ID: 970870527

View in Genome Browser
Species Human (GRCh38)
Location 4:20812016-20812038
Sequence TTTTCCCCCACTGGGGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970870519_970870527 26 Left 970870519 4:20811967-20811989 CCCTAAGAGACAGGCCACTAAAT 0: 1
1: 0
2: 0
3: 11
4: 113
Right 970870527 4:20812016-20812038 TTTTCCCCCACTGGGGTGTCTGG 0: 1
1: 0
2: 0
3: 12
4: 162
970870521_970870527 12 Left 970870521 4:20811981-20812003 CCACTAAATTAAATGACAGTTTG 0: 1
1: 0
2: 2
3: 15
4: 263
Right 970870527 4:20812016-20812038 TTTTCCCCCACTGGGGTGTCTGG 0: 1
1: 0
2: 0
3: 12
4: 162
970870520_970870527 25 Left 970870520 4:20811968-20811990 CCTAAGAGACAGGCCACTAAATT 0: 1
1: 0
2: 0
3: 15
4: 142
Right 970870527 4:20812016-20812038 TTTTCCCCCACTGGGGTGTCTGG 0: 1
1: 0
2: 0
3: 12
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970870527 Original CRISPR TTTTCCCCCACTGGGGTGTC TGG Intronic
900837190 1:5014058-5014080 TTTTGGCCCAGTGGGGTGGCAGG - Intergenic
901150355 1:7097198-7097220 TTCTTCCCCAGTGGGGTGGCGGG + Intronic
901162733 1:7192449-7192471 ATTTCCACCACTGGGCTATCCGG - Intronic
904615144 1:31745565-31745587 CTCTCCCACAATGGGGTGTCAGG + Intronic
905204509 1:36335543-36335565 TTTTTCCCCAGTGGGGGCTCTGG - Intergenic
906684911 1:47757024-47757046 TTGTCCCCCTCTTGGGTCTCAGG + Intergenic
907329160 1:53660139-53660161 TGTTCCCCCATTGAGGTGTCTGG - Intronic
911184831 1:94893009-94893031 TTTTCTCACACTGGTGTGCCTGG - Intronic
912175629 1:107152464-107152486 TTTTAAGCCACTGGGGTGTGCGG - Intronic
914754997 1:150557479-150557501 TTCTCACCCACTCAGGTGTCTGG + Exonic
916727105 1:167533212-167533234 TCTTCCCTCAGTGGGGTGTGTGG + Intronic
918210009 1:182342177-182342199 TTTTCCCCCATTGGAGAGTTTGG - Intergenic
919819737 1:201465585-201465607 CTTCCCCCCACTGCGGTGTTCGG - Exonic
921192987 1:212726196-212726218 TTTTCCCCCACTGATGTGAGAGG - Intronic
924181235 1:241440339-241440361 TTTTCCCCATCTGGAGTATCGGG - Intergenic
1063958967 10:11290627-11290649 TTTTCCTCCACTGCAGTCTCAGG - Intronic
1065271914 10:24041892-24041914 TTTTCCCCTTCTAGGCTGTCTGG + Intronic
1065445119 10:25790400-25790422 TTTTTCCCCACAGTTGTGTCTGG + Intergenic
1065617119 10:27538783-27538805 TTTTCCCCCATTTTGGTTTCAGG + Exonic
1068777172 10:60880404-60880426 TATTCCCTCTCTGAGGTGTCTGG - Intronic
1069157182 10:65044601-65044623 TTTTCCCCTACTGGGACGTGGGG - Intergenic
1069572065 10:69500281-69500303 TTGTCCCCTACTGGGGTGAGGGG + Intronic
1069797195 10:71061038-71061060 TTGTCCCACACTGGGGAGTGTGG + Intergenic
1069871906 10:71538281-71538303 TTTTCCCTCACTGGGGGACCTGG - Intronic
1072465886 10:95662097-95662119 TCTTCCCCCACTGAGTTGTTGGG + Intergenic
1074430012 10:113386467-113386489 TTCTCCCTCCCTGGGGTGACTGG + Intergenic
1075536648 10:123277038-123277060 TTTTCACCCAGTGGGGTGAGAGG - Intergenic
1077406255 11:2383780-2383802 TCGTCCCCCACTGGGGTGCCTGG + Intronic
1084981817 11:72833031-72833053 TTCTCCCTCCCTGGGGTCTCAGG - Intronic
1089127042 11:116183846-116183868 TTCTCCAACACTGGGGTGTGTGG + Intergenic
1089748368 11:120632805-120632827 TTCTCCACCACTGGGGAGACTGG + Intronic
1092688010 12:11072791-11072813 TTTTCACCCACGGGTGGGTCGGG + Intronic
1093473443 12:19529346-19529368 TTTTCCCTCACTGGGGAGCAGGG - Intronic
1096569918 12:52516434-52516456 TTTTCCCCCACCGGTGTTCCTGG - Intronic
1097021308 12:56022479-56022501 GATTCCCTCACTGGGGTTTCTGG + Intronic
1101613146 12:106310252-106310274 TGTTCCCCCACTTGTGAGTCAGG + Intronic
1102611881 12:114119531-114119553 GTTTCCCCTGCTGGGGTCTCAGG + Intergenic
1103870760 12:124089920-124089942 TTTTCTCCCATAGGTGTGTCTGG - Intronic
1113262354 13:108578628-108578650 ATCTTCCCCACTGGGATGTCTGG + Intergenic
1114024850 14:18515906-18515928 TTGTCCCTCACTTAGGTGTCCGG + Intergenic
1115124160 14:29972456-29972478 TTCTGCCCCACTGGGGTTCCAGG - Intronic
1119295167 14:73526921-73526943 TCTCTCCCCACTGGGCTGTCTGG - Intronic
1119678602 14:76574963-76574985 TTGTCCCTAACTGGGCTGTCAGG + Intergenic
1120496187 14:85239500-85239522 TGCTCCCCCACTGGGATTTCTGG + Intergenic
1122185157 14:99986793-99986815 TTTTCCCCCATTGAATTGTCTGG - Intronic
1122690709 14:103530991-103531013 ATGTCCCTCCCTGGGGTGTCTGG + Intronic
1122999665 14:105286529-105286551 GCTTCCCCCACTGGGGTTCCTGG - Intronic
1124078701 15:26470980-26471002 TCTTCCCCCACTGTGGTATTGGG - Intergenic
1124200013 15:27671096-27671118 TTGTTCCCCTCTGGAGTGTCTGG - Intergenic
1124980334 15:34564052-34564074 TTTGCCCCCCATGGGATGTCTGG + Intronic
1127875074 15:63105045-63105067 TTATCACCCACTGGGGTGAGGGG - Intergenic
1128163183 15:65438123-65438145 TTATCCCCCACTGAGGCTTCAGG - Intergenic
1128587671 15:68864306-68864328 TTGTCCCCTACTGCAGTGTCTGG - Intronic
1131390322 15:92042852-92042874 GTTTCCACCCCTAGGGTGTCAGG + Intronic
1132673836 16:1113678-1113700 TGAGCCCCCACGGGGGTGTCTGG - Intergenic
1134508391 16:14825700-14825722 TGTTCACCCACTGGGATGTTAGG - Intronic
1134696087 16:16224465-16224487 TGTTCACCCACTGGGATGTTAGG - Intergenic
1134975740 16:18570223-18570245 TGTTCACCCACTGGGATGTTAGG + Intergenic
1135590683 16:23702918-23702940 TTTTCTCCCACGGTGGTCTCAGG - Intronic
1136180439 16:28548295-28548317 GTCTCCTCCACTGGGCTGTCTGG + Intergenic
1138423776 16:56916821-56916843 TTTTCACCCAATGGGCTCTCTGG + Intergenic
1138785035 16:59836124-59836146 TCTGCCCCTACTGGGGGGTCAGG + Intergenic
1139205131 16:65021342-65021364 TTTTCCCAGAATGGGGTCTCTGG + Intronic
1141450518 16:84097475-84097497 TCTCCCCTCACAGGGGTGTCAGG + Intronic
1144322938 17:14148179-14148201 TTTTCACCCAATGTGGTGACTGG - Intronic
1147422048 17:40326790-40326812 TTCTCCACCCCTGGGGTGTAGGG + Intronic
1148480748 17:47958084-47958106 TTTCCCCACTCTTGGGTGTCTGG + Intergenic
1149645565 17:58238925-58238947 TTTTCCCCCACAGTGGTGGGGGG - Intronic
1149669273 17:58391516-58391538 TTGGCCCCCACTGTGGTGACTGG - Intronic
1151988627 17:77559774-77559796 TTTTCCACCCCTGCGGTGTGTGG + Intergenic
1152688314 17:81705777-81705799 CTTTCCCCCACTGGGGAACCAGG + Intronic
1154365359 18:13703045-13703067 TTTTCCCAAAATGGGGTCTCTGG - Intronic
1157433076 18:47645869-47645891 GTTTCCCCTACTGGGATCTCTGG + Intergenic
1158067347 18:53426491-53426513 TTTTCCCCCACTGGTTGGCCTGG + Intronic
1166816467 19:45549304-45549326 ACTTCCCCCACTGCGGCGTCAGG - Intronic
925567457 2:5271677-5271699 TTTTCCTCCAGTGGGGAGCCAGG + Intergenic
926296865 2:11575261-11575283 GTTTCACCCACTGGTATGTCTGG - Intronic
927168821 2:20351200-20351222 TTTTCCCCCAACTGGGTGTGCGG + Intronic
928556009 2:32425912-32425934 CTTTCCCCCACAGCTGTGTCAGG + Intronic
935731294 2:106066313-106066335 TTTCCCCTCTCTGGGGTGTGAGG - Intronic
936160972 2:110084104-110084126 TTTTCCCCTCCTGGGGTTTGCGG - Exonic
936183691 2:110287250-110287272 TTTTCCCCTCCTGGGGTTTGCGG + Intergenic
937510626 2:122591130-122591152 TTTTCTCCCACAAGGATGTCTGG + Intergenic
938611355 2:132950558-132950580 TTTTCCCCAAAAGTGGTGTCGGG - Intronic
940015039 2:149095452-149095474 TTTTCCCCCACATGGGAGTTTGG + Intronic
945934090 2:215885752-215885774 TTTTACAGCACTGAGGTGTCTGG - Intergenic
948762757 2:240202938-240202960 TTTTCCCTCACTAGGGCCTCTGG + Intergenic
948922770 2:241073498-241073520 TCTTCCCACACCGGGGTGCCTGG - Intronic
1169986958 20:11455909-11455931 TTTTCCCTCACTTGAGTTTCTGG + Intergenic
1170244526 20:14205758-14205780 TTCTCCTACACTAGGGTGTCAGG - Intronic
1171268454 20:23793745-23793767 TTGTCCCCTCCTGGGATGTCTGG + Intergenic
1173073455 20:39792945-39792967 TTTGCCACCACTGGGGTGGCGGG + Intergenic
1173182073 20:40813215-40813237 CTTTCCCCCAGTGGGGTCCCAGG - Intergenic
1173979277 20:47210719-47210741 TTTTCTCCCAATGGGGTGGGTGG + Exonic
1174042872 20:47712508-47712530 ATTTCCCCAACTAGGGTGTGGGG + Intronic
1175385274 20:58590977-58590999 TTTTCCCACACGAGGGTATCAGG - Intergenic
1176338591 21:5622044-5622066 TTTTCCACCACCAGGGAGTCTGG + Intergenic
1176339999 21:5685117-5685139 TTTTCCACCACCAGGGAGTCTGG + Intergenic
1176472253 21:7117270-7117292 TTTTCCACCACCAGGGAGTCTGG + Intergenic
1176495814 21:7499048-7499070 TTTTCCACCACCAGGGAGTCTGG + Intergenic
1176504828 21:7639339-7639361 TTTTCCACCACCAGGGAGTCTGG - Intergenic
1177619943 21:23575854-23575876 TTTGCCCCCAATGAGGTATCGGG + Intergenic
1178074466 21:29002393-29002415 TTTTTCCCCACTGGGGCATTTGG - Intergenic
1178478176 21:32956048-32956070 CTTTCCCCCTCTGGGCTGTCAGG - Intergenic
1178704183 21:34859354-34859376 CTTTCCCCCAGGGGGATGTCAGG - Intronic
1178877286 21:36422880-36422902 GATTCCCACACTGGGGTTTCGGG + Intergenic
1179291534 21:40022138-40022160 TTTTCCCCTAGTGTGGTGCCTGG - Intronic
1179970053 21:44831177-44831199 TTTTCCCCCACAGGTGTCTGGGG - Intergenic
1180449013 22:15443387-15443409 TTGTCCCTCACTTAGGTGTCCGG + Intergenic
1182121807 22:27792409-27792431 TTTTCTACCACTGGGTTTTCTGG - Intronic
1182514124 22:30843302-30843324 TTTGCCACCAATGGGGTCTCTGG - Intronic
1184003843 22:41694606-41694628 GTTTCTCCCACTGTGGTGTCTGG - Exonic
1184644169 22:45887161-45887183 TTCACCCCCACTGGAGAGTCAGG + Intergenic
949111215 3:262883-262905 TTTGGCCCCACTAGGGTTTCTGG + Intronic
950275172 3:11654781-11654803 TCTTCTCTCACTGGGGTTTCAGG - Intronic
950723502 3:14900931-14900953 ATTTTCCCCACTGTAGTGTCAGG - Intronic
954325087 3:49859184-49859206 TTATGCCCCACTGGGATGTGGGG + Exonic
957201671 3:77143847-77143869 TTTTACCATACTGGTGTGTCAGG + Intronic
958584903 3:96074580-96074602 TTTTCCCCCTTTGGGGTGAGAGG + Intergenic
959087544 3:101867707-101867729 TTTTTCCCCAGTGGGCTATCAGG + Intergenic
963948458 3:151171569-151171591 GTTTCCCCGTCTGGGGTGTGTGG - Intronic
964873775 3:161342555-161342577 TGTACCCCCATTGGGGTGTTGGG - Intergenic
968566915 4:1317963-1317985 TTTTCCTCCACCTGGGTGTCAGG + Intronic
968582165 4:1400251-1400273 GTGTCCCCCACTTTGGTGTCAGG - Intergenic
969424524 4:7116368-7116390 TTAACCCCCACTGGGCTGTGTGG + Intergenic
969462511 4:7336223-7336245 CTCTCCCTCACTGGGGTTTCAGG + Intronic
970870527 4:20812016-20812038 TTTTCCCCCACTGGGGTGTCTGG + Intronic
973141354 4:46772276-46772298 TTGTCACGCACTGGGGTGTGGGG + Intronic
975608454 4:76179956-76179978 TTTTCCCCTTTTGTGGTGTCTGG - Intronic
983760237 4:171396253-171396275 TTATCCCTCAGTGGGGAGTCAGG - Intergenic
990594968 5:57303466-57303488 ATTTCCCCCACTAGTGTGTGTGG - Intergenic
991176188 5:63689727-63689749 TCTTCCTCCCCTGGGGTGTCAGG + Intergenic
991658025 5:68922594-68922616 TTGTCCCCCACTGGGTTGTTGGG + Intergenic
996726609 5:126678221-126678243 TTTTGCCACACTGGCGAGTCTGG - Intergenic
1001951129 5:175817454-175817476 TTTTCCCCCACTGGGGTCAGAGG + Intronic
1001990757 5:176113749-176113771 TTTTCCTGCACTGGCGTCTCTGG + Intronic
1001997708 5:176175241-176175263 TTTTGCTGCACTGGGGTCTCTGG - Intergenic
1002226117 5:177724391-177724413 TTTTCCTGCACTGGCGTCTCTGG - Intronic
1002267732 5:178046821-178046843 TTTTCCTGCACTGGCGTCTCTGG + Intronic
1002595313 5:180318217-180318239 TTTGGCCCCACTGGGGTGTGGGG + Intronic
1004032534 6:11884956-11884978 TTTTACCCCACTGTGGTGCTTGG - Intergenic
1010033010 6:71289211-71289233 ACTTGCCCCTCTGGGGTGTCGGG - Intronic
1015813914 6:137188070-137188092 TTTTCCCCCACTGGGGATTTGGG - Intergenic
1022232863 7:28430893-28430915 TCTTCCCCCACTGAGGTTTGAGG - Intronic
1023314659 7:38922940-38922962 ATTGCCCCCACTTAGGTGTCAGG + Intronic
1023623933 7:42097868-42097890 TTTTCCCTCCCTGGTATGTCTGG - Intronic
1023879808 7:44312011-44312033 GTTTCCCCCTCTGGGCTGTGGGG - Intronic
1027630581 7:80600028-80600050 TTTTTCCCCAATTGGTTGTCTGG - Intronic
1029574030 7:101391160-101391182 GTTTGCCTCTCTGGGGTGTCCGG + Intronic
1030640975 7:112006088-112006110 TTTTCCTACACTTGAGTGTCTGG - Intronic
1032257660 7:130310112-130310134 TTTTCCCCCAATGGTTTGTGTGG - Intronic
1033602196 7:142896523-142896545 TTTTTCCGCACTGGAGTGCCTGG + Intergenic
1035654167 8:1293066-1293088 TTCTCCCCCACTTGTGGGTCAGG - Intergenic
1036657739 8:10688733-10688755 TCTTCCCCCATGGGAGTGTCAGG + Intronic
1036793197 8:11737143-11737165 TTTCCCCTCTCGGGGGTGTCTGG - Intronic
1037822273 8:22140763-22140785 TTTCCCCCCACTGGGGTGCAAGG + Intronic
1041658806 8:60380530-60380552 TTTTCCTTCTCTGGGGGGTCTGG - Intergenic
1041773661 8:61499741-61499763 TTTTCCCCCAGTGAGGGGACTGG + Exonic
1049222993 8:141436346-141436368 TTTTCCTTCACTGGGGAATCTGG - Intergenic
1051417742 9:16860418-16860440 TTTTTCTCCATTGAGGTGTCTGG - Intronic
1051556605 9:18390685-18390707 TTTTCCTCCACTGGGAGGTGGGG - Intergenic
1054815889 9:69475173-69475195 CTTTCTCCCATTGAGGTGTCTGG - Intronic
1055735168 9:79320344-79320366 TTTTGCCAAACTGGAGTGTCTGG - Intergenic
1057471006 9:95356206-95356228 TTTTACTCTACTGGGGTTTCAGG + Intergenic
1058263745 9:102872284-102872306 TTTTCCCCCACTGTGAAGGCAGG + Intergenic
1059395038 9:114028833-114028855 TTTTCCCCGACTGGTTCGTCTGG - Intronic
1062710560 9:137972987-137973009 TTTTCCCACCCTTGGGGGTCAGG + Intronic
1203423068 Un_GL000195v1:12876-12898 TTTTCCACCACCAGGGAGTCTGG - Intergenic
1186784804 X:12947409-12947431 TTTTCACCTTCTGTGGTGTCAGG + Intergenic
1188385480 X:29552198-29552220 TTTTACCCCACTGTGTTGTTGGG + Intronic
1191008824 X:55739422-55739444 TCTGTCCCCACTGGGGTTTCAGG + Intronic
1193066817 X:77268774-77268796 TCTGCCCCTACTGGGGGGTCAGG - Intergenic
1194142150 X:90220320-90220342 TGTACCCCCACAGGGGTTTCAGG - Intergenic
1195124304 X:101790287-101790309 TTTTCCACCGATGGGGTGTGGGG - Intergenic
1195398339 X:104435179-104435201 TTTTCCCCAAGTGGGGTGAGGGG + Intergenic