ID: 970870135

View in Genome Browser
Species Human (GRCh38)
Location 4:20807337-20807359
Sequence GTGAAGACCCTGTAATCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970870134_970870135 6 Left 970870134 4:20807308-20807330 CCAACATAAACATTAGTGCAAAG 0: 1
1: 0
2: 1
3: 19
4: 264
Right 970870135 4:20807337-20807359 GTGAAGACCCTGTAATCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970870135 Original CRISPR GTGAAGACCCTGTAATCACA TGG Intronic
No off target data available for this crispr