ID: 970856153

View in Genome Browser
Species Human (GRCh38)
Location 4:20651277-20651299
Sequence GCTGCAGCAAGCCCCACTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970856144_970856153 -4 Left 970856144 4:20651258-20651280 CCCCCAAACCCCCACAGCGGCTG No data
Right 970856153 4:20651277-20651299 GCTGCAGCAAGCCCCACTCAGGG No data
970856137_970856153 30 Left 970856137 4:20651224-20651246 CCTCTGAAACATAACCCTGTTGG No data
Right 970856153 4:20651277-20651299 GCTGCAGCAAGCCCCACTCAGGG No data
970856146_970856153 -6 Left 970856146 4:20651260-20651282 CCCAAACCCCCACAGCGGCTGCA No data
Right 970856153 4:20651277-20651299 GCTGCAGCAAGCCCCACTCAGGG No data
970856145_970856153 -5 Left 970856145 4:20651259-20651281 CCCCAAACCCCCACAGCGGCTGC No data
Right 970856153 4:20651277-20651299 GCTGCAGCAAGCCCCACTCAGGG No data
970856142_970856153 -1 Left 970856142 4:20651255-20651277 CCACCCCCAAACCCCCACAGCGG No data
Right 970856153 4:20651277-20651299 GCTGCAGCAAGCCCCACTCAGGG No data
970856139_970856153 16 Left 970856139 4:20651238-20651260 CCCTGTTGGCCTGAGAACCACCC No data
Right 970856153 4:20651277-20651299 GCTGCAGCAAGCCCCACTCAGGG No data
970856141_970856153 7 Left 970856141 4:20651247-20651269 CCTGAGAACCACCCCCAAACCCC No data
Right 970856153 4:20651277-20651299 GCTGCAGCAAGCCCCACTCAGGG No data
970856140_970856153 15 Left 970856140 4:20651239-20651261 CCTGTTGGCCTGAGAACCACCCC No data
Right 970856153 4:20651277-20651299 GCTGCAGCAAGCCCCACTCAGGG No data
970856147_970856153 -7 Left 970856147 4:20651261-20651283 CCAAACCCCCACAGCGGCTGCAG No data
Right 970856153 4:20651277-20651299 GCTGCAGCAAGCCCCACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970856153 Original CRISPR GCTGCAGCAAGCCCCACTCA GGG Intergenic