ID: 970852769

View in Genome Browser
Species Human (GRCh38)
Location 4:20621277-20621299
Sequence CTCAAAAAACAGTGGCTATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970852769_970852773 9 Left 970852769 4:20621277-20621299 CCATATAGCCACTGTTTTTTGAG No data
Right 970852773 4:20621309-20621331 TATGCCAGGTACTATGCTCAGGG No data
970852769_970852771 -5 Left 970852769 4:20621277-20621299 CCATATAGCCACTGTTTTTTGAG No data
Right 970852771 4:20621295-20621317 TTGAGTGCTTCTTATATGCCAGG 0: 1
1: 9
2: 79
3: 578
4: 2158
970852769_970852772 8 Left 970852769 4:20621277-20621299 CCATATAGCCACTGTTTTTTGAG No data
Right 970852772 4:20621308-20621330 ATATGCCAGGTACTATGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970852769 Original CRISPR CTCAAAAAACAGTGGCTATA TGG (reversed) Intergenic
No off target data available for this crispr