ID: 970868523

View in Genome Browser
Species Human (GRCh38)
Location 4:20785813-20785835
Sequence GATCCTTCCACCAAGGTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970868523_970868526 -8 Left 970868523 4:20785813-20785835 CCTAAGACCTTGGTGGAAGGATC 0: 1
1: 0
2: 0
3: 15
4: 134
Right 970868526 4:20785828-20785850 GAAGGATCTCCATTTCTTGGTGG 0: 1
1: 0
2: 1
3: 14
4: 174
970868523_970868530 19 Left 970868523 4:20785813-20785835 CCTAAGACCTTGGTGGAAGGATC 0: 1
1: 0
2: 0
3: 15
4: 134
Right 970868530 4:20785855-20785877 GTAACTTGGTGCAGCCACTGTGG 0: 1
1: 2
2: 181
3: 1738
4: 5439
970868523_970868529 5 Left 970868523 4:20785813-20785835 CCTAAGACCTTGGTGGAAGGATC 0: 1
1: 0
2: 0
3: 15
4: 134
Right 970868529 4:20785841-20785863 TTCTTGGTGGGAATGTAACTTGG 0: 1
1: 3
2: 53
3: 484
4: 2087
970868523_970868527 -7 Left 970868523 4:20785813-20785835 CCTAAGACCTTGGTGGAAGGATC 0: 1
1: 0
2: 0
3: 15
4: 134
Right 970868527 4:20785829-20785851 AAGGATCTCCATTTCTTGGTGGG 0: 1
1: 0
2: 1
3: 8
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970868523 Original CRISPR GATCCTTCCACCAAGGTCTT AGG (reversed) Intronic
903953403 1:27009618-27009640 GGTCCTTGGACCAAGGTCTTTGG - Intronic
904701031 1:32358107-32358129 AATCCCCCCACCAAGTTCTTAGG + Intronic
905167299 1:36090214-36090236 GATCCTTCCACCTCAGTCTCTGG - Intronic
905254446 1:36671174-36671196 GATCCTGTCTCCAAGGTTTTTGG + Intergenic
905320621 1:37114321-37114343 GATGCTTCCAGCATGGTCTTGGG - Intergenic
907339696 1:53726189-53726211 GGACCTTCCATCAAGGCCTTGGG - Intronic
908041214 1:60115839-60115861 CATCCTTCCAAAAAGGTTTTTGG - Intergenic
911722669 1:101208240-101208262 GATTCTCCCACAAATGTCTTTGG + Intergenic
915215833 1:154340317-154340339 GCTCCTTCCACCCTGGGCTTGGG - Intronic
915233282 1:154461969-154461991 GATCCTTAAACAAAAGTCTTAGG + Intronic
917956270 1:180102007-180102029 ATTCCTTCCCCCAAGGTATTGGG + Intronic
918323107 1:183383325-183383347 GAGGCTTCCACCAAGGTCTCTGG + Intronic
924618172 1:245632800-245632822 GATCCTTCCACCTTGGCCTCCGG - Intronic
924743440 1:246811574-246811596 GATGCTTACACCAGGGCCTTAGG + Intergenic
1063774114 10:9240827-9240849 CATTCTTCCACTAAGGTCTGTGG + Intergenic
1063878558 10:10507347-10507369 GATACTTCCACCAATGTCACAGG + Intergenic
1064655472 10:17551483-17551505 GTTCCTTCCCCCAGGGTATTGGG - Intergenic
1068337918 10:55661318-55661340 GATTGTTCCACCATGGCCTTAGG - Intergenic
1068801403 10:61144721-61144743 GAGCCTTCCACCAAGTCCTGAGG - Intergenic
1069411947 10:68163052-68163074 AATCCTCCCACCAAAGTGTTGGG - Intronic
1069770964 10:70899649-70899671 AATCCTTCCACCAAGGGATAAGG - Intergenic
1070646869 10:78207964-78207986 GAGCCTGCCAGCAATGTCTTGGG + Intergenic
1076811845 10:132890470-132890492 GATCCTTCAACCAAAGCCTTAGG - Intronic
1077764461 11:5143460-5143482 GCTCCTTCCAACCAGATCTTGGG + Intergenic
1078433880 11:11308775-11308797 GCTACATCCATCAAGGTCTTTGG + Intronic
1078733944 11:14002669-14002691 GCTCCTGCCACCAGGCTCTTGGG - Intronic
1079026903 11:16956257-16956279 GATCCTTCCACCTTGGCCTCTGG + Intronic
1081129702 11:39363889-39363911 GTTCCTTCCACCCTGTTCTTAGG + Intergenic
1083075183 11:60029379-60029401 GATGCTACCACCAAAATCTTAGG - Intergenic
1085540151 11:77260068-77260090 GATCCGCCCACCAAAGTGTTGGG - Intronic
1090880028 11:130825200-130825222 GTCCCTTCCCCCAAGGGCTTCGG + Intergenic
1092951796 12:13510469-13510491 GAGCCTGGCACCAAGGTCTTTGG + Intergenic
1093134777 12:15437418-15437440 ATTCCTTGCACCAAGATCTTTGG - Intronic
1093446507 12:19266231-19266253 GATCCTCCCACCTTGGTCTCCGG - Intronic
1093886641 12:24468936-24468958 CATCCTTCCACCCTGGTCTGTGG - Intergenic
1093930716 12:24952520-24952542 GATCCTTCCACCTCAGCCTTGGG - Intergenic
1096000321 12:48124380-48124402 GATCATTCTACCAAGGTTTCAGG - Intronic
1096396043 12:51267597-51267619 GATCCTCCCACCTAAGCCTTTGG + Intronic
1096532283 12:52249507-52249529 CATCCCTCCACTAAGGTCCTAGG - Intronic
1097510156 12:60529337-60529359 GCACCTGCCACAAAGGTCTTTGG - Intergenic
1099987846 12:89688720-89688742 GATCCTTACTGCAGGGTCTTGGG + Intronic
1100481435 12:94983382-94983404 GTTCCTTCCACCTTGGTCTGGGG + Intronic
1102227667 12:111240375-111240397 GTACCTTCCACCAAAGTCTATGG - Intronic
1105464415 13:20624434-20624456 ATTCCTTCCACCAGGGTTTTGGG + Intronic
1106529188 13:30572654-30572676 GATCCTTACACCAGGGTCAACGG - Intronic
1106633962 13:31507529-31507551 GATCCTCCCACCTTGGCCTTAGG + Intergenic
1108175713 13:47790862-47790884 GATATTTTCCCCAAGGTCTTGGG - Intergenic
1109155710 13:58906504-58906526 GAGCCTTCCACCAGGGGCCTGGG - Intergenic
1110127874 13:71969856-71969878 AATCCTTCCACCAAGTCTTTTGG + Intergenic
1110284147 13:73730358-73730380 TAACCTGCCACCAAGGTTTTTGG - Intronic
1112259368 13:97864078-97864100 AATCCCTCCCCCATGGTCTTGGG + Intergenic
1118298830 14:64595680-64595702 CATCCCCCAACCAAGGTCTTAGG - Intergenic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1120989790 14:90364952-90364974 GATCCTTCCACCTCGGCCTCCGG - Intergenic
1123689339 15:22823856-22823878 GTGCCTTCCACCAAGGGCATCGG + Exonic
1126551318 15:49933311-49933333 AATTCTTCCTACAAGGTCTTTGG - Intronic
1128448460 15:67785688-67785710 CCTCCTTCCATCAAGGTCATAGG - Intronic
1128883098 15:71261345-71261367 GATCCTTCCTCCAGAGACTTTGG + Intronic
1133504227 16:6394809-6394831 GATCTTTTCACCAAGGACTTAGG - Intronic
1133960229 16:10486746-10486768 GATCCTTTCCCCAAGGTCGCCGG - Intergenic
1137681735 16:50353172-50353194 GATCCTTCCACCTCAGTCTCTGG + Intronic
1138405713 16:56792072-56792094 GATCCTCCCACCTAAGTCTCCGG - Intronic
1140572577 16:76125875-76125897 CATCCTTCCTGCAGGGTCTTGGG + Intergenic
1141389819 16:83655204-83655226 GATCCTTCCAGCCTGGCCTTTGG + Intronic
1146301832 17:31695670-31695692 CATCCTTGCACCAAGGCCTCTGG - Intergenic
1146401210 17:32501426-32501448 ATTCCTTCCTCCAAGGTGTTGGG - Intronic
1148002794 17:44399722-44399744 TTTCCTCCCACCATGGTCTTGGG + Exonic
1151080198 17:71321050-71321072 GATCCTTGCAGCAAGGTGTTCGG - Intergenic
1152046875 17:77942635-77942657 GATCTTTCGACACAGGTCTTTGG + Intergenic
1153325951 18:3820394-3820416 GTTCCTTCCTCCCAGTTCTTTGG - Intronic
1153641931 18:7165008-7165030 GATCCTTCTCCTAAGGTTTTGGG + Intergenic
1154232246 18:12567645-12567667 AATCCTTCCCCAAAGGACTTAGG - Intronic
1155497801 18:26459770-26459792 GATCCTTTCTCCGAGGTCTGGGG + Exonic
1168559344 19:57370342-57370364 GAACCTTCAACCCAGGGCTTAGG + Intronic
1168562508 19:57395936-57395958 GAACCTTCAACCCAGGGCTTAGG + Intronic
927869191 2:26613035-26613057 GATCCTTTCCCCAAGGCCTAGGG + Intronic
933659268 2:84914206-84914228 GATGCTTCCATGAAGGTCTTGGG - Intergenic
934924404 2:98371905-98371927 GGTCCTTCTCCCAAGGTCTTGGG - Intronic
935684878 2:105674413-105674435 GATTCTTCCTACAATGTCTTGGG - Intergenic
935930297 2:108116940-108116962 GATACTACAACCTAGGTCTTAGG - Intergenic
938276820 2:130033716-130033738 GACCCTGTGACCAAGGTCTTGGG - Intergenic
938327789 2:130424497-130424519 GACCCTGGGACCAAGGTCTTGGG - Intergenic
938362157 2:130696981-130697003 GACCCTGGGACCAAGGTCTTGGG + Intergenic
938746577 2:134284156-134284178 GAACCATCCACCAAGGATTTTGG - Intronic
942983848 2:182115208-182115230 TAACCTGGCACCAAGGTCTTGGG - Intronic
943872544 2:193019692-193019714 TCACCTTCCACCAGGGTCTTTGG + Intergenic
944101909 2:196036489-196036511 GAGTCTTCCCCCAAGGTATTGGG + Intronic
946625024 2:221602183-221602205 GACCCTCCCACAGAGGTCTTGGG + Intergenic
947297946 2:228654008-228654030 GGGCCTTCCTCCAAGGTCTTTGG + Intergenic
1174798325 20:53541064-53541086 GATCCTTCCACCTCAGCCTTCGG - Intergenic
1175153886 20:56956228-56956250 AATCCTTCCAGCTAGGTCTGTGG - Intergenic
1183176080 22:36225679-36225701 GATCCTTCTTCCAGGGTCTCAGG - Intergenic
1183182254 22:36268034-36268056 GATCCTTCTTCCAGGGTCTCGGG + Intergenic
1184609119 22:45591126-45591148 GCCCCTTCCACCAAGCTCTGTGG - Intronic
950691974 3:14666237-14666259 TTTCCTTCCACCCAGGTCCTGGG - Intronic
951599373 3:24356319-24356341 CAGCCTTCCACTAAAGTCTTGGG - Intronic
953392803 3:42543638-42543660 GGTCCTGCTGCCAAGGTCTTTGG + Intergenic
955287036 3:57651956-57651978 GATCCTCCCACCTAGGTGTTGGG - Intronic
956359208 3:68428589-68428611 GAGTGTTCCACCAATGTCTTAGG - Intronic
957145105 3:76413273-76413295 GATATTTTCACCATGGTCTTGGG + Intronic
959315568 3:104801922-104801944 GCTCTTTCCACCAAAGGCTTTGG - Intergenic
961961916 3:130864509-130864531 GATACTTTCCCCATGGTCTTGGG - Intronic
962762493 3:138528148-138528170 GATCCTTCCACCTCAGTCTTCGG + Intronic
965527920 3:169740917-169740939 GATCCATCCACCAAAGTGCTGGG - Intergenic
966469504 3:180273183-180273205 TCTCCTTCCACCATTGTCTTGGG + Intergenic
967280440 3:187817356-187817378 GATCCTTTCACCCAGGTACTGGG + Intergenic
970782836 4:19759444-19759466 GATCCTCCCACCTAAGTGTTGGG - Intergenic
970868523 4:20785813-20785835 GATCCTTCCACCAAGGTCTTAGG - Intronic
979732871 4:124045640-124045662 GGTCATGCCACCAAGGCCTTGGG - Intergenic
980509012 4:133760273-133760295 GCTCATGCCACCAAGGCCTTGGG - Intergenic
982734480 4:158991274-158991296 GATTCTGTCTCCAAGGTCTTTGG - Intronic
983568175 4:169176214-169176236 ATTCCTTTCACCAATGTCTTAGG - Intronic
986464152 5:8004770-8004792 CAGCCTTCCACAAAGGCCTTGGG - Intergenic
988199980 5:28054988-28055010 GATATTTCCTCCATGGTCTTGGG + Intergenic
990560016 5:56974529-56974551 GAACCTTCCACCAGGTTCTTAGG + Intergenic
992957431 5:81924382-81924404 GATTCTTAAACCATGGTCTTGGG - Intergenic
996036195 5:118762071-118762093 GCCCATGCCACCAAGGTCTTGGG + Intergenic
997246556 5:132355055-132355077 GATTCTTCCTCCTAGGTCTCTGG - Intergenic
998107522 5:139477753-139477775 GATCCTTCTTCCAAGATCCTAGG + Intronic
999375988 5:151086909-151086931 GCTCTTCCCACCCAGGTCTTGGG - Intronic
1001860285 5:175048195-175048217 GATCCTACCACTAAGTTCTATGG - Intergenic
1005971241 6:30763583-30763605 AATACTTCCATCAAGGTGTTGGG - Intergenic
1006558422 6:34889028-34889050 GCTCCTTCCCCAAAGGTTTTGGG - Intergenic
1011658514 6:89574104-89574126 GGTGCCTACACCAAGGTCTTTGG - Intronic
1015459017 6:133466976-133466998 AACTCTGCCACCAAGGTCTTTGG + Intronic
1021501132 7:21333336-21333358 GATCCTTCCACCTCAGTCTCTGG - Intergenic
1023388383 7:39683115-39683137 GATGCTGCCACCATGCTCTTGGG + Intronic
1026827045 7:73590886-73590908 GATCCTCCCACCTTGGCCTTAGG - Intergenic
1028843956 7:95459554-95459576 GCTCCTTCCTCCAGGGTCTGTGG - Intergenic
1031596282 7:123653344-123653366 GATCCTCCCACCTCGGCCTTCGG - Intergenic
1034153252 7:148933686-148933708 GATCCTTCCACCACAGTCTCCGG - Intergenic
1042079719 8:65037959-65037981 GATCCTTTCAGCATGGTCTGGGG + Intergenic
1044170835 8:89049954-89049976 GACCCTTCCACCAGGGCTTTGGG - Intergenic
1044560141 8:93604794-93604816 GTTCCCTTCACCCAGGTCTTAGG - Intergenic
1045924372 8:107568667-107568689 GATCTTTCCTCCAAGATATTAGG - Intergenic
1053594961 9:39551215-39551237 GATTCTTCCACCTCAGTCTTTGG - Intergenic
1053852742 9:42306242-42306264 GATTCTTCCACCTCAGTCTTTGG - Intergenic
1054571292 9:66813759-66813781 GATTCTTCCACCTCAGTCTTTGG + Intergenic
1055897220 9:81192206-81192228 CATGCTTCCACCAATGTTTTAGG - Intergenic
1060146291 9:121255343-121255365 GATCCTTCCACCTAGTCCCTGGG + Intronic
1061565248 9:131434472-131434494 CATCCTCCCACCAAGGTATCAGG + Intronic
1062688331 9:137827842-137827864 GAACCTTCCACCTAGGTTTCGGG - Intronic
1186497898 X:10026358-10026380 GTTCCTTCCACGTAGGTCTATGG - Intronic
1190176566 X:48155541-48155563 GATCCTCCCACCTCGGCCTTGGG - Intergenic
1190194706 X:48307106-48307128 GATCCTTCCACCACAGCCTCGGG + Intergenic
1190639112 X:52465855-52465877 CATCCTTCCAAGAAGGACTTTGG + Intergenic
1190661186 X:52655587-52655609 GATCCTTCCACCACGGCCTCAGG + Intronic
1193751974 X:85356902-85356924 GTTTCTTCCACCAAGATTTTGGG - Intronic
1195513237 X:105742005-105742027 GATCCTTGCCACAAGGTGTTTGG - Intronic
1199843098 X:151670748-151670770 GACTCTTCCACTAAGGACTTTGG + Intronic