ID: 970862924

View in Genome Browser
Species Human (GRCh38)
Location 4:20723970-20723992
Sequence TCAAAGCCTTCATTTTTATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 380}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970862911_970862924 17 Left 970862911 4:20723930-20723952 CCCCTTCGTCCCTCACCCCCATC 0: 1
1: 0
2: 2
3: 56
4: 648
Right 970862924 4:20723970-20723992 TCAAAGCCTTCATTTTTATGGGG 0: 1
1: 0
2: 2
3: 20
4: 380
970862913_970862924 15 Left 970862913 4:20723932-20723954 CCTTCGTCCCTCACCCCCATCTT 0: 1
1: 1
2: 5
3: 47
4: 700
Right 970862924 4:20723970-20723992 TCAAAGCCTTCATTTTTATGGGG 0: 1
1: 0
2: 2
3: 20
4: 380
970862917_970862924 1 Left 970862917 4:20723946-20723968 CCCCATCTTCCATACATTTCAGC 0: 1
1: 0
2: 0
3: 15
4: 194
Right 970862924 4:20723970-20723992 TCAAAGCCTTCATTTTTATGGGG 0: 1
1: 0
2: 2
3: 20
4: 380
970862912_970862924 16 Left 970862912 4:20723931-20723953 CCCTTCGTCCCTCACCCCCATCT 0: 1
1: 0
2: 1
3: 55
4: 686
Right 970862924 4:20723970-20723992 TCAAAGCCTTCATTTTTATGGGG 0: 1
1: 0
2: 2
3: 20
4: 380
970862919_970862924 -1 Left 970862919 4:20723948-20723970 CCATCTTCCATACATTTCAGCCT 0: 1
1: 0
2: 0
3: 19
4: 261
Right 970862924 4:20723970-20723992 TCAAAGCCTTCATTTTTATGGGG 0: 1
1: 0
2: 2
3: 20
4: 380
970862915_970862924 7 Left 970862915 4:20723940-20723962 CCTCACCCCCATCTTCCATACAT 0: 1
1: 1
2: 2
3: 38
4: 470
Right 970862924 4:20723970-20723992 TCAAAGCCTTCATTTTTATGGGG 0: 1
1: 0
2: 2
3: 20
4: 380
970862916_970862924 2 Left 970862916 4:20723945-20723967 CCCCCATCTTCCATACATTTCAG 0: 1
1: 0
2: 0
3: 22
4: 224
Right 970862924 4:20723970-20723992 TCAAAGCCTTCATTTTTATGGGG 0: 1
1: 0
2: 2
3: 20
4: 380
970862918_970862924 0 Left 970862918 4:20723947-20723969 CCCATCTTCCATACATTTCAGCC 0: 1
1: 0
2: 0
3: 8
4: 155
Right 970862924 4:20723970-20723992 TCAAAGCCTTCATTTTTATGGGG 0: 1
1: 0
2: 2
3: 20
4: 380
970862914_970862924 8 Left 970862914 4:20723939-20723961 CCCTCACCCCCATCTTCCATACA 0: 1
1: 0
2: 2
3: 21
4: 410
Right 970862924 4:20723970-20723992 TCAAAGCCTTCATTTTTATGGGG 0: 1
1: 0
2: 2
3: 20
4: 380
970862920_970862924 -8 Left 970862920 4:20723955-20723977 CCATACATTTCAGCCTCAAAGCC 0: 1
1: 0
2: 0
3: 18
4: 265
Right 970862924 4:20723970-20723992 TCAAAGCCTTCATTTTTATGGGG 0: 1
1: 0
2: 2
3: 20
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970862924 Original CRISPR TCAAAGCCTTCATTTTTATG GGG Intronic
900563126 1:3317979-3318001 TCAAACCCTTCTTTATTGTGAGG - Intronic
904360253 1:29966535-29966557 TCAAAGTCTTTATTTTTCTCAGG - Intergenic
904386238 1:30143935-30143957 TAAAAGCATTCAGTTTTATAAGG - Intergenic
905746236 1:40420975-40420997 TTAAAGTGTTCATTCTTATGAGG + Intronic
905918376 1:41701429-41701451 TCAGAGACTTCATCTCTATGAGG - Intronic
906271900 1:44485919-44485941 TCACAGCCTTGTTTTTAATGAGG - Intronic
906528596 1:46510769-46510791 TCAAAGCCTTCAGTGATAGGAGG + Intronic
907017769 1:51033991-51034013 TCACATCTTTCATTTTTATCTGG + Intergenic
908433801 1:64085108-64085130 ACCAACCCTTAATTTTTATGAGG - Intronic
908632629 1:66126476-66126498 TCAAAGCTTTCATCTTAATAAGG - Intronic
909256778 1:73434071-73434093 TCTCAGCCTTAATTTTAATGTGG + Intergenic
910173972 1:84408273-84408295 TCACAGGCTTCATATTGATGGGG + Intronic
910214852 1:84833011-84833033 TCTTAGCCTTTATATTTATGTGG - Intronic
910283003 1:85522147-85522169 TTAAAGTCTTTAATTTTATGAGG - Intronic
910702061 1:90086261-90086283 TCAAAGCCTTTCATTTGATGAGG - Intergenic
911855783 1:102872887-102872909 TTAAAGCATTCAGTTTTATAAGG - Intergenic
912175827 1:107154954-107154976 GCAAAGCATTCATTATTTTGAGG - Intronic
913109938 1:115648669-115648691 TAAATGACCTCATTTTTATGGGG + Intronic
914207011 1:145540846-145540868 TTAAAGTCTTTAATTTTATGAGG + Intergenic
915826759 1:159086349-159086371 ACAAAGCATCCATGTTTATGAGG - Intronic
915848452 1:159294337-159294359 CCAAAGTCTTTCTTTTTATGGGG + Intronic
916965368 1:169934978-169935000 TCAAAGCCTTCATATATATTAGG - Intronic
917320862 1:173780142-173780164 TCAAAGCCTTCACATATCTGTGG + Intronic
917798792 1:178552033-178552055 AGAAAGCCTTCATTTTAAAGTGG + Intergenic
919216417 1:194562339-194562361 TCAAATGTTTCATTTTTATGAGG + Intergenic
919272604 1:195369019-195369041 TCTATGTCATCATTTTTATGTGG - Intergenic
920409965 1:205751382-205751404 TCAAAGCGATCATTTTTGTTTGG + Intergenic
920857453 1:209674960-209674982 AGAAAGCTTTCATTTTTATTCGG - Intergenic
921421229 1:214951179-214951201 TTTAACCCTTCCTTTTTATGTGG + Intergenic
923472502 1:234304611-234304633 TCAAAATCCACATTTTTATGAGG + Intronic
923832692 1:237575405-237575427 TTAAAGCCATGATTTTTATATGG + Intronic
924806514 1:247366018-247366040 TAAAAGCCTTCAGTTTTAAAAGG + Intergenic
1063815155 10:9762997-9763019 TCCAAGCCTTCATAAATATGAGG + Intergenic
1064623230 10:17235949-17235971 TCAAAGCATTCATTTTTTTTAGG + Intronic
1065405288 10:25357206-25357228 TAAAAGCATTCACTTTTATAAGG + Intronic
1065632894 10:27698809-27698831 TCAATGCATTCCTTTTAATGTGG + Intronic
1068107498 10:52637443-52637465 TCAATGCCTTCATTTAGAAGTGG + Intergenic
1068645365 10:59460626-59460648 TCAAAGTCTTCATTTTGAAAAGG - Intergenic
1068706925 10:60087270-60087292 TGAAAGCCTCGGTTTTTATGTGG - Intronic
1068723925 10:60279453-60279475 TTAAAGACTTCATTTATTTGTGG - Intronic
1069189226 10:65466650-65466672 TAAAGGCATTCAGTTTTATGAGG + Intergenic
1069340170 10:67400571-67400593 TCAAAGGCTTATTTTTCATGTGG + Intronic
1070633440 10:78105178-78105200 TAAAAGCATTCAGTTTTATAAGG + Intergenic
1070963297 10:80514345-80514367 ACAAAGACTGCATTTTTAGGAGG + Intronic
1072500619 10:96013836-96013858 TCAGAGCCATCATTTTCATCTGG - Exonic
1072741181 10:97910903-97910925 TCAGTGGCTTCATTTTCATGCGG - Intronic
1073895972 10:108158258-108158280 TTAGAGCCATCATTTTTCTGGGG - Intergenic
1075393382 10:122109580-122109602 TCAAAGTCTTCATTCTTCTTGGG - Intronic
1075895016 10:125987549-125987571 TCAAAGCCTTGGTTTTTGAGAGG - Intronic
1075957677 10:126537984-126538006 TCCTTGCCTTCATTTTTACGTGG - Intronic
1077942622 11:6859499-6859521 TAAAAGCATTCAGTTTTATAAGG - Intergenic
1078635147 11:13042765-13042787 TAAAAGTTTTCATTTTTAGGAGG - Intergenic
1079543571 11:21605748-21605770 TTATAGCATTCATTTTTATTTGG + Intergenic
1079739148 11:24035946-24035968 TAAAAGCATTCAGTTTTATAAGG + Intergenic
1081083909 11:38775482-38775504 TAAAAGCATTCAGTTTTATAAGG - Intergenic
1081527986 11:43940034-43940056 TCCAAGCCTTCAGTGTTGTGAGG + Intronic
1081612912 11:44573861-44573883 TCAGAGTCTTGGTTTTTATGAGG + Intronic
1082583863 11:54909351-54909373 TCAAAACCTTTATTTTCATTCGG - Intergenic
1085379130 11:76096859-76096881 GCAAAGGCTTCATTTGGATGAGG - Intronic
1085919079 11:80930160-80930182 TCTAAGCCTTCAAGATTATGGGG - Intergenic
1086604931 11:88685379-88685401 TAAAAGCATTCAGTTTTATAAGG + Intronic
1087341740 11:96915678-96915700 TGAAAGCATTCAGTTTTATAAGG + Intergenic
1087388484 11:97504594-97504616 TCAAAACATTTATTTTTGTGTGG - Intergenic
1088089166 11:106017939-106017961 TCAGAGTCTGCATTTTAATGGGG - Intronic
1088376161 11:109143896-109143918 TTAGAGCCTGCACTTTTATGAGG - Intergenic
1088377724 11:109160203-109160225 TAAAGGCCTTCAGTTTTATAAGG - Intergenic
1088941055 11:114456729-114456751 ACAAAGCATTTAATTTTATGTGG + Intergenic
1090449705 11:126795741-126795763 TAAAAAACTTCATTTTTTTGAGG - Intronic
1090558749 11:127905851-127905873 TGAAATTCTTCATTTTTATAAGG - Intergenic
1090890829 11:130920982-130921004 TAAAAGCATTCAGTTTTATAAGG - Intergenic
1092093679 12:5824301-5824323 TAAAAGCATTCAGTTTTATAAGG - Intronic
1092593600 12:9975568-9975590 TAAAAGCATTCAGTTTTATAAGG + Intronic
1092643798 12:10547383-10547405 TGAAAACCTTCATTTCTGTGAGG + Intergenic
1093102356 12:15042349-15042371 TCTAAGACTTCATGTTTATTTGG + Intergenic
1093322616 12:17732535-17732557 TAAAAGCTTACATTTATATGAGG + Intergenic
1093633399 12:21436534-21436556 ACAAAGCATTCATTTCTAGGAGG - Intergenic
1093784061 12:23172289-23172311 TCTGAGCCTCCAATTTTATGTGG + Intergenic
1093861136 12:24169110-24169132 AGAGATCCTTCATTTTTATGTGG - Intergenic
1094048007 12:26188242-26188264 TGAATTCTTTCATTTTTATGTGG - Intronic
1096026580 12:48369261-48369283 TCATAGACTTCCTCTTTATGGGG - Intergenic
1096063097 12:48718433-48718455 GCAATGCCTTCATTTTTGTATGG + Intergenic
1096063389 12:48720553-48720575 TAAAAGCATTCAGTTTTATAAGG - Intergenic
1098784407 12:74732275-74732297 TCTAAGCCTATACTTTTATGTGG - Intergenic
1101187959 12:102300800-102300822 TCAAAGACTTCATTTTGGTTAGG + Intergenic
1102388502 12:112530913-112530935 TAAAAGCCTTCATTTTTGGGAGG + Intergenic
1103759600 12:123238937-123238959 TTGAAGCCTTCATATTTAGGGGG + Intronic
1106875782 13:34071213-34071235 TCTCAGCCTTCATCTTCATGTGG + Intergenic
1107281542 13:38741767-38741789 TCTAGGCATGCATTTTTATGAGG + Intronic
1107552638 13:41491753-41491775 TCAAAGCCTTCAATATGCTGTGG - Intergenic
1108197089 13:48005929-48005951 CCAAAGCTTTTATTTTGATGGGG - Intergenic
1108806447 13:54162451-54162473 TCTCTGCCTTCATTTTTATATGG + Intergenic
1109324717 13:60853298-60853320 TAAAAGCATTCATTTTTAAAAGG - Intergenic
1109436122 13:62305420-62305442 TCCAACCCTACATTTTTATGTGG + Intergenic
1110559827 13:76898822-76898844 TAAAAGCATTTATTTTTATAAGG - Intergenic
1110721905 13:78771518-78771540 TCACATCCTTCAGTTCTATGAGG + Intergenic
1111261931 13:85752157-85752179 TTAAAGCATACACTTTTATGTGG - Intergenic
1111621480 13:90731196-90731218 TAAAGGCATTCAGTTTTATGAGG + Intergenic
1114373115 14:22112045-22112067 TCACAGACTCCATTTTTAAGAGG + Intergenic
1114380449 14:22198252-22198274 TAAAAGCATTCAGTTTTATAAGG + Intergenic
1114802420 14:25792522-25792544 TCCAAGCCTCCTATTTTATGTGG + Intergenic
1115068917 14:29297531-29297553 TAAAAGCATTCAGTTTTATAAGG - Intergenic
1115929697 14:38477607-38477629 TAAAAGCATTCAGTTTTATAAGG + Intergenic
1117688876 14:58284623-58284645 TTAAAGCTATCATTCTTATGGGG + Intronic
1117965253 14:61200632-61200654 TCCAAGGCTTAATTTTTTTGTGG + Intronic
1118045880 14:61970733-61970755 TCACTGCCTTCAATTTGATGAGG + Intergenic
1118075236 14:62290945-62290967 TCCAAGGCTTAATTTATATGAGG - Intergenic
1118707621 14:68494676-68494698 TCACTGCCCTCATTTTTATATGG - Intronic
1120074189 14:80137031-80137053 TCAAAGCCATCTTATTTGTGAGG - Intergenic
1120636925 14:86964674-86964696 TAAAAGCATTCAGTTTTATAAGG + Intergenic
1120831261 14:88999762-88999784 TGAAAGCCTCCATTTTTGTATGG + Intergenic
1121483900 14:94298794-94298816 TCAAAGCATTCAGTTTTATAAGG - Intergenic
1123504007 15:20919953-20919975 TAAAACCATTCATCTTTATGAGG + Intergenic
1123561254 15:21493615-21493637 TAAAACCATTCATCTTTATGAGG + Intergenic
1123597498 15:21930919-21930941 TAAAACCATTCATCTTTATGAGG + Intergenic
1125045345 15:35238540-35238562 GCAAAGCTTTCATGTTTCTGTGG + Intronic
1127158638 15:56155798-56155820 TGAAAGCCTTTTTTATTATGGGG - Intronic
1127263341 15:57341769-57341791 TCATAGCAATTATTTTTATGTGG - Intergenic
1130283286 15:82535571-82535593 TCAATGGCTTTATTTTTTTGCGG - Intergenic
1130425020 15:83788517-83788539 GCAAAGCCTTCAAATTTCTGAGG - Intronic
1130572736 15:85062929-85062951 CCAAAGCCAGAATTTTTATGAGG - Intronic
1132439366 15:101843266-101843288 TCATAGCCTTCCTTTTACTGTGG - Intergenic
1132820540 16:1866192-1866214 TCAAAGCTTTCCTTTATATAGGG + Intronic
1133596871 16:7302391-7302413 TCAGAGCCTTCATTTGGCTGAGG + Intronic
1134475973 16:14574348-14574370 TAAAGGCATTCAGTTTTATGAGG + Intronic
1134815878 16:17205600-17205622 TCATAGCCATCATTTCTATGTGG + Intronic
1135205455 16:20480204-20480226 TCAAAGCTATCATTTTGATTAGG - Intronic
1135213453 16:20543609-20543631 TCAAAGCTATCATTTTGATTAGG + Intronic
1135965074 16:27028801-27028823 TAAAACCAATCATTTTTATGGGG - Intergenic
1136662831 16:31780300-31780322 TAAAGGCATTCAGTTTTATGAGG + Intronic
1138198552 16:55072176-55072198 TAAAGGCATTCAGTTTTATGTGG - Intergenic
1138461712 16:57152591-57152613 TCAAAGTCATCATCTTTATGTGG - Exonic
1139304176 16:65969075-65969097 ACCAAGCCTTTATTTCTATGAGG + Intergenic
1140665878 16:77226935-77226957 TCAAAGGCTTTATTTTAAAGGGG - Intergenic
1140696763 16:77542388-77542410 TCAAAGCCTCCATGTCTATTTGG - Intergenic
1141443448 16:84043646-84043668 CCAAAGGCTTCTTTTTGATGTGG + Intergenic
1144051238 17:11498833-11498855 GCAAATCCTTCGTTGTTATGGGG - Intronic
1144140771 17:12345628-12345650 TCAGAGCCAGCATTTTTATCAGG - Intergenic
1144538588 17:16115486-16115508 TAAAGGCATTCAGTTTTATGAGG - Intronic
1146634761 17:34495662-34495684 TCAAGTACTTCATTTTTAAGTGG + Intergenic
1149818365 17:59749401-59749423 TCAAAGCCTGCAGGTTTATCAGG - Intronic
1149905703 17:60525216-60525238 TTAAAGCTTTGATTTTTTTGTGG - Intronic
1151997246 17:77617891-77617913 TCAAACTCTTCATTTGCATGTGG + Intergenic
1152123836 17:78434692-78434714 TCAAACCCTTTCTTTTTATCTGG + Intronic
1152270705 17:79323068-79323090 TCAAAGCCTTCATTAGGAGGGGG + Intronic
1153301392 18:3595008-3595030 TCAAAGCTTTTATCTCTATGTGG + Intronic
1155731366 18:29163404-29163426 TCAGAGACTTGATCTTTATGAGG + Intergenic
1155925406 18:31650743-31650765 TCAGAGGCTTCATTTTTAACAGG + Intronic
1156596194 18:38550902-38550924 CCAACTCCTTCGTTTTTATGTGG - Intergenic
1156940908 18:42766511-42766533 TAAAGGCCTTCAGTTTTATAAGG + Intronic
1157003153 18:43550844-43550866 TAAAAGCATTCAGTTTTATAAGG - Intergenic
1157195603 18:45617938-45617960 CCTAAGCCTTCATTTTTCTAGGG - Intronic
1158073489 18:53500949-53500971 TCAAAGACTTCATAGTTTTGGGG - Intronic
1158287492 18:55900352-55900374 TCCAAGCTTTTATTTTGATGTGG - Intergenic
1158628290 18:59090372-59090394 TCTCTGCCTTCATCTTTATGTGG + Intergenic
1159098255 18:63930320-63930342 TAAAAGCCTTCAGTTCCATGGGG + Intronic
1159131077 18:64281090-64281112 TAAAAGCCTTCAGTTTTAAAAGG + Intergenic
1159837494 18:73356780-73356802 TTAAAGCTTTCATTTCAATGGGG + Intergenic
1160244015 18:77142974-77142996 TAAAGGCATTCATTTTTATAAGG + Intergenic
1165117759 19:33539128-33539150 TCCAAGCCTTCTTCTTGATGAGG + Intergenic
1168483372 19:56740146-56740168 TGAAAGACTCCATTTTTATTTGG + Intergenic
926107663 2:10162585-10162607 TCAAAGCCCTCACTTTTTTCTGG + Intronic
926760540 2:16275000-16275022 TCAAATCATTCATTCTTTTGAGG - Intergenic
928048811 2:27967938-27967960 TGAAAGCATTCAGTTTTATAAGG + Intronic
929700831 2:44161605-44161627 TCATAGTCCTCATTCTTATGAGG + Intergenic
929962448 2:46506886-46506908 TCTTAGCCTTCATGTCTATGTGG - Intronic
930511743 2:52354296-52354318 GCAAAACCTTTCTTTTTATGTGG - Intergenic
930558551 2:52930290-52930312 TAAAAGCATTCAGTTTTATAAGG - Intergenic
930844026 2:55881518-55881540 TCAAAGCATTCATGTTTCTTTGG - Intronic
930976504 2:57468622-57468644 TCACATACTTAATTTTTATGAGG + Intergenic
931585238 2:63819220-63819242 TCTAAGCCTCAATTTTTATCAGG + Intronic
933875826 2:86621342-86621364 CCAAAGCCATCATTTTTTTATGG - Intronic
935372550 2:102362773-102362795 TCAAAGTTTTTTTTTTTATGTGG + Intronic
936813707 2:116433594-116433616 TAAAAGCATTCACTTTTATAAGG - Intergenic
938682073 2:133702240-133702262 TCAAAGCCAAAATTTTTCTGAGG + Intergenic
938888852 2:135682211-135682233 CCAAAGTCATCATTTCTATGTGG + Intronic
939476045 2:142687388-142687410 ATAAAGCCTACATTTTCATGTGG - Intergenic
941021626 2:160412943-160412965 TCAAAGCTTACTCTTTTATGTGG - Intronic
942334699 2:174870761-174870783 TCAAAGTCTTTATTTTGGTGAGG - Intronic
942521684 2:176810507-176810529 TCAAAATCTTTATTTTTAAGAGG - Intergenic
942727455 2:179026014-179026036 TAAAGGCCTTCAGTTTTATAAGG + Intronic
942923681 2:181407700-181407722 TAAAAGCCTGCCTTATTATGTGG - Intergenic
943622833 2:190168578-190168600 TAAAGGCATTCAGTTTTATGAGG - Intronic
943912421 2:193585236-193585258 TCAAAGATTTCATTTTAATTAGG - Intergenic
944734151 2:202546432-202546454 TCTATGCTTTCATTTTTATCAGG - Intronic
945431903 2:209773991-209774013 TCACAGCCTTCATTAATATTTGG + Intronic
945612924 2:212028780-212028802 TGAGAGCATTCATTTTTATATGG + Intronic
1169161237 20:3380325-3380347 TTAAAGCTTTCCTTTTTATTAGG - Intronic
1169663238 20:8004524-8004546 TCACAGTCTTCATTTTAAAGTGG - Intronic
1169709103 20:8541260-8541282 TCAAAGCCTTCCTTAATATTTGG - Intronic
1170007450 20:11684852-11684874 TCAAAGCAGTCATTTTCCTGGGG - Intergenic
1171911709 20:30967248-30967270 TCAGAAACTTCATTTTGATGTGG - Intergenic
1173733684 20:45345373-45345395 TCAAACCTTTCATTTTAAGGTGG + Intronic
1173989502 20:47290469-47290491 TCAAAGAGTGCATTTTTATAGGG - Intronic
1174775293 20:53338219-53338241 TAAAACCCTTCAATTTTATGTGG - Intronic
1177015023 21:15776053-15776075 AGATAGCTTTCATTTTTATGAGG + Intronic
1177487549 21:21778444-21778466 TTAAAGCATTCAGTTTTATAAGG - Intergenic
1177707112 21:24720612-24720634 CCAAAGCCTTCATTGTGATGAGG + Intergenic
1181185675 22:21101980-21102002 TCAAAGCCTTAAGTTTTGTTTGG + Intergenic
1184311864 22:43650954-43650976 TAAAAGCATTCAGTTTTATGAGG + Intronic
1184371124 22:44082742-44082764 ACAAAGGATTCATTTTTCTGTGG + Intronic
949704847 3:6804684-6804706 TCAAAGCCACCATTTTAGTGTGG - Intronic
950658384 3:14451519-14451541 TCAAAGCCTTGAATGTTAGGCGG + Intronic
950999042 3:17537057-17537079 GCAAAGCCATCTTTTTTAAGGGG - Intronic
951116182 3:18864738-18864760 CAAAAGAATTCATTTTTATGGGG + Intergenic
951173383 3:19569334-19569356 ACAAAGCCAACATTTGTATGTGG - Intergenic
951263184 3:20536181-20536203 TCAAAGCCTTCTTTTGTTTGAGG + Intergenic
951350063 3:21595908-21595930 TCCAATCCTTCATTTCTATGTGG + Intronic
952244773 3:31575448-31575470 TCAAATGCTTGATTTTTTTGGGG + Intronic
953208794 3:40856039-40856061 TCAGAGCCTGAATTTTTATTTGG - Intergenic
955102891 3:55869372-55869394 TGAAAGCTGTCATTTGTATGAGG - Intronic
956668541 3:71664377-71664399 TCAATGCCTCCATTTTTTTTTGG + Intergenic
957263457 3:77929945-77929967 TCAAGGCTTTCGTTTTTATATGG - Intergenic
957661344 3:83157793-83157815 TCAACGTTTTCATTTTTATTTGG + Intergenic
957870380 3:86083610-86083632 TAAAAGCATTCAGTTTTATAAGG - Intergenic
957981298 3:87514922-87514944 TCATCTTCTTCATTTTTATGAGG + Intergenic
958537328 3:95420434-95420456 TTATAGCTTTTATTTTTATGTGG - Intergenic
958611963 3:96437179-96437201 TAAAAGCATTCAGTTTTATAAGG - Intergenic
958647315 3:96888912-96888934 TAAAGGCATTCAGTTTTATGTGG - Intronic
961136392 3:124515322-124515344 TCTCAGCATTCTTTTTTATGAGG - Intronic
961257721 3:125571287-125571309 TAAAGGCATTCATTTTTATAAGG + Intronic
961489030 3:127239226-127239248 TAAAAGCTTCCATTTTAATGTGG + Intergenic
962493028 3:135911828-135911850 TCAAGGCTTTGATTTTTCTGTGG - Intergenic
962718279 3:138147757-138147779 TAAAAGCCTTAATTTTTCTTAGG - Intergenic
963952771 3:151221230-151221252 TAAAAGCATTCAGTTTTATAAGG + Intronic
964635772 3:158857510-158857532 TCAAAGACTTCATTTTGTTTTGG + Intergenic
964863308 3:161226103-161226125 TAAAACCCTTCATTCTGATGAGG - Intronic
965196415 3:165602397-165602419 TAAAAGTCTTCATTTGTATAGGG - Intergenic
965198679 3:165629760-165629782 TAAAGGCATTCAGTTTTATGAGG - Intergenic
965608007 3:170515722-170515744 TCAAACTCTTCATTTTTCAGAGG + Intronic
965712469 3:171569374-171569396 TAGGAGCCTTCAGTTTTATGGGG - Intergenic
966469521 3:180273426-180273448 TCAAAGCCTTCAAAATTGTGAGG - Intergenic
966799901 3:183753349-183753371 TCTAAGCCTATATTTTAATGTGG + Intronic
967248810 3:187515964-187515986 TCAATGCATTCATTTTTCAGTGG - Intergenic
968072734 3:195796723-195796745 TCTTAGCCTGCATTTTTTTGTGG - Intronic
969011273 4:4064507-4064529 TAAAGGCCTTCAGTTTTATAAGG - Intergenic
969742807 4:9045391-9045413 TAAAGGCCTTCAGTTTTATAAGG + Intergenic
969904610 4:10382596-10382618 TAAAAGCATTCAGTTTTATAAGG + Intergenic
970717017 4:18938186-18938208 TCAAGAAGTTCATTTTTATGAGG + Intergenic
970862924 4:20723970-20723992 TCAAAGCCTTCATTTTTATGGGG + Intronic
971204992 4:24557145-24557167 TCATTGCCTTCATTCTTACGTGG - Intronic
971779322 4:31011041-31011063 TCAAGCCCATCATTTTTCTGTGG + Intronic
973986095 4:56355517-56355539 ACACAGCCTTCATTTCCATGTGG - Intronic
974024312 4:56719656-56719678 TAAAAAATTTCATTTTTATGTGG + Intergenic
975277790 4:72521826-72521848 TGAAAGCATTCATTTATATGTGG - Intronic
975825324 4:78313862-78313884 TCATAGCCTTCACTTTCATTTGG + Intronic
976051052 4:81012000-81012022 TAAAAGCATTCAGTTTTATAAGG + Intergenic
976825334 4:89254459-89254481 TCAAATACTTCACTTTTAAGTGG - Intronic
977435390 4:96988906-96988928 TAAAAGCATTCAGTTTTATAAGG + Intergenic
977451091 4:97198963-97198985 TCAAGGCATTAATTTTTATATGG - Intronic
978087214 4:104668466-104668488 TTAAAGGCTTCAGTTTTATAAGG - Intergenic
978975037 4:114858944-114858966 TCTAATTCTTCATGTTTATGTGG - Intronic
979007913 4:115326313-115326335 TCAAAGCCTCCATTTCGATTAGG + Intergenic
979136213 4:117115301-117115323 TAAAAGCATTCATTTTTAAAAGG - Intergenic
979180819 4:117724334-117724356 TTAAAGCCTTAAATTTGATGAGG - Intergenic
979594356 4:122517669-122517691 TTAAATCTTTCATTTTTTTGAGG - Intergenic
980368548 4:131838348-131838370 TGAAAGCATTCAGTTTTATAAGG + Intergenic
981644329 4:146981511-146981533 TCAGAGACTTCAGCTTTATGTGG - Intergenic
982488264 4:155995675-155995697 TAAAGGACTTCATTTTTATTTGG - Intergenic
982503720 4:156192624-156192646 TCAAAAGTTTCATTTTCATGAGG + Intergenic
983340432 4:166454365-166454387 TAAAAGCATTCAGTTTTATACGG + Intergenic
984136465 4:175946543-175946565 TCAAAGCCTACTTTTCTAGGTGG + Intronic
984410203 4:179388258-179388280 TCAAATCCTTTATTTTCTTGTGG - Intergenic
984754990 4:183316770-183316792 TCATAGCTCTCATTTTTAGGGGG + Exonic
984926830 4:184814500-184814522 TTAAAACCTTCAATTCTATGTGG + Intronic
985033145 4:185812362-185812384 TCAAACTCATCATTTTTTTGAGG + Intronic
985159887 4:187033736-187033758 TGAAAGCATTCAGTTTTATAAGG + Intergenic
985180555 4:187256904-187256926 TCATAGCCTCAAGTTTTATGGGG - Intergenic
986398948 5:7360646-7360668 TTAATGCCTTCATTTTTAATAGG - Intergenic
986755103 5:10828198-10828220 TCACACTTTTCATTTTTATGAGG - Intergenic
987096068 5:14551398-14551420 GAAAAACCTTGATTTTTATGAGG - Intergenic
987402140 5:17488904-17488926 TCAAAGCATTGAGTTCTATGGGG - Intergenic
987531876 5:19131185-19131207 TGAAAGCATTCAATTTTATAAGG - Intergenic
987654901 5:20795023-20795045 TAAAAGCATTCAGTTTTATAAGG + Intergenic
988740743 5:34066914-34066936 TAAAAGCATTCAGTTTTATAAGG - Intronic
988941275 5:36150973-36150995 TATAAATCTTCATTTTTATGAGG + Intronic
989389117 5:40882234-40882256 TCAAGGCATTCAGTTTTATAAGG + Intergenic
989428556 5:41325123-41325145 TCAAAGCAATCTATTTTATGGGG - Intronic
989460710 5:41695716-41695738 TCAAAGATTTCATTTTGATTAGG + Intergenic
990429082 5:55717225-55717247 TAAAAGCATTCAGTTTTATAAGG + Intronic
990796899 5:59553664-59553686 ACCAAGCATTCATTTTAATGTGG - Intronic
990904149 5:60785313-60785335 TCAACTCCTTAATTTTTATTAGG - Intronic
991220566 5:64210921-64210943 TCAAATCCTTCATCTTCCTGAGG + Intronic
991315958 5:65307003-65307025 TTAAACTCTTCATTTTAATGTGG + Intronic
991340395 5:65602174-65602196 TAAAGGCCTTCAGTTTTATAAGG - Intronic
992094233 5:73346040-73346062 TCAAACCCCACATTTTTATTTGG - Intergenic
993293742 5:86108680-86108702 TAAAAGCATTCATTTTTATAAGG + Intergenic
993873399 5:93277818-93277840 TCAAAGCATTTATGTTTCTGGGG - Intergenic
994203610 5:97007249-97007271 TCAAAGCCTATATTTTTGAGGGG + Intronic
994287212 5:97983501-97983523 TCAATTCCTTCATCTTTAAGTGG + Intergenic
994380404 5:99064131-99064153 TCAGAGGCTTCATTTATATCGGG - Intergenic
994494215 5:100489112-100489134 TAAAGGCATTCATTTTTATAAGG - Intergenic
994755693 5:103790885-103790907 TAAAAGCATTCAGTTTTATAAGG - Intergenic
995223249 5:109675026-109675048 TTAAAGCATTCATCTTTGTGAGG + Intergenic
995282895 5:110355505-110355527 TAAAAGCCTTCATTATGATCTGG + Intronic
995623208 5:114050703-114050725 TCTATGCCTTCCTTATTATGTGG - Intergenic
996011326 5:118484087-118484109 TAAAAGCATTCAGTTTTATAAGG - Intergenic
996196268 5:120611204-120611226 TAAAAGCATTCAGTTTTATAAGG + Intronic
996663691 5:126033307-126033329 TCAATGCCATCCATTTTATGTGG - Intergenic
996834527 5:127776429-127776451 TAAAAGCATTCAGTTTTATAAGG + Intergenic
996909610 5:128640108-128640130 AGAAAGCCTTGATTTTCATGTGG - Intronic
997890259 5:137670155-137670177 TCAAACTCTCAATTTTTATGTGG - Intronic
998494836 5:142579402-142579424 ACAATGCCTTCATGTTTATGAGG + Intergenic
998525952 5:142843392-142843414 TCAAAGGTATCATCTTTATGTGG - Intronic
998586510 5:143432740-143432762 TGGAAGCCTTCATTTTTATGAGG + Intronic
999327852 5:150654326-150654348 TCAAAGGCTACATGTTTAAGCGG - Intronic
1000180014 5:158799773-158799795 GCTAGGCCTGCATTTTTATGGGG - Intronic
1000248010 5:159465890-159465912 GCAAAGCCTTCATTTGCATAGGG - Intergenic
1003180577 6:3788121-3788143 TACATGGCTTCATTTTTATGAGG - Intergenic
1003785217 6:9478189-9478211 TCATTGCCTTCATTTTTGTAGGG + Intergenic
1004290608 6:14363642-14363664 TCAATTCCTTTATTTTTGTGTGG + Intergenic
1004332605 6:14735480-14735502 TCCAAGCCTTAACTTTTAAGTGG - Intergenic
1004653249 6:17632574-17632596 TCAAATACTTCATTTTTAAATGG + Intronic
1005394803 6:25370298-25370320 TCAAGACCTTCATCTTTATGGGG + Intronic
1007749587 6:44063814-44063836 CCAAAGCCATCATTTCTGTGGGG - Intergenic
1008264697 6:49410674-49410696 ACAAAGCCTTCATTTTGGTCGGG + Intergenic
1009316157 6:62223615-62223637 TAAAAGCATTCATTTTTATAAGG - Intronic
1009772412 6:68160700-68160722 TAAAAGCATTCAGTTTTATAAGG + Intergenic
1010374667 6:75153034-75153056 TCTAATCCTTCATATATATGTGG - Intronic
1012767578 6:103387841-103387863 TAAAAGCGTTCAGTTTTATAGGG - Intergenic
1013071754 6:106735885-106735907 CCAAACCCTTCCTTTTTATCAGG - Intergenic
1013890585 6:115021623-115021645 TAAAAGCATTCAGTTTTATAAGG - Intergenic
1014029354 6:116682596-116682618 GTAAAGCCTTCATTTCCATGGGG - Intronic
1014409971 6:121102908-121102930 TCATATCCTTCTTTTTGATGGGG - Intronic
1016177531 6:141098820-141098842 TAAAAGCATTCAGTTTTATAAGG + Intergenic
1017550480 6:155501077-155501099 TCAAATTCTACATTTTTATAGGG + Intergenic
1018554507 6:165035999-165036021 TAAAAGCATTCAGTTTTATAGGG + Intergenic
1021407881 7:20294928-20294950 TCAATTCTTTCATTTTTATTTGG + Intergenic
1021497167 7:21288748-21288770 TGAAGGCTCTCATTTTTATGTGG + Intergenic
1022413961 7:30162142-30162164 TTAAAACATTTATTTTTATGTGG - Exonic
1027434643 7:78151868-78151890 TCACAGTCTTCCTTTTGATGAGG + Intronic
1028680413 7:93522545-93522567 TGAAATACTTCATTTTTATAAGG - Intronic
1029070557 7:97892520-97892542 TAAAGGCCTTCAGTTTTATAAGG - Intergenic
1030108556 7:106007425-106007447 TAAAGGCATTCAGTTTTATGAGG - Intronic
1030868706 7:114731084-114731106 TAAAAGCATTCAGTTTTATAAGG + Intergenic
1030967005 7:116005582-116005604 TAAAGGCATTCAGTTTTATGAGG + Intronic
1031327090 7:120415310-120415332 TAAAAGCTTTCAATTTTATATGG + Intronic
1031367122 7:120915856-120915878 ACAAAGCATACATTTTTAAGAGG - Intergenic
1032000490 7:128262071-128262093 GCAGAGCCTACATTCTTATGGGG - Intergenic
1032910704 7:136426248-136426270 TCAAAGCATCAATATTTATGGGG - Intergenic
1033419793 7:141195276-141195298 TAAAGGCATTCAGTTTTATGAGG - Intronic
1033760060 7:144427970-144427992 TAAAAGCATTCAGTTTTATAAGG - Intergenic
1034011460 7:147533357-147533379 CCAAAGGTTTCATATTTATGAGG - Intronic
1034514085 7:151560409-151560431 TCAAAGCCTTGATCTGTAGGTGG + Intronic
1036248012 8:7137205-7137227 TAAAGGCCTTCAGTTTTATAAGG + Intergenic
1036886242 8:12555793-12555815 TAAAGGCCTTCAGTTTTATGAGG - Intergenic
1037003435 8:13748120-13748142 TCAAGGCATTCAGTTTTATAAGG - Intergenic
1037502804 8:19501450-19501472 TCAAAGCCTTCACTTTTCTGTGG + Intronic
1038977497 8:32716369-32716391 TCAATGCTTTGATTTTTAGGTGG + Intronic
1040472071 8:47742280-47742302 TCCCAGCCTACATTTTTATCAGG + Intergenic
1041208255 8:55520728-55520750 AGAAAGCCTTCATTTTTCTACGG + Intronic
1041897826 8:62946513-62946535 TAAAAGCCTTCATTATGGTGGGG + Intronic
1042602457 8:70512181-70512203 TAAAGGCCTTCAGTTTTATAAGG + Intergenic
1043128875 8:76436092-76436114 TAAAGTCCTTCTTTTTTATGTGG - Intergenic
1043454707 8:80401842-80401864 TCAATGTCTTCAATTTTCTGGGG + Intergenic
1044010046 8:86983798-86983820 TAAAAGCATTCAGTTTTATAAGG + Intronic
1044194113 8:89353778-89353800 TAAACGCATTCATTTTTATATGG - Intergenic
1044204857 8:89481578-89481600 TGAAATCATCCATTTTTATGGGG + Intergenic
1045244849 8:100434000-100434022 GGGAAGCCTTTATTTTTATGGGG + Intergenic
1045777566 8:105823777-105823799 TGAGAGTCTGCATTTTTATGCGG + Intergenic
1046305244 8:112357361-112357383 TAAAAGCATTCAGTTTTATAAGG + Intronic
1046572544 8:115984537-115984559 TCAAAACCTCCATTTTGATCAGG - Intergenic
1046785316 8:118259471-118259493 TCAGAGACTTCTTTGTTATGAGG - Intronic
1047106927 8:121742847-121742869 TCAACGTCTTCATTTTACTGAGG + Intergenic
1047242493 8:123104701-123104723 CCTATACCTTCATTTTTATGGGG - Intronic
1047552799 8:125894918-125894940 ACAAATCCTTTATTTGTATGGGG + Intergenic
1048660844 8:136599573-136599595 TAAAAGCATTCAGTTTTATAAGG + Intergenic
1048932239 8:139324393-139324415 CCAAAGCCTGCATTTAGATGAGG + Intergenic
1050076077 9:1865613-1865635 TCAAAACCTAGGTTTTTATGGGG - Intergenic
1050367575 9:4886729-4886751 TCAAAGCCTTCTTGGTTATGTGG - Intergenic
1050468359 9:5957655-5957677 TCAGAGCATTCCTTTTTATTAGG + Intronic
1050841933 9:10160575-10160597 ACATAGCCTTTATTTTCATGAGG - Intronic
1052080751 9:24203035-24203057 TAAAAGCATTCAGTTTTATAAGG + Intergenic
1052126804 9:24786272-24786294 TCAAAACCATCATCTTTCTGAGG + Intergenic
1052520342 9:29539372-29539394 TCAAAACCTTCATATGGATGTGG + Intergenic
1052954156 9:34240062-34240084 TTATAGCCTCCATTTTTATTAGG + Intronic
1055317636 9:75049778-75049800 TCAAGACCTCTATTTTTATGTGG - Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057719451 9:97520198-97520220 TCAATGCTTTCATTTTTCAGAGG + Intronic
1058206246 9:102112352-102112374 TGAAATCCTTCATTATTGTGTGG + Intergenic
1059218558 9:112590165-112590187 TCAAAATCTGCATTTTAATGAGG + Intronic
1186335260 X:8579969-8579991 TCAAAGCCTTCACTTGGATCAGG + Intronic
1187167022 X:16813756-16813778 TTAATGCATTCATTTTTGTGTGG - Intronic
1187780034 X:22810562-22810584 TCACAAACATCATTTTTATGTGG - Intergenic
1188325597 X:28797394-28797416 TAAAGGCATTCAGTTTTATGAGG - Intronic
1189945384 X:46171968-46171990 TAAAAGCATTCAGTTTTATAAGG - Intergenic
1191008411 X:55736475-55736497 TCAAAGATTTCATTTTGATTTGG + Intronic
1192080424 X:68042495-68042517 GAAAAGCCTTCATTTTCCTGGGG - Exonic
1192252811 X:69427176-69427198 TCAAAAACTTCATTTTTTTAAGG + Intergenic
1193279307 X:79628249-79628271 TAAAAGCATTCAGTTTTATAAGG + Intergenic
1194552410 X:95318587-95318609 TCAAAACTTTCATTTTCATTAGG + Intergenic
1195056043 X:101145918-101145940 TCAAATCTTTCATTTTTTGGGGG - Intronic
1195641702 X:107182871-107182893 TCAAAACTTTCATTTTTTAGGGG - Intronic
1195924143 X:110008784-110008806 TCAAATGCTTCATTTCCATGTGG - Intronic
1196012801 X:110906219-110906241 TCAAATCCTTCTTTTTTGGGAGG + Intergenic
1196341006 X:114597463-114597485 TCTTTTCCTTCATTTTTATGTGG - Intronic
1197348896 X:125358755-125358777 TAAAAGCATTCAGTTTTATAAGG + Intergenic
1197460310 X:126733111-126733133 TCAAATCATTCATTTTTACATGG - Intergenic
1197567226 X:128102098-128102120 TTAAAGCATTCAGTTTTATAAGG - Intergenic
1198499308 X:137226954-137226976 TCAACGTTTTCTTTTTTATGGGG - Intergenic
1200041705 X:153375583-153375605 TCAAAGCCTTCATTTCCTTCAGG - Intergenic
1200106869 X:153719096-153719118 ACAAAGCCTTCATTCTTTTTTGG - Intronic
1201924148 Y:19266566-19266588 TAAAAGCATTCAGTTTTATAAGG - Intergenic
1202091319 Y:21193972-21193994 TAAAAGCATTCAGTTTTATAAGG + Intergenic