17173445 CAGGCAAGGGAGAAGGGGAAGGG + Intergenic
1004920239 6:20369329-20369351 CAGGAAAAGGAGAAGGATCAGGG + Intergenic
1004999112 6:21223200-21223222 CATACAAATGAGAAAGAGCAAGG - Intronic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005061840 6:21783797-21783819 GCAAAAAAGGAGAAGGAGGAAGG - Intergenic
1005132042 6:22520500-22520522 GAGAGAAGGGAGAAGGGGGAAGG + Intergenic
1005159222 6:22838835-22838857 CATACAAAGGAGGAAGAGGCAGG + Intergenic
1005385242 6:25279272-25279294 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1005500138 6:26422159-26422181 CAGGCTGAGGAGGAGGAGGAGGG - Intergenic
1005510789 6:26509918-26509940 CAGGCAAGGGAGAAACAGGAGGG - Exonic
1006449197 6:34096261-34096283 TAGACAAAGAGGAAGGAGAAAGG - Intronic
1006547707 6:34792876-34792898 CAGACAGAAGAGGAGGAGGTGGG - Intronic
1006635712 6:35459889-35459911 CTCATAAAGGAGAAAGAGGATGG - Intronic
1006803580 6:36774694-36774716 CAGACAGAGGGGAAAGAGGTGGG + Intronic
1006912963 6:37576000-37576022 CAGACAAAGAAGAAGGAGTGTGG - Intergenic
1006914747 6:37587063-37587085 CAGACAAAGGGATAGTAGGAAGG - Intergenic
1006947807 6:37797068-37797090 CAGACAAGGGAGAAGGCAAAAGG - Intergenic
1007114123 6:39331164-39331186 CAGAAAAAGAAGAAGGAGTTGGG - Exonic
1007198968 6:40089023-40089045 CAGAACAAGATGAAGGAGGAGGG + Intergenic
1007685982 6:43667681-43667703 AGGACAGAGGAGGAGGAGGAGGG - Intronic
1007694662 6:43724683-43724705 GAGACTAAGGAGCAGGAGGCAGG - Intergenic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1008055949 6:46946224-46946246 CAGCCAGAGAAGAAGGAGGGAGG + Intronic
1008627530 6:53332551-53332573 CACAGAACGGAGCAGGAGGAGGG + Intronic
1009404896 6:63300139-63300161 CAGGCAAAGCTGGAGGAGGAAGG - Intronic
1009514935 6:64603265-64603287 AAGAAAGAAGAGAAGGAGGATGG - Intronic
1009954264 6:70433421-70433443 CAGACAAATGAAAACCAGGATGG + Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010569831 6:77463449-77463471 CGGACGAAGGAGAGGGCGGAAGG + Exonic
1010738954 6:79476707-79476729 CAGAGAGAGGAGAATGAAGAAGG + Intergenic
1010869681 6:81021991-81022013 AAGAGAAAGGAGAAGGGGTAGGG - Intergenic
1010899481 6:81408501-81408523 TAGACAAAGGGAAAGAAGGAGGG + Intergenic
1011203796 6:84869178-84869200 GTGACAAAGGAGAAGAAGGCAGG - Intergenic
1011484757 6:87830004-87830026 AAGGGAGAGGAGAAGGAGGAAGG - Intergenic
1011510034 6:88090010-88090032 CAGACTAAGGAGAATGTGCAGGG + Intergenic
1011553309 6:88549277-88549299 AAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1013172428 6:107648745-107648767 CAGAAATAGGAAAAGGTGGATGG - Intronic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013556326 6:111260218-111260240 CCGACGAAGGAGACGTAGGAAGG - Intronic
1013572715 6:111445805-111445827 CAGACATAGGAAAAGGAGACTGG + Intronic
1013760420 6:113511327-113511349 CAGACAGAGGAAAAGGAGCATGG - Intergenic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1013976338 6:116083059-116083081 CAGTCAATGAAGAAGGAGTAGGG + Intergenic
1014215404 6:118748161-118748183 CAGTCAAATGAGAAGAAAGAAGG - Intergenic
1014494367 6:122102254-122102276 AAGAGAAAGGAGGAGGAGAAAGG + Intergenic
1014715558 6:124861048-124861070 CTGAGAAGGGACAAGGAGGAAGG - Intergenic
1014757334 6:125315946-125315968 GAGACAGAGAAGGAGGAGGAGGG + Intergenic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1014871709 6:126604014-126604036 TAGACAGAGGAGGAGGAGGCAGG - Intergenic
1014977735 6:127909757-127909779 CACACAAAGGAGAATGGTGATGG + Intronic
1015229160 6:130894052-130894074 CAGACAAAGGAGATGAGGCAAGG + Intronic
1015434968 6:133174737-133174759 AAGACAAAGGAGAAGGGGAAGGG - Intergenic
1016578911 6:145605462-145605484 CAGACAAGAGAGAAGGATAATGG - Intronic
1016598511 6:145828614-145828636 CAGAGAACGGGGAAGGAAGAGGG + Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1016709396 6:147152840-147152862 CAAACAAAGGAGAAGAGGGCAGG - Intergenic
1016802814 6:148183670-148183692 CAGACACAGCAGGAGGAGGACGG + Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017339571 6:153305207-153305229 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339585 6:153305255-153305277 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339626 6:153305405-153305427 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017804198 6:157929209-157929231 CAAACAAAGGAGAAGGAGGGAGG - Intronic
1017949085 6:159120379-159120401 GGAGCAAAGGAGAAGGAGGAAGG - Intergenic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018240914 6:161773821-161773843 CAGAAAAAGAAGAAGAAGAAGGG + Intronic
1018268968 6:162055582-162055604 CACAGAAAGGAGGAGGAGGGAGG + Intronic
1018552181 6:165010238-165010260 GAGACAAAGTATCAGGAGGAAGG - Intergenic
1018816789 6:167338895-167338917 AAGAAAAAGAAGAAGGAAGAGGG - Intronic
1019253760 7:35372-35394 CAAACAAAAAAGAAGGAAGACGG - Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019419071 7:942360-942382 AAGAGAGAGGAGGAGGAGGAAGG + Intronic
1019494974 7:1333475-1333497 TAAAAAAAGGAGAAGAAGGAGGG - Intergenic
1019549245 7:1594006-1594028 GAGGGAAAGAAGAAGGAGGAGGG - Intergenic
1019574658 7:1731345-1731367 CAGAAAAGGGAGAATGATGAAGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019805046 7:3117547-3117569 AAGAGAAAGGAGAGAGAGGAGGG + Intergenic
1019945372 7:4324541-4324563 GAAGAAAAGGAGAAGGAGGATGG - Intergenic
1020853341 7:13385283-13385305 AAAACAAAAGAGATGGAGGAAGG + Intergenic
1020865799 7:13560712-13560734 CAGACAAAGGAAAAGAAGGAAGG + Intergenic
1021029594 7:15714773-15714795 GAGAGAAAGGAGGAGAAGGAGGG + Intergenic
1021083071 7:16386292-16386314 CAGACAAAAGAGCAGCAGAATGG - Intronic
1021158857 7:17246846-17246868 GAGAAAAAGGAGAAGGTGAAAGG - Intergenic
1021301643 7:18980799-18980821 GAGACGGAGGAGAAGGAAGAAGG - Intronic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021690203 7:23223599-23223621 CAGACAGAGGAGGAGGTGAAGGG - Intergenic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1021785865 7:24152079-24152101 CAGACTGGGGAGAAGGAGAAGGG - Intergenic
1022099953 7:27163516-27163538 GAGAGAAGGGAGAAGGCGGAAGG + Exonic
1022131290 7:27406909-27406931 CAGACATTGAAGACGGAGGAAGG + Intergenic
1022141992 7:27500676-27500698 CAAACCAGGGAGAAGGAGGAGGG + Intergenic
1022673734 7:32479155-32479177 CACACACAGGAGAAGAAGGGAGG - Intergenic
1022803569 7:33799162-33799184 CAAACATAAGAGAAAGAGGATGG - Intergenic
1022846073 7:34211165-34211187 CTGACCAGGGAAAAGGAGGAAGG - Intergenic
1022955167 7:35374067-35374089 AAGACAGAGGAGAAGGAAGAGGG - Intergenic
1023013649 7:35944515-35944537 AGGACAAAGAGGAAGGAGGAGGG - Intergenic
1023186903 7:37541703-37541725 AAGACACATGAGGAGGAGGAGGG - Intergenic
1023496875 7:40807389-40807411 AAGACAAGTGAGAAGGGGGATGG + Intronic
1023648218 7:42341441-42341463 CAGAAAAAGGATAAGGAAGAAGG - Intergenic
1023727786 7:43162422-43162444 CAGACCATGGAGATGGAGGTTGG - Intronic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1024045015 7:45580131-45580153 TAGACAAAAGAGAGGGAGAATGG + Intronic
1024077481 7:45829319-45829341 AGGACAAAGAGGAAGGAGGAGGG + Intergenic
1024355442 7:48409776-48409798 CATCCAAAGAAGAATGAGGAGGG + Intronic
1024387810 7:48773613-48773635 CTGTCACAGGAGAAAGAGGATGG - Intergenic
1024731129 7:52254978-52255000 AAGAAAAAGGAGAAGAAAGAGGG + Intergenic
1024770284 7:52714105-52714127 TAGATAAAGGAGGAGGATGAAGG - Intergenic
1024839701 7:53571652-53571674 CAGACCCAGGAGAAGGAAGAGGG - Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1025126929 7:56352088-56352110 AGGACAAAGAGGAAGGAGGAGGG - Intergenic
1025288171 7:57685618-57685640 GAGACCAAGGAGCAGGAGCATGG + Intergenic
1026157868 7:67843060-67843082 AGGACAAAGGAGAAGGAGAGAGG + Intergenic
1026158951 7:67852217-67852239 AAGAGAAAGGAGAAAGAGGAGGG + Intergenic
1026159064 7:67852834-67852856 GAGAGAAAGGAGGAGGAGGAGGG + Intergenic
1026206234 7:68260278-68260300 GAGACAAAAGAGAAGGAGGAAGG - Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1026484777 7:70808452-70808474 TAGACACTGGAGAAGGAAGAAGG + Intergenic
1026502387 7:70953725-70953747 AAGGCAAAGGAGAAGCAGGATGG + Intergenic
1026503259 7:70960580-70960602 CTGCCAGAGGAGAAGGAGGGTGG + Intergenic
1027253504 7:76414682-76414704 AAAAAAAAGGAGGAGGAGGAGGG - Intronic
1027505229 7:79009006-79009028 AAAAAAAAGGAGAAGGAAGAGGG - Intronic
1027645317 7:80790324-80790346 AGGAGAAAGGAGGAGGAGGAAGG + Intronic
1027798043 7:82718399-82718421 TAAACAAAGGAAAAGGAGTATGG - Intergenic
1027940103 7:84667458-84667480 CTGACACAGGAGAAGAAGAAAGG - Intergenic
1028070824 7:86448032-86448054 AAAAAAAAGGAGGAGGAGGAGGG + Intergenic
1028134274 7:87209984-87210006 GAGACAGAGGAGAGGGAGGGGGG + Intronic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028490472 7:91405863-91405885 TGGACAAGGGAGAAGGAGAAGGG - Intergenic
1028519311 7:91712250-91712272 CAGACAAAAAAGAGGGAGGCTGG + Intronic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1028754695 7:94421772-94421794 TAGACCAAGGAGTAGGAGGTAGG - Intronic
1029027719 7:97435159-97435181 CATACATAGGAGAAAGAGAAAGG - Intergenic
1029065430 7:97843559-97843581 AAGACAAAGGAAAAGCAGGCAGG + Intergenic
1029309641 7:99650730-99650752 GAGGCAGAGGAGAAGGTGGACGG - Intronic
1029336432 7:99903800-99903822 GTGCCAAAGGAGAAAGAGGAGGG - Intronic
1029409211 7:100398048-100398070 AGGACAAAGGAGAACAAGGATGG - Intronic
1029422082 7:100477099-100477121 CAGAAAATGAAGTAGGAGGAAGG + Intronic
1029872226 7:103706969-103706991 TAAACAAATGAGCAGGAGGAGGG - Intronic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1030722179 7:112883297-112883319 CAGACAAAAGGAAAGAAGGATGG - Intronic
1030880121 7:114867472-114867494 ATGACAAAAGAGAAGAAGGAGGG - Intergenic
1031065543 7:117101097-117101119 CAAACAGAGGAGAGGGATGATGG + Intronic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031813587 7:126404171-126404193 CAGCCAGAGAAGAAGGAAGAAGG - Intergenic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1031994561 7:128221050-128221072 CTCACAAAGAAGGAGGAGGAGGG - Intergenic
1032092904 7:128920579-128920601 CAGGCAGAGCAGAAGGAGGTCGG - Intergenic
1032182673 7:129694194-129694216 CAAACAAATGAGGAGGAAGAGGG + Intronic
1032522733 7:132558737-132558759 CAGGCAAAGGCGAAAGAGGCGGG - Intronic
1032523366 7:132562349-132562371 GAGGCAGAGGAGGAGGAGGAAGG - Intronic
1032620783 7:133529194-133529216 AAGGCAAAGAAGAAGGAGAAAGG - Intronic
1032720450 7:134547082-134547104 TAGACAAAGAGGAAGGGGGAGGG + Intergenic
1032855569 7:135830761-135830783 CAGAGAAAGGAGAAAGCAGAAGG + Intergenic
1032869959 7:135974540-135974562 CAAAAAAAAGAGGAGGAGGAGGG + Intronic
1032876071 7:136039613-136039635 TATAAAATGGAGAAGGAGGAAGG - Intergenic
1032923980 7:136580705-136580727 GAAACAAAGAAGAAGGGGGAAGG - Intergenic
1032962037 7:137046853-137046875 TAAACACAGAAGAAGGAGGAGGG + Intergenic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1033215096 7:139487657-139487679 AAGACAAAGGGGAAGGGGAAGGG + Intergenic
1033256581 7:139806748-139806770 CAGACAGATGAGAGGGAGGATGG - Intronic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034033806 7:147798958-147798980 CAGGCAAAGAAGATGGATGATGG + Intronic
1034240332 7:149605876-149605898 CAGGGAAAGGCTAAGGAGGAAGG - Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034865079 7:154634672-154634694 GAGACGAAGGAGAAGGAGAAGGG - Intronic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1035038406 7:155910218-155910240 CAGGCAGAGGAGGAGGAGCAAGG - Intergenic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035136249 7:156705785-156705807 CACACAAAGGAGAAAGAGAAGGG + Intronic
1036286237 8:7446453-7446475 CAGACATAGGACAAGGACGCAGG + Intronic
1036335238 8:7865075-7865097 CAGACATAGGACAAGGACGCAGG - Intronic
1036508984 8:9383161-9383183 CAGACAGATGACCAGGAGGAAGG - Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1037062428 8:14531337-14531359 CAGACACTGGAGAATGAGTAAGG - Intronic
1037208832 8:16360313-16360335 GAGACTAAAGAGAGGGAGGAGGG + Intronic
1037494758 8:19428031-19428053 GATCCAGAGGAGAAGGAGGAAGG - Intronic
1037611541 8:20480390-20480412 CAGATCAAAGGGAAGGAGGATGG + Intergenic
1038020747 8:23550337-23550359 CAGAGAAACGTGAAGGAGGGCGG - Intronic
1038034082 8:23672303-23672325 GGAGCAAAGGAGAAGGAGGAGGG - Intergenic
1038044026 8:23750819-23750841 CAGGGAAAGGAGAACAAGGAAGG - Intergenic
1038217820 8:25578680-25578702 TAGACAAGGGAAAAGGAGAAAGG + Intergenic
1038400331 8:27279656-27279678 TAGACAGGGGAGAGGGAGGAAGG + Intergenic
1038483642 8:27918788-27918810 GAGAAAGAGGAGGAGGAGGAGGG + Intronic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1038596431 8:28890497-28890519 CAGGAAGAGGAGAAGGGGGAGGG - Exonic
1039195654 8:35028504-35028526 CAGAAAGAGGAAAAGGAGCAGGG + Intergenic
1039262585 8:35787987-35788009 AAGAAAAAAGAAAAGGAGGAAGG + Intronic
1039272765 8:35900825-35900847 CAGACAGAAGAAAAGAAGGAAGG - Intergenic
1039314491 8:36356490-36356512 GAGACAAAAGGGAAGGAGGAAGG + Intergenic
1039455682 8:37704526-37704548 CAGCCACAGGAGCTGGAGGAGGG + Intergenic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1039954522 8:42196845-42196867 AAGGCAAATGAGAAGAAGGAAGG + Intronic
1039963800 8:42269652-42269674 AAGAGAAAGGAGAGGGAAGAGGG + Intergenic
1040365274 8:46709008-46709030 AAGACAAAGGAAAAGCAGGCAGG - Intergenic
1040439256 8:47424037-47424059 CAGACACAGGAGAATATGGATGG + Intronic
1040444360 8:47478422-47478444 CAGAGACAGAAGAAGCAGGAAGG + Intronic
1041067041 8:54092087-54092109 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1041161237 8:55046215-55046237 TACACAAAGGAGAAAGAGAAAGG + Intergenic
1041167268 8:55102353-55102375 CCGACGCAGGAGCAGGAGGAGGG + Intergenic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1041567274 8:59293115-59293137 CAGGCCAAGAAGAAGGGGGAAGG + Intergenic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042338968 8:67658890-67658912 CAGACAAAAGAGAATGAGAGAGG - Intronic
1042691297 8:71502306-71502328 CAGACAAAGAAGAATGAGAGGGG - Intronic
1042719517 8:71812276-71812298 GAGAGAAAGGAGAAGGCTGAAGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1042949784 8:74189145-74189167 GAAAGAAAGGAGGAGGAGGATGG - Intergenic
1043342459 8:79256616-79256638 CTGACACAGGAGCAGGATGAAGG + Intergenic
1043385588 8:79744634-79744656 AAGTAAAAGGAGAAGGGGGATGG + Intergenic
1043417500 8:80066118-80066140 CAGACACAGAAGAAAAAGGAAGG + Intronic
1043693479 8:83187541-83187563 CAGACACTGGAGAATGAGTAAGG - Intergenic
1044228539 8:89747397-89747419 CACACAAGGGAGCAGGAGAAAGG + Intergenic
1044401830 8:91781657-91781679 CAGGCAGAGGAGATGGAGGGGGG - Intergenic
1044422929 8:92019400-92019422 CAGAGAAAGGAAGAGCAGGAGGG + Intronic
1044435951 8:92164532-92164554 GAGACACAGGGGAATGAGGAGGG + Intergenic
1044706174 8:95010866-95010888 AAGACAAAGGGGAAGGAAGCAGG + Intronic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1044966347 8:97577437-97577459 AGGACAGAGCAGAAGGAGGATGG + Intergenic
1045085404 8:98677528-98677550 AAGACAAAGGAGGAAGAGGAAGG + Intronic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1045889014 8:107132115-107132137 CAGCCAAAGGAGAAAGAGAAAGG - Intergenic
1045975604 8:108127846-108127868 AAAACAAAAAAGAAGGAGGAAGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046157098 8:110306214-110306236 GAGACAAAGGAAAAGGAAGAAGG - Intergenic
1046399937 8:113691896-113691918 GAGAAAGAGGAGGAGGAGGAGGG - Intergenic
1046438337 8:114225401-114225423 CAGAGAAAGGAAAGGGAGGAAGG - Intergenic
1046525712 8:115379995-115380017 GAGAGAGAGAAGAAGGAGGAAGG + Intergenic
1046547799 8:115673557-115673579 CAGACAACATGGAAGGAGGAAGG + Intronic
1046731262 8:117728785-117728807 CAGGAAAAGGAGAACAAGGATGG - Intergenic
1047298870 8:123596002-123596024 CAGCCAGTGAAGAAGGAGGAGGG + Intergenic
1047830853 8:128628150-128628172 CAGAAAAGAGGGAAGGAGGATGG - Intergenic
1047906686 8:129480260-129480282 GTGACAGAGGAGAAGGGGGAGGG - Intergenic
1048293435 8:133197559-133197581 CATAGAGAGGAGGAGGAGGAGGG - Intronic
1048598716 8:135895549-135895571 CATTCCAAGTAGAAGGAGGAAGG - Intergenic
1048769904 8:137884147-137884169 AAGGAAAAGGAGAAGGAGCAGGG - Intergenic
1049062579 8:140287363-140287385 GAGACGAAGCAGAGGGAGGAGGG + Intronic
1049278185 8:141730384-141730406 GAGAGGAAGGAGGAGGAGGAGGG - Intergenic
1049350675 8:142162877-142162899 AAGAGAGAGGAGATGGAGGATGG + Intergenic
1049415251 8:142492072-142492094 CAGACAGAGGAGAGGGTGGATGG - Intronic
1049893724 9:95068-95090 GATAGAAAGGAGAGGGAGGAGGG - Intergenic
1050252332 9:3758001-3758023 TAGACAAAGGAAAAGGGGGTTGG - Intergenic
1050690396 9:8221166-8221188 AAGACTAAGGAGAAGCAGGGTGG + Intergenic
1050747374 9:8892036-8892058 CAGAGAAAAGAAAAGCAGGAAGG - Intronic
1051350302 9:16192474-16192496 AAGAGATAGGAGAAGGAGGGAGG - Intergenic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1051715299 9:19976480-19976502 CAGTCACAGTAGAAGGTGGAGGG - Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052982915 9:34461893-34461915 CAGAAAAAGATAAAGGAGGATGG + Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053260196 9:36656263-36656285 CTGACAAAGTAGAAGATGGAGGG - Intronic
1053734945 9:41095138-41095160 GATAGAAAGGAGAGGGAGGAGGG - Intergenic
1053789263 9:41674975-41674997 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1054177545 9:61886328-61886350 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1054659986 9:67694480-67694502 AAGGCAGAGGAGGAGGAGGAAGG + Intergenic
1054693436 9:68336259-68336281 GATAGAAAGGAGAGGGAGGAGGG + Intronic
1054747362 9:68868245-68868267 AGGATAAAGAAGAAGGAGGATGG + Intronic
1055195115 9:73581554-73581576 GAGAAAAAGGAGGAGCAGGAGGG - Intergenic
1056008458 9:82300355-82300377 CACAAAAAGGAGAAAGAGAAAGG - Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056719082 9:89058189-89058211 AAAACAAAGAAGATGGAGGATGG + Intronic
1056802995 9:89707057-89707079 CCGAAAGAGGAGAAGCAGGAGGG - Intergenic
1057007445 9:91573122-91573144 GTGAGACAGGAGAAGGAGGAAGG + Intronic
1057021146 9:91698642-91698664 GAGAAAAAGGAGCAGGTGGAAGG - Intronic
1057180780 9:93028918-93028940 CAGGCACAGGAGACAGAGGAGGG + Intronic
1057307889 9:93922756-93922778 AAGACAGAGAAGAAGGAAGAGGG + Intergenic
1057364255 9:94404038-94404060 CTCACAAAGCAGAAGGTGGAAGG - Intronic
1057387116 9:94614129-94614151 AAGAGGAGGGAGAAGGAGGAGGG + Intronic
1057605748 9:96496776-96496798 CAGAGGAAGGAGCTGGAGGAAGG - Intronic
1057659079 9:96984033-96984055 CTCACAAAGCAGAAGGTGGAAGG + Intronic
1057739767 9:97701172-97701194 GAGCCGAAGGAGAAGGAGGAGGG - Intergenic
1057904636 9:98974494-98974516 CTGACAAAGGGCAAGGAGGAGGG + Intronic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058217085 9:102248178-102248200 CACAAAATGGAGAATGAGGAAGG - Intergenic
1058391408 9:104499350-104499372 CAGTCAAAGAAGAACTAGGAAGG - Intergenic
1058561434 9:106233138-106233160 AGGAGAAAGGAGGAGGAGGAAGG - Intergenic
1058561440 9:106233161-106233183 AGGAGAAAGGAGAAGGAAGAAGG - Intergenic
1058561469 9:106233307-106233329 AAGAAAAAGGAGGAGGAAGAAGG - Intergenic
1058618790 9:106862525-106862547 GAGGCAAAGGAGAAGGAGAAGGG - Intergenic
1058931286 9:109721702-109721724 CAGACAATGGAGAAAGAAGCGGG - Intronic
1058956141 9:109950502-109950524 CAGACAGAGGAGCAGGTGTAGGG - Intronic
1059780532 9:117521730-117521752 CAGAAAAAGGACCAGGAGCATGG + Intergenic
1060168751 9:121443194-121443216 CAGGCAGAGGAGTAGGTGGAAGG - Intergenic
1060716118 9:125930796-125930818 CAGACAAGGGATATGGAGGATGG - Intronic
1060813088 9:126620882-126620904 CAGCCAATGGAGAAGGGGGTAGG + Intronic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1061579213 9:131526634-131526656 CAGACAAAGCTGAGGGAAGAGGG + Intronic
1061899681 9:133666509-133666531 GAGAGGAAGGAGGAGGAGGAGGG - Intronic
1061933255 9:133844130-133844152 CAGACAAAGTAGAGGGGGCAGGG - Intronic
1061942579 9:133891493-133891515 CAGATAGAGGAGAAGGATGGAGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062254241 9:135613637-135613659 CACACACAGGGGCAGGAGGATGG + Intergenic
1062497923 9:136840361-136840383 AAGAGCAAGGACAAGGAGGAGGG + Exonic
1062638390 9:137503515-137503537 AGGAGGAAGGAGAAGGAGGAGGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062682683 9:137790519-137790541 CAGACAAAGAAGGGGGAGGGAGG - Intronic
1062746636 9:138217171-138217193 CAAACAAAAAAGAAGGAAGACGG + Intergenic
1203772083 EBV:54557-54579 CCGCCAAAGAAGGAGGAGGAGGG - Intergenic
1185485831 X:481466-481488 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485896 X:481690-481712 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485972 X:481949-481971 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185603480 X:1354577-1354599 AAGAAAACGGAGAAAGAGGAGGG + Intronic
1185603490 X:1354616-1354638 GAGAAAATGGAGAAAGAGGAGGG + Intronic
1185611105 X:1394206-1394228 AAGAAAAAGGAAAAGGAGGGAGG - Intergenic
1185787482 X:2903110-2903132 GAGAAAAAGAAGAAGGAGAAGGG - Intergenic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1186058716 X:5680404-5680426 CAGAAAGAGAAGAAGGATGACGG - Intergenic
1186178422 X:6949371-6949393 GAGGAAAAGGATAAGGAGGAGGG - Intergenic
1186611935 X:11146096-11146118 CACAGTTAGGAGAAGGAGGAAGG + Intronic
1186679129 X:11853837-11853859 CAAACAATTGAGGAGGAGGAGGG + Intergenic
1187066932 X:15850104-15850126 CAGGCAAAGGAGATGAAGAAGGG - Intronic
1187072872 X:15905660-15905682 CAGATAAAGGAGAAAAAGGCTGG - Intergenic
1187088400 X:16066572-16066594 CTGACACAGGATAAGGAGGAAGG - Intergenic
1187245332 X:17548804-17548826 CAGAGAGAGGAAAAGGAAGAGGG + Intronic
1187447672 X:19373147-19373169 GAGAGGAAGGAAAAGGAGGAAGG + Intronic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1187926380 X:24254165-24254187 AAGAGATAGGAGAGGGAGGAAGG - Intergenic
1188036461 X:25322941-25322963 GAGAAAAAGGAGAAAGAGGAAGG - Intergenic
1188059877 X:25588505-25588527 CACACAAAGAAGAAAGAGAAAGG - Intergenic
1188128778 X:26404189-26404211 ATGATAAAGGAGAAGGAGCAAGG + Intergenic
1188136913 X:26502855-26502877 AAGCCAAAGGGGAAGGAGAAGGG + Intergenic
1188697084 X:33207107-33207129 CAGACAAATGAGAATGAGGAAGG - Intronic
1189197072 X:39161922-39161944 GAGAAAGAGGAGGAGGAGGAGGG - Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189454803 X:41176260-41176282 CAGACCATGAAGGAGGAGGAGGG - Intronic
1189481339 X:41394445-41394467 CAGGCACAGAAGAAGGAGGAGGG + Intergenic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189799140 X:44675868-44675890 AAGACAAAGGTGATGGAGGAGGG - Intergenic
1190023615 X:46902396-46902418 GAGAGAAAGGAGAAAAAGGAAGG + Intergenic
1190144154 X:47875147-47875169 CAGAGCAAGGAGGAGCAGGAGGG + Intronic
1190881320 X:54494876-54494898 CAGACAGAGGAGAAGGGGGTTGG + Intronic
1190885760 X:54530034-54530056 CGGAGGAGGGAGAAGGAGGACGG - Intergenic
1191108379 X:56786596-56786618 AGGAGAAAGAAGAAGGAGGAGGG - Intergenic
1191840368 X:65509461-65509483 CAGAACAAGGAGTAGAAGGAAGG - Intergenic
1192143953 X:68668206-68668228 AAGAGAAAGAAGAAGGAGGAGGG - Intronic
1192185181 X:68941831-68941853 AGGAGAAAGGAGGAGGAGGAAGG + Intergenic
1192234177 X:69285608-69285630 AAGAGAATGGAGAAGGGGGAAGG + Intergenic
1192261490 X:69508443-69508465 AAGACAAAGGAGAGGAGGGAGGG - Intronic
1192874130 X:75210635-75210657 CAGCCAAAGGAGAATAAGGAGGG + Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193144156 X:78060026-78060048 CAGACCCAGGAGAGGGAGGAGGG + Intergenic
1193825063 X:86215016-86215038 CAGACAAAGGGGAGAGAGAAAGG - Intronic
1193843619 X:86440680-86440702 CACACAAAGCAGAAAAAGGATGG - Intronic
1194764104 X:97829300-97829322 GAGATCAGGGAGAAGGAGGAAGG - Intergenic
1194792824 X:98172092-98172114 CAGACAAAAGAGAAGGTTCAAGG + Intergenic
1195696234 X:107669615-107669637 AAAAAAAAGGAGGAGGAGGAGGG - Intergenic
1195973966 X:110505161-110505183 AAGGAAAAGGAGAAGGAGAAGGG - Intergenic
1196206128 X:112942081-112942103 AACAAAAAGGAAAAGGAGGAAGG - Intergenic
1196310097 X:114153803-114153825 CAGAGAAAAGAGAGGGAGAATGG + Intergenic
1196484084 X:116183893-116183915 CACAGAAAGGAGAAGGAGAAAGG + Intergenic
1196911854 X:120491874-120491896 CAGGCAAGGGTTAAGGAGGAAGG + Intergenic
1197355141 X:125430325-125430347 CAGAGACAGGAGAAGGAGAAGGG - Intergenic
1197673268 X:129302240-129302262 CAGAAAAAGGACAAGGACAAAGG - Intergenic
1197754033 X:129982745-129982767 GAGAGAGAGGAGAAGGAGGTCGG + Intronic
1197856798 X:130921751-130921773 GAGAAAAAGGAGGAAGAGGAAGG - Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198548256 X:137717268-137717290 TACACAAAAGAGAAGGAGAAAGG - Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199297049 X:146171219-146171241 AGGAGAAAGGAGAAGGAGGAAGG - Intergenic
1199332207 X:146575555-146575577 CACACAAATGAGAAAGAGAAAGG + Intergenic
1199539955 X:148947720-148947742 GAGACAAAAACGAAGGAGGAAGG + Intronic
1199600806 X:149540183-149540205 CAGCCACAGGAGAAGCAGGTCGG - Intergenic
1200184092 X:154170469-154170491 GCTACAAAGGTGAAGGAGGAGGG + Intergenic
1200189746 X:154207597-154207619 GCTACAAAGGTGAAGGAGGAGGG + Intergenic
1200195499 X:154245406-154245428 GCTACAAAGGTGAAGGAGGAGGG + Intergenic
1200201151 X:154282527-154282549 GCTACAAAGGTGAAGGAGGAGGG + Intronic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG + Intergenic
1200989330 Y:9334865-9334887 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1200991999 Y:9355195-9355217 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1200994653 Y:9375475-9375497 CGGATCAAGGAGAAAGAGGATGG + Intronic
1200997316 Y:9395821-9395843 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1200999831 Y:9464358-9464380 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1201002489 Y:9484667-9484689 CGGATCAAGGAGAAAGAGGATGG + Intronic
1201005149 Y:9504954-9504976 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1201007807 Y:9525281-9525303 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic
1201574381 Y:15446454-15446476 CACACAAGTGGGAAGGAGGATGG + Intergenic
1201793940 Y:17874387-17874409 CATACAAAGAAGAAATAGGAGGG + Intergenic
1201807614 Y:18031598-18031620 CATACAAAGAAGAAATAGGAGGG - Intergenic
1201973065 Y:19817058-19817080 TAGACAAAGAGGAAGGGGGAGGG - Intergenic
1202273667 Y:23094715-23094737 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202292360 Y:23325966-23325988 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic
1202355324 Y:24042202-24042224 CATACAAAGAAGAAATAGGAGGG + Intergenic
1202426663 Y:24728460-24728482 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202444126 Y:24941626-24941648 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic
1202515454 Y:25627907-25627929 CATACAAAGAAGAAATAGGAGGG - Intergenic