ID: 970875067

View in Genome Browser
Species Human (GRCh38)
Location 4:20859689-20859711
Sequence CTTAAAATACAGTAGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 711
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 661}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970875066_970875067 -4 Left 970875066 4:20859670-20859692 CCTCTTTCTCACAACTTCTCTTA 0: 1
1: 0
2: 0
3: 45
4: 517
Right 970875067 4:20859689-20859711 CTTAAAATACAGTAGAAGCTTGG 0: 1
1: 0
2: 2
3: 47
4: 661

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970875067 Original CRISPR CTTAAAATACAGTAGAAGCT TGG Intronic
900272877 1:1802471-1802493 ATTAAAATACAATATAGGCTGGG + Intronic
901227667 1:7623657-7623679 CTGAAAATACAGAATTAGCTGGG - Intronic
901285648 1:8076582-8076604 CTAAAAATACAGAATTAGCTGGG + Intergenic
902355639 1:15897520-15897542 CTAAAAATACAATATTAGCTGGG - Intronic
902420133 1:16272418-16272440 CTTAAAATACAAAATTAGCTGGG - Intronic
902558769 1:17263073-17263095 CTAAAAATACAAAAGTAGCTGGG - Intronic
903089482 1:20898889-20898911 CTAAAAATACAAAATAAGCTGGG - Intronic
903434259 1:23334529-23334551 CTTTAAGTACACTAGAGGCTGGG - Intronic
903489103 1:23714370-23714392 CTAAAAATACAAAATAAGCTGGG + Intergenic
904080707 1:27871062-27871084 CTAAAAATACAAAAGTAGCTGGG - Intergenic
904086079 1:27909208-27909230 CTTAGAACACAGTAGACTCTTGG + Intronic
904238530 1:29129232-29129254 CTAAAAATACAGAAATAGCTGGG - Intergenic
904243561 1:29168325-29168347 TTTAAAATACAGTAGAAGGCCGG - Intronic
905052692 1:35065556-35065578 CTTTAAATACAGTTGACTCTTGG - Intronic
905624851 1:39482632-39482654 CTAAAAATACAGAATTAGCTGGG + Intronic
906030137 1:42712849-42712871 CTAAAAATACAGAATTAGCTGGG - Intergenic
906222462 1:44092179-44092201 CTTAAAATACAAAATTAGCTGGG + Intergenic
906314458 1:44777230-44777252 CTAAAAATACAGAAGCAGCCGGG - Intronic
906798480 1:48716126-48716148 TTTAAAATACAAAGGAAGCTTGG + Intronic
907071078 1:51535405-51535427 CTTTAAAGACAGAAGAAACTAGG - Intergenic
907141140 1:52186077-52186099 CTAAAAATACAGTATTAGCTGGG + Intronic
907207562 1:52786927-52786949 CTAAAAATACAATATTAGCTGGG + Intronic
908262259 1:62348283-62348305 CTAAAAATACAAAAGTAGCTGGG + Intergenic
910498622 1:87862802-87862824 ATAAAAATATAGTAGAAGCTTGG - Intergenic
911603509 1:99873593-99873615 CTAAAAATACAGAATTAGCTGGG - Intronic
912112980 1:106366542-106366564 TTTAAAATACATAAAAAGCTTGG - Intergenic
914818384 1:151080348-151080370 CTAAAAATACAATATTAGCTGGG + Intronic
915171295 1:153979385-153979407 CTAAAAATACAGAATTAGCTGGG + Intergenic
915241915 1:154529238-154529260 CTAAAAATACAAAAGTAGCTGGG - Intronic
915720035 1:157978238-157978260 CTTAAACAACAGTAGTGGCTGGG + Intergenic
916176440 1:162043429-162043451 CTAAAAATACAAAAGTAGCTGGG + Intergenic
916347580 1:163811303-163811325 CTAAAAATACAAAATAAGCTGGG + Intergenic
916567090 1:165990451-165990473 CTTAAAATACAAAATTAGCTAGG - Intergenic
916585054 1:166143192-166143214 ATTAATATATAGTAGAGGCTGGG + Intronic
917110129 1:171539160-171539182 CTAAAAATACAGAATCAGCTGGG - Intronic
917443345 1:175085711-175085733 CTAAAAATACAAAATAAGCTGGG + Intronic
917517904 1:175723083-175723105 ATTAAAATATATTAGAGGCTGGG - Intronic
917763717 1:178194460-178194482 CTGGAAGTACAGGAGAAGCTTGG + Intronic
917780338 1:178388499-178388521 TTTAAAATACAGTAGTAGTATGG + Intronic
918783829 1:188737742-188737764 TTTAAAATACAGTTGACCCTTGG + Intergenic
919035281 1:192299658-192299680 CTTAAAACACAGTAGTAAATTGG - Intergenic
919081525 1:192872093-192872115 CTCAAAATAAAGCAGGAGCTGGG + Intergenic
919169601 1:193937456-193937478 CTTGAAAGAGAGAAGAAGCTTGG - Intergenic
919328223 1:196136388-196136410 TTTAAAATACATTAGAATTTTGG + Intergenic
919687150 1:200494572-200494594 TTTAAAGTACACTACAAGCTGGG - Intergenic
919865119 1:201775759-201775781 TTTAAAATATGGTAGAAGCCTGG + Intronic
920266707 1:204729559-204729581 TTTAAATTACAGTGGAAGCATGG - Intergenic
920611693 1:207445578-207445600 TTTATAATTCAGCAGAAGCTAGG + Intergenic
921010842 1:211139450-211139472 CTAAAAATACAATATTAGCTGGG + Intergenic
922371833 1:224918995-224919017 CTCAAAATTCAGAAGAAGCCAGG - Intronic
922418577 1:225443982-225444004 CTAAAAATACAGAATTAGCTTGG - Intergenic
923871144 1:237995435-237995457 CTTAAAATACAAAATTAGCTGGG - Intergenic
924326955 1:242905043-242905065 GTTAAAAAACAGTAGAGGCTGGG + Intergenic
924555797 1:245117582-245117604 CTAAAAATACAGAATTAGCTGGG - Intronic
924675409 1:246171712-246171734 ATAAAAATACAGTATAAGGTTGG + Intronic
1062879418 10:966121-966143 CTAAAAAGACAGTAGAGGCAAGG + Intergenic
1063259253 10:4366618-4366640 CTCAAAATATATTAGAGGCTGGG - Intergenic
1064269697 10:13853670-13853692 CTAAAAATACAAAAGTAGCTGGG + Intronic
1064577417 10:16760346-16760368 CTAAAAATACAAAAGTAGCTGGG + Intronic
1064828866 10:19439233-19439255 GTTAAAAGAGAGAAGAAGCTGGG + Intronic
1065791798 10:29267237-29267259 CCTAAAAAACAGGAGAAGCAGGG + Intergenic
1067012643 10:42728802-42728824 CTAAAAATACAAAAGTAGCTGGG - Intergenic
1067202167 10:44182486-44182508 CTAAAAATACAGAATTAGCTGGG + Intergenic
1067310948 10:45113066-45113088 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1067371258 10:45684890-45684912 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1067388525 10:45841261-45841283 CTAAAAATACAAAAGTAGCTGGG - Intronic
1067417539 10:46115699-46115721 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1067502954 10:46822582-46822604 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1068279692 10:54853097-54853119 CTAAAAATACAAAAGTAGCTGGG + Intronic
1069455469 10:68550565-68550587 CTAAAAATACAAAAGTAGCTGGG - Intergenic
1069983624 10:72269239-72269261 CTCAAAATACAAAATAAGCTGGG + Intergenic
1070155769 10:73834211-73834233 CTTAAAACCCAGTAGAAGCTGGG - Intronic
1070283635 10:75068173-75068195 TTTAAAATACAGTAAAGGCTGGG + Intergenic
1070538335 10:77396278-77396300 CCTAAAATATAATAAAAGCTGGG + Intronic
1070846765 10:79529207-79529229 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1070927032 10:80231060-80231082 CTAAAAATACAAAAGTAGCTGGG - Intergenic
1071050896 10:81448097-81448119 CTAAAAATACAAAATAAGCTGGG - Intergenic
1072103432 10:92251024-92251046 GTAAAAATACAGTATAGGCTGGG - Intronic
1072322123 10:94260822-94260844 CTAAAAATAAAGTCTAAGCTGGG - Intronic
1072668257 10:97410257-97410279 CTAAAAATACAAAATAAGCTAGG + Intronic
1073011812 10:100365983-100366005 GATAAAATATAGTAAAAGCTAGG - Intergenic
1073172189 10:101519832-101519854 CTAAAAATACAGAATTAGCTGGG + Intronic
1073406476 10:103302323-103302345 CTAAAAATACAAAAGTAGCTGGG - Intergenic
1073674902 10:105634861-105634883 CTTAGCATACATAAGAAGCTTGG + Intergenic
1074067389 10:110029038-110029060 CTAAAAATACAAAAGTAGCTGGG - Intronic
1074362047 10:112831500-112831522 CTTAAAATAGGGGAGAATCTTGG - Intergenic
1074521493 10:114228920-114228942 CTTAAAATACAAAATTAGCTGGG + Intronic
1074728532 10:116342565-116342587 CTAACAATCCAGGAGAAGCTAGG + Intronic
1076391118 10:130103137-130103159 CTAAAAATACAGAATTAGCTGGG - Intergenic
1076989430 11:263107-263129 CTTAAAATACAAAATTAGCTGGG + Intergenic
1079112935 11:17615765-17615787 CTAAAAATACAAAATAAGCTGGG + Intronic
1079563057 11:21847089-21847111 ATTAAAATACAGGTTAAGCTTGG - Intergenic
1079812278 11:25010089-25010111 TTTAAAAAACAGTGTAAGCTAGG - Intronic
1079929613 11:26541681-26541703 CTTAAAGTAAAGTAGACTCTAGG - Intronic
1081101881 11:39012464-39012486 CTTAAAATACAAAATTAGCTGGG - Intergenic
1082059420 11:47847912-47847934 CGTAAAATACAGTGAAAGCGCGG - Exonic
1082226073 11:49708777-49708799 CTTAAAATTCAGGAGAACTTTGG + Intergenic
1082938441 11:58678440-58678462 CAGAAATTACAGTAGAAACTGGG - Intronic
1083653397 11:64217386-64217408 CTAAAAATACAAAAGTAGCTGGG + Intronic
1083859904 11:65414583-65414605 CTAAAAATACAATATTAGCTAGG + Intergenic
1084135701 11:67179432-67179454 CTAAAAATACAAAATAAGCTGGG - Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084950898 11:72664965-72664987 CTAAAAATACAGAATTAGCTGGG - Intronic
1086454393 11:86947040-86947062 CTAAAAATACAGAAGTAGCTGGG + Exonic
1086623020 11:88910962-88910984 CTTAAAATTCAGGAGAACTTTGG - Intronic
1087340034 11:96892816-96892838 CTAAAAATACAAAATAAGCTGGG + Intergenic
1087822668 11:102729685-102729707 CTGAAAATACAAAATAAGCTGGG + Intergenic
1089451548 11:118601355-118601377 ATTAAAATAAAGGAGCAGCTGGG - Exonic
1089717126 11:120371325-120371347 CTAAAAATACAGAATTAGCTGGG + Intronic
1089778017 11:120852642-120852664 CTTTGAAGACAGTAGCAGCTGGG - Intronic
1091440321 12:507782-507804 CTGGAAATCCAGTAGTAGCTTGG + Intronic
1091440327 12:507818-507840 CTGGAAATCCAGTAGTAGCTTGG + Intronic
1091440344 12:507890-507912 CTGGAAATCCAGTAGTAGCTTGG + Intronic
1091440352 12:507926-507948 CTGGAAATCCAGTAGTAGCTTGG + Intronic
1091440360 12:507962-507984 CTGGAAATCCAGTAGTAGCTTGG + Intronic
1091740356 12:2956836-2956858 CTAAAAATACAATATTAGCTGGG - Intergenic
1091932297 12:4405681-4405703 TTTAAAATACCGTACATGCTGGG - Intergenic
1092702134 12:11243695-11243717 CTTTAAAGAAAGTAGAATCTGGG + Intergenic
1093145231 12:15557328-15557350 ATTAAAAAAAAGAAGAAGCTAGG - Intronic
1093475795 12:19552991-19553013 CTTAAAATACAAAATTAGCTGGG - Intronic
1094151392 12:27288041-27288063 CTAAAAATACAGAATTAGCTGGG - Intronic
1094532574 12:31290878-31290900 CTAAAAATACAATATTAGCTGGG - Intronic
1094769920 12:33644040-33644062 CTTAATATACAATGGAAGGTGGG + Intergenic
1095050675 12:37551534-37551556 CTAAAAATACAGAAGTAGCCAGG + Intergenic
1095462340 12:42456094-42456116 CTAAAAATACAAAATAAGCTGGG + Intronic
1095769702 12:45939535-45939557 CTAAAAATACAAAAGTAGCTGGG + Intronic
1096169667 12:49457592-49457614 CTAAAAATACAGAATTAGCTGGG - Intronic
1096300659 12:50424517-50424539 CTTAAAATACAAAATCAGCTGGG - Intronic
1096973903 12:55687649-55687671 CTTAAAATACAAAATTAGCTGGG - Intronic
1097111186 12:56659466-56659488 CTAAAAATACAATATTAGCTGGG + Intergenic
1098941622 12:76543165-76543187 CTGAAAATTCAGTAGGAGCTAGG - Intronic
1099281493 12:80654253-80654275 CTTAAAATACAAAATTAGCTGGG - Intronic
1099690259 12:85943086-85943108 CTAAAAATACAAAAGTAGCTAGG + Intergenic
1099707210 12:86171206-86171228 CTAAAAATACAAAATAAGCTGGG + Intronic
1100474012 12:94919023-94919045 CTAAAAATACAAAATAAGCTGGG - Intronic
1101230255 12:102733580-102733602 CTAAAAATACAAAAGAAGCCAGG + Intergenic
1102095610 12:110238295-110238317 CTTAAAATACAAAATTAGCTGGG - Intergenic
1102334308 12:112064871-112064893 CTAAAAATACAGAATTAGCTGGG + Intronic
1102661472 12:114532543-114532565 TTTAAAAGCCAGTAGAATCTAGG - Intergenic
1102875145 12:116443445-116443467 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1103355449 12:120316481-120316503 CTAAAAATACAGAATTAGCTGGG + Intergenic
1103384414 12:120520751-120520773 GTTAAATTACATTAGAGGCTGGG - Intronic
1103709979 12:122905273-122905295 TTAAAAATACAGCAGAGGCTGGG - Intergenic
1103777130 12:123374415-123374437 CTAAAAATACAGAATTAGCTGGG + Intergenic
1104032723 12:125076900-125076922 TTTAAAATAAAGTTGAGGCTGGG + Intronic
1105058791 12:133129338-133129360 CTAAAAATACAGAATTAGCTGGG + Intronic
1105333907 13:19445778-19445800 CTAAAAATACAAAAGTAGCTGGG + Intronic
1105756938 13:23474599-23474621 CTAAAAATACAGAATTAGCTGGG + Intergenic
1107498534 13:40953135-40953157 CTGAAAATACAGAATTAGCTGGG - Intronic
1108345648 13:49544172-49544194 TTTAAAAAACAATATAAGCTGGG + Intronic
1109166946 13:59047256-59047278 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1109848025 13:68022827-68022849 CTTAAAATACAGTCGAACTGAGG + Intergenic
1110061466 13:71043659-71043681 ATAAAAATACAGTAGAAGGATGG + Intergenic
1110360753 13:74622222-74622244 GTATAAATACATTAGAAGCTAGG + Intergenic
1110423879 13:75343675-75343697 CTAAAAATACAAAAGTAGCTGGG - Intronic
1110944707 13:81397625-81397647 CTAAAAATACAGAATTAGCTGGG + Intergenic
1111470197 13:88671019-88671041 CATAAAATACTGTAAAAACTTGG + Intergenic
1111591544 13:90353818-90353840 CTAAAAATACAGAATTAGCTGGG + Intergenic
1112188505 13:97151288-97151310 TTTAAAATACAGTAAAACCCTGG + Intergenic
1112524838 13:100135036-100135058 CTAACAAAACAGTACAAGCTGGG - Intronic
1112556064 13:100469613-100469635 CTAAAAATACAGTATTAGCTGGG + Intronic
1112871385 13:103975089-103975111 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1113136687 13:107098206-107098228 CTTAAAACACAGCAGAACCAAGG + Intergenic
1113141597 13:107158262-107158284 CTAAAAATACAGAATTAGCTGGG + Intergenic
1113430948 13:110249786-110249808 CTTAAAAAACAGTAAAATATAGG + Intronic
1113491302 13:110694185-110694207 CTAAAAATACAGAATTAGCTGGG - Intronic
1114310015 14:21457827-21457849 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1115179413 14:30605055-30605077 CTGAAAATACAAAATAAGCTGGG - Intronic
1115583958 14:34790959-34790981 CTAAAAATACAATATTAGCTGGG + Intronic
1116720297 14:48487502-48487524 CTTAACATCCAGTTGAAGATAGG - Intergenic
1116823368 14:49647292-49647314 CTAATAAGACAGTAGAAGATAGG - Exonic
1116925825 14:50635868-50635890 CTAAAAATACAGAAGTAGCTGGG - Intronic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1118977202 14:70688025-70688047 CTTAAAATACAAAATTAGCTGGG + Intergenic
1119580285 14:75772826-75772848 CTTAAAATACAAAATTAGCTAGG - Intronic
1119986892 14:79148402-79148424 CTTACAATACAACAGCAGCTTGG - Intronic
1120752660 14:88212277-88212299 CTAAAAATACAGAATTAGCTGGG + Intronic
1120795628 14:88630189-88630211 CTAAAAATACAGAATTAGCTAGG - Intronic
1120898522 14:89556240-89556262 CTAAAAATACAATATTAGCTGGG + Intronic
1120899663 14:89564931-89564953 CTAAAAATACAATATTAGCTGGG + Intronic
1120924931 14:89788322-89788344 CTAAAAATACAGAATTAGCTGGG + Intergenic
1120924956 14:89788456-89788478 CTAAAAATACAGAATTAGCTGGG + Intergenic
1121910934 14:97791839-97791861 CTAAAAATACAGAATTAGCTGGG + Intergenic
1122185023 14:99985604-99985626 CTTAAAATACAAGATTAGCTGGG + Intronic
1122290267 14:100677038-100677060 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1122731347 14:103801009-103801031 CTAAAAATACAGAATTAGCTGGG - Intronic
1122750684 14:103930346-103930368 CTAAAAATACAAAATAAGCTGGG - Intronic
1202891518 14_KI270722v1_random:163554-163576 CTAAAAATACAAAAAAAGCTGGG + Intergenic
1123469945 15:20542340-20542362 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1123648110 15:22458341-22458363 CTAAAAATACAAAAGTAGCTGGG - Intergenic
1123730239 15:23137362-23137384 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1123748377 15:23334772-23334794 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1123795920 15:23769885-23769907 CTTAAAATACAAAATTAGCTGGG - Intergenic
1124280755 15:28358659-28358681 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1124301949 15:28552970-28552992 CTAAAAATACAAAAGTAGCTGGG - Intergenic
1124910339 15:33914232-33914254 ATAAACATACAGTAGCAGCTAGG + Intronic
1125405331 15:39347171-39347193 CTAAAAATACAGCAGTAGCCAGG + Intergenic
1126120540 15:45247633-45247655 CTAAAAATACAAAATAAGCTGGG - Intergenic
1126131148 15:45342850-45342872 CTTAAAATACAAAATTAGCTGGG + Intergenic
1126456225 15:48865057-48865079 CCTAAAACGCAGTAGATGCTTGG - Intronic
1126650773 15:50919369-50919391 CTAAAAATACAGAATTAGCTGGG + Intronic
1126759807 15:51959344-51959366 CTTGAAATAAAGTACAAGCAAGG + Intronic
1126768535 15:52032843-52032865 CTAAAAATACAGAATTAGCTGGG - Intronic
1126799687 15:52287813-52287835 CTAAAAATACAAAAGTAGCTGGG + Intronic
1127184089 15:56459827-56459849 CTAAAAATACAGAATTAGCTGGG + Intronic
1127446264 15:59066447-59066469 CTAAAAATACAAAATAAGCTGGG + Intronic
1128031161 15:64481479-64481501 CTAAAAATACAGAATTAGCTAGG - Intronic
1128066680 15:64769262-64769284 CTAAAAATACAGAATTAGCTGGG + Intronic
1128204512 15:65838868-65838890 CTAAAAATACAGAATTAGCTAGG - Intronic
1129774312 15:78225102-78225124 TTTAAAATACAGTTTTAGCTAGG + Intronic
1130635888 15:85619502-85619524 CTTAAAAAAAAGTAGAAGCTGGG - Intronic
1131246713 15:90800517-90800539 CTAAAAATACAAAATAAGCTGGG + Intronic
1132174170 15:99695696-99695718 CTAAAAATACAGAATTAGCTGGG + Intronic
1133068158 16:3225282-3225304 CTAAAAATACAAAATAAGCTGGG + Intronic
1133931093 16:10232672-10232694 CTTAAAATTCAGGAGACTCTGGG + Intergenic
1134225236 16:12385007-12385029 CTAAAAATACAAAAGTAGCTGGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134539265 16:15051676-15051698 TTAAAAATAAAGTAGAGGCTGGG - Intronic
1134559110 16:15192477-15192499 CTTAAAACAGAGTTGAAACTTGG - Intergenic
1134919646 16:18104090-18104112 CTTAAAACAGAGTTGAAACTTGG - Intergenic
1135026748 16:19004658-19004680 GTTAAAATACCGTATAAGCTGGG - Intronic
1135375885 16:21946956-21946978 CTTCACATACAGTTGAATCTGGG - Intergenic
1135389717 16:22080504-22080526 CTAACAATACAGTAAAAGCTAGG - Intronic
1135561991 16:23483806-23483828 CTAAAAATACAGTATCAGCCGGG - Intronic
1135984097 16:27171002-27171024 ATTAAAGTACAGTTGAGGCTGGG - Intergenic
1136095404 16:27952064-27952086 CTTAAAATACAGTTCAACCCAGG + Intronic
1136102332 16:28005272-28005294 CTAAAAATACAGAATTAGCTGGG - Intronic
1136174981 16:28510434-28510456 CTAAAAATACAGACCAAGCTCGG - Intronic
1136378486 16:29879384-29879406 CTTAAAATACAAAATTAGCTGGG - Intronic
1138058469 16:53861954-53861976 CTTAAAACTCTGTAGAGGCTGGG + Intronic
1138668460 16:58593396-58593418 CTAAAAATACAGTATTAGCTAGG + Intronic
1139747638 16:69087331-69087353 CTGAAAAAGCAGTTGAAGCTTGG - Intergenic
1139813261 16:69641737-69641759 TTTAAAATACAGTTTAAGCAAGG + Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141592932 16:85080631-85080653 CTAAAAATACAAAATAAGCTGGG + Intronic
1142428380 16:90012618-90012640 CTAAAAATACAGAATTAGCTGGG - Intronic
1142479689 17:211442-211464 CTAAAAATACAGAATTAGCTGGG + Intergenic
1142725015 17:1807049-1807071 CTAAAAATACAGAATAAGCTGGG - Intronic
1142969073 17:3599076-3599098 CTAAAAATACAGAATTAGCTGGG + Intergenic
1143139007 17:4730198-4730220 CTAAAAATACAGAATTAGCTGGG - Intergenic
1145716411 17:27027291-27027313 CTAAAAATACAATATTAGCTGGG - Intergenic
1145743768 17:27297810-27297832 CTTAAAATACAGTCTAGGCTGGG + Intronic
1145763491 17:27441732-27441754 CTAAAAATACAAAATAAGCTGGG + Intergenic
1146217935 17:30993498-30993520 CTTAAAATTCACTAGGGGCTCGG - Intronic
1146391191 17:32424733-32424755 CTAAAAATACAGAATTAGCTGGG + Intergenic
1147047093 17:37760885-37760907 CTTAATAGACAGTTGAAGCTGGG - Intergenic
1147117975 17:38316645-38316667 CTAAAAATACAAAAAAAGCTGGG + Intronic
1147275602 17:39313794-39313816 CTTAAAATACAAAATTAGCTGGG - Intronic
1147287280 17:39412387-39412409 CTAAAAATACAGAATTAGCTGGG - Intronic
1147356238 17:39899821-39899843 CTAAAAATACAGAATTAGCTGGG - Intergenic
1148501123 17:48092149-48092171 CTAAAAATACAAAAGTAGCTGGG - Intronic
1148608750 17:48949775-48949797 CTAAAAATACAGAATTAGCTGGG - Intergenic
1149101047 17:52907719-52907741 CTAAAAGTCCAGTAAAAGCTGGG - Intergenic
1149465490 17:56875547-56875569 CTTATGATACAATAAAAGCTAGG - Intergenic
1149673741 17:58439643-58439665 CTGAAAATACAGAATTAGCTGGG - Intronic
1149824385 17:59814139-59814161 CTAAAAATACAGAATTAGCTGGG - Intronic
1150067519 17:62124006-62124028 CTAAAAATACAAAAGTAGCTGGG - Intergenic
1150408468 17:64922385-64922407 CTAAAAATACAAAAAAAGCTGGG - Intergenic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150536562 17:66048768-66048790 CTAAAAATACAGAATTAGCTGGG - Intronic
1150730418 17:67688175-67688197 CTTAAAATACAAAATTAGCTGGG + Intronic
1150795571 17:68234168-68234190 CTTAAAATACAAAATTAGCTGGG + Intergenic
1150799553 17:68269832-68269854 CTAAAAATACAAAAGTAGCTGGG - Intronic
1150913093 17:69409689-69409711 CTAAAAATACAAAATAAGCTGGG + Intergenic
1151592599 17:75055670-75055692 CTAAAAATACAAAAGTAGCTGGG + Intronic
1151621573 17:75248623-75248645 CTAAAAATACAGAATTAGCTGGG + Intronic
1151632777 17:75322209-75322231 CTAAAAATACAAAAGTAGCTGGG + Intronic
1152441153 17:80310711-80310733 CTAAAAATACAGAATTAGCTGGG - Intronic
1153205355 18:2693790-2693812 CTTAAAATACAAAAGTAGCCAGG - Intronic
1154222394 18:12467786-12467808 CTAAAAATACAAAATAAGCTGGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1158459537 18:57634094-57634116 CTAAAAATACAAAATAAGCTGGG - Intergenic
1158476217 18:57782010-57782032 TTTAAAATACAGTAAATGCCAGG + Intronic
1158578751 18:58662863-58662885 CCAAAAATATAGAAGAAGCTGGG + Intergenic
1159784131 18:72693686-72693708 CTTAAAATACAAAATTAGCTAGG + Intergenic
1160030357 18:75251886-75251908 CTTAAAAGACAACAGAAGGTGGG - Intronic
1161114736 19:2490282-2490304 CTAAAAATACAATACAAGCTGGG - Intergenic
1161489030 19:4551666-4551688 CTAAAAATACAAAATAAGCTGGG + Intronic
1161790819 19:6358770-6358792 CTTAAAATACAAAATTAGCTGGG + Intergenic
1161810639 19:6469190-6469212 CTAAAAATACAGAATTAGCTGGG - Intronic
1162057014 19:8070859-8070881 CTAAAAATACAGAATTAGCTGGG + Intronic
1162353222 19:10164302-10164324 CTAAAAATACAGAATTAGCTGGG - Intronic
1162523749 19:11196217-11196239 CTAAAAATACAGAATTAGCTAGG - Intronic
1162603571 19:11689425-11689447 CTAAAAATACAGAATTAGCTGGG + Intergenic
1162882839 19:13672981-13673003 CTAAAAATACAGAATTAGCTGGG - Intergenic
1163948249 19:20560617-20560639 CTAAAAATACAGAATTAGCTGGG + Intronic
1163997726 19:21067761-21067783 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1164058429 19:21643215-21643237 CTAAAAATACAATATTAGCTAGG - Intergenic
1164169571 19:22713046-22713068 CTAAAAATACAGCATTAGCTGGG + Intergenic
1164208776 19:23079316-23079338 CTAAAAATACAAAATAAGCTGGG - Intronic
1165527467 19:36368305-36368327 CTAAAAATACAGAATTAGCTGGG + Intronic
1165621888 19:37255028-37255050 CTAAAAATACAAAAGTAGCTGGG - Intergenic
1165809288 19:38601108-38601130 CTAAAAATACAAAAGAAGCTAGG - Intronic
1166527622 19:43522640-43522662 CTAAAAATACAAAATAAGCTGGG - Intronic
1166776698 19:45317446-45317468 CTAAAAATACAGAATTAGCTGGG - Intronic
1166823481 19:45595113-45595135 CTAAAAATACAAAATAAGCTAGG + Intronic
1167165102 19:47793825-47793847 CTAAAAATACAAAAAAAGCTGGG - Intergenic
1167270935 19:48505698-48505720 CTAAAAATACAAAATAAGCTGGG + Intronic
1167316311 19:48765175-48765197 CTAAAAATACAAAAGTAGCTTGG + Intergenic
1167582112 19:50351183-50351205 CTAAAAATACAATATTAGCTGGG + Intronic
1167763775 19:51465709-51465731 CTAAAAATACAGAATTAGCTGGG + Intergenic
1168007071 19:53498726-53498748 CTAAAAATACAATATCAGCTGGG + Intergenic
1168015628 19:53570691-53570713 CTTAAAATACAAAATTAGCTGGG - Intronic
1168054322 19:53853381-53853403 CTAAAAATACAGAATTAGCTGGG - Intergenic
1168128752 19:54303143-54303165 CTAAAAATACAGTATTAGCCAGG - Intergenic
1168289372 19:55349964-55349986 CTAAAAATACAAAATAAGCTGGG + Exonic
1168299396 19:55395295-55395317 CTTAAAATACAAAATTAGCTGGG - Intronic
1168333588 19:55584284-55584306 CTAAAAATACAAAATAAGCTGGG - Intergenic
1168395397 19:56043258-56043280 ATAAAAAAACAGTAGATGCTGGG - Intronic
1168594697 19:57665754-57665776 CTAAAAATACAAAATAAGCTGGG + Intergenic
924997539 2:376277-376299 CTAAAAATAAAGTGAAAGCTTGG + Intergenic
926374804 2:12215902-12215924 CTAAAAATACAGAATCAGCTGGG - Intergenic
926607899 2:14915721-14915743 CTAAAAATACAAAATAAGCTGGG - Intergenic
927316702 2:21691412-21691434 CTTCAGACACAGGAGAAGCTAGG + Intergenic
927418901 2:22908797-22908819 CTAAAAATACAAAAGTAGCTGGG - Intergenic
927557391 2:24045438-24045460 CTAAAAATACAATATTAGCTGGG + Intronic
927628356 2:24747943-24747965 CTAAAAATACAAAAGTAGCTGGG + Intronic
927714805 2:25344566-25344588 CTTAAAATACAAAATTAGCTGGG + Intergenic
928289032 2:30021222-30021244 CTAAAAATACAAAAAAAGCTGGG - Intergenic
928552237 2:32383825-32383847 CTTAAAATACAGCACCAGCTGGG - Intronic
929134430 2:38609535-38609557 CTAAAAATACAAAAGTAGCTGGG + Intergenic
929142989 2:38682733-38682755 CTAAAAATACAACATAAGCTGGG + Intronic
929327108 2:40628394-40628416 ATTGACATACAGTAGTAGCTCGG + Intergenic
929463670 2:42125692-42125714 CTTAAAATACAGGAAAAAATTGG - Intergenic
929504507 2:42517888-42517910 AAGAAAATACAGTAGAGGCTGGG + Intronic
929633515 2:43492015-43492037 TTTAAGATACAGAAGAGGCTGGG + Intronic
930787907 2:55289136-55289158 CCTAAAATACAGAACATGCTGGG - Exonic
931101561 2:59007619-59007641 CTTAAAATACTCTAGAAGTAGGG + Intergenic
931294820 2:60911835-60911857 CTTAAAATACAAAATTAGCTGGG + Intronic
931563892 2:63593253-63593275 CTAAAAATACAGAATTAGCTGGG - Intronic
931729228 2:65138363-65138385 CTAAAAATACAATACTAGCTGGG + Intergenic
932601662 2:73131404-73131426 CTTAAAATACAATTGCAGCCTGG + Intronic
932893871 2:75619769-75619791 CTAAAAATACAAAAGTAGCTGGG - Intergenic
933068189 2:77825027-77825049 CTTAAGATATAGTAGAAGGATGG - Intergenic
933433759 2:82218182-82218204 CTGAAATTACAGTACAAGGTGGG + Intergenic
933575821 2:84066210-84066232 CTAGAATTACATTAGAAGCTGGG + Intergenic
936078915 2:109419003-109419025 CTTAAAAAACCCTTGAAGCTTGG + Intronic
936656476 2:114493882-114493904 CTAAAAATTCAGTAGAGGCCAGG - Intronic
936704698 2:115058323-115058345 CTAAAAGAGCAGTAGAAGCTGGG - Intronic
937041844 2:118828177-118828199 CCAAAAATACAGAAAAAGCTGGG + Intergenic
937395094 2:121528250-121528272 AATAAAGGACAGTAGAAGCTGGG + Intronic
937642641 2:124230825-124230847 TTTAAAACACATTAGAGGCTGGG - Intronic
938614016 2:132979081-132979103 CTGGAAATTCAGTGGAAGCTTGG - Intronic
938917672 2:135959228-135959250 CTAAAAATACAAAAGTAGCTGGG + Intronic
939766753 2:146260203-146260225 CTAAATATAAAGAAGAAGCTGGG - Intergenic
940492019 2:154374763-154374785 TTCAAAGTACAGTATAAGCTGGG - Intronic
940740656 2:157503675-157503697 CTTAAAATGCATTATAACCTGGG - Intergenic
941150414 2:161907667-161907689 ATAAAAATGCAGTAGAAGTTAGG + Intronic
941202775 2:162533526-162533548 TTTAAGATACAGTAGAATTTAGG + Intronic
941504751 2:166328407-166328429 TTTCAAATACAGTAGAGGGTGGG - Intronic
941747058 2:169098087-169098109 TTTAAAATACATGAGAAGGTGGG + Intergenic
941889480 2:170563877-170563899 CTTTATCTACAGAAGAAGCTGGG + Intronic
942583910 2:177453430-177453452 CTAAAAATATAGTATTAGCTGGG - Intronic
942659509 2:178249233-178249255 TAAAAAATACAATAGAAGCTGGG - Intronic
943693413 2:190893878-190893900 CTAAAAATGCATTTGAAGCTGGG - Intronic
943816216 2:192259038-192259060 CAAATAATCCAGTAGAAGCTGGG - Intergenic
944718946 2:202403842-202403864 CTAAAAATACAAAAGTAGCTGGG + Intronic
944985373 2:205170089-205170111 CTTAAAATACAAAATTAGCTGGG - Intronic
945822056 2:214676074-214676096 ATTAAAATACAGTGGGGGCTGGG + Intergenic
946132956 2:217621877-217621899 CTGTAAATGCAGTGGAAGCTGGG + Intronic
946223920 2:218252060-218252082 CTAAAAATACAGAATTAGCTAGG + Intronic
947814992 2:233030765-233030787 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1169148658 20:3271780-3271802 CTAAAAATACAAAATAAGCTGGG - Intronic
1169373481 20:5046624-5046646 CTAAAAATACAGAATTAGCTGGG + Intergenic
1169441263 20:5635828-5635850 CTAAAAATACAGAATTAGCTGGG + Intergenic
1169608555 20:7352090-7352112 CTTGGTATACAGTAGATGCTAGG + Intergenic
1170055710 20:12200521-12200543 CTTAAAATACAAAATTAGCTGGG + Intergenic
1171005426 20:21460885-21460907 CTGAAAATACAAAAGTAGCTGGG + Intergenic
1171545185 20:25995002-25995024 CTAAAAATACAGAAGTAGCCAGG + Intergenic
1171940510 20:31324366-31324388 TTAAAAATAAATTAGAAGCTTGG + Intergenic
1172086910 20:32392441-32392463 CTAAAAATACAGAATTAGCTGGG - Intronic
1173054024 20:39594037-39594059 CTTAAATTACAGTTGATTCTAGG + Intergenic
1173695276 20:45005348-45005370 TTTAAAAAACATTAGCAGCTGGG + Intronic
1174256425 20:49258940-49258962 CTAAAAATACAAAATAAGCTGGG + Intronic
1174608575 20:51780093-51780115 CTAAAAATACAAAAGTAGCTGGG - Intergenic
1175441356 20:58994400-58994422 CTAAAAATACAGCATTAGCTGGG + Intronic
1176422991 21:6531364-6531386 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1177150864 21:17454349-17454371 CTGAAAATACAGTGGAATCAAGG - Intergenic
1177184476 21:17778648-17778670 CTAAAAATACAAAAGTAGCTGGG - Intergenic
1177728999 21:25004276-25004298 CTAAAAATACAATATTAGCTGGG + Intergenic
1177793714 21:25749668-25749690 CTAAAAATACAGAATAAGCTGGG + Intronic
1177996013 21:28098720-28098742 CTGAAAATACAAAAGTAGCTGGG - Intergenic
1178285401 21:31321511-31321533 CTAAAAATACAATATTAGCTGGG - Intronic
1178285424 21:31321644-31321666 TTTAAAACACAGAAGAGGCTGGG - Intronic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179367760 21:40773932-40773954 TTGAAGACACAGTAGAAGCTGGG + Intronic
1179698485 21:43139681-43139703 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1180891020 22:19289142-19289164 CTAAAAATACAGTATTAGCCGGG - Intronic
1181091163 22:20473573-20473595 TTTAAAATACAGTATAGGTTAGG + Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182633242 22:31703956-31703978 CTAAAAATACAGAATTAGCTGGG - Intronic
1183053831 22:35288688-35288710 TTTAAAATGCAGTGGAGGCTGGG + Intronic
1184018992 22:41807997-41808019 CTGAAAATACAGAATTAGCTGGG + Intronic
1184539312 22:45109614-45109636 CTAAAAATACAGAATTAGCTGGG - Intergenic
1184845391 22:47080957-47080979 CTAAAAATACAATATTAGCTGGG + Intronic
949152511 3:787155-787177 GTTAAAATAAAGTAGACCCTTGG - Intergenic
949253505 3:2017081-2017103 TTTAAAGTACAGTAGTTGCTAGG - Intergenic
949479834 3:4483098-4483120 TTTAAAATGCAATAGAGGCTGGG - Intergenic
949615463 3:5749054-5749076 CTTAAAATACTTTAAAAGTTTGG - Intergenic
949711871 3:6880223-6880245 CATAAAATAAAGTAGAATTTGGG - Intronic
950541047 3:13613350-13613372 TTTAAAATACAGTAGTATTTTGG - Intronic
950565208 3:13765495-13765517 CTAAAAATACAAAAGTAGCTGGG + Intergenic
950802018 3:15560253-15560275 CTGAAAATACAGAATTAGCTGGG - Intergenic
951725422 3:25752538-25752560 ATTAAAATAAAGAAGAAGCCAGG + Intronic
951927606 3:27925501-27925523 CTAAAAATACAAAAGTAGCTGGG - Intergenic
953329609 3:42041951-42041973 CTAAAAATACAAAAGTAGCTGGG - Intronic
953611713 3:44452526-44452548 CTTAAAAGACAGTGGGGGCTGGG - Intronic
954726451 3:52615188-52615210 CTTAAAATACAGTAAATGAGAGG + Intronic
955020524 3:55116552-55116574 CAAAGAGTACAGTAGAAGCTGGG + Intergenic
955585653 3:60474782-60474804 CTAAAAATACAAAAGTAGCTGGG - Intronic
956110505 3:65865799-65865821 CTAAAAATACAGAATTAGCTGGG - Intronic
957024033 3:75159375-75159397 CTTAAAATACAAAATCAGCTGGG - Intergenic
957439486 3:80225299-80225321 CTAAAAATACAGAAATAGCTGGG + Intergenic
957534906 3:81489142-81489164 TTTAATATACAGTACAGGCTTGG + Intergenic
957873763 3:86118300-86118322 TCTAAAATACAGTGAAAGCTGGG + Intergenic
960106928 3:113807967-113807989 CTAAAAATACAGAATTAGCTGGG + Intronic
960112520 3:113858695-113858717 CTAAAAATACAAAAGTAGCTGGG - Intronic
960189332 3:114684419-114684441 ATTAAAATACAGGAGAAATTGGG + Intronic
960245829 3:115399523-115399545 CTTAATATACAGCAGAGGCCAGG - Intergenic
960285945 3:115828792-115828814 ATTAAAATTTAGTGGAAGCTTGG + Intronic
960547879 3:118937663-118937685 CATAAAATGAAGTAGAAGCTTGG - Intronic
960705859 3:120480333-120480355 CTAAAAATACAAAAGTAGCTGGG - Intergenic
961157326 3:124691265-124691287 CTAAAAATACAGAATTAGCTGGG + Intronic
962151724 3:132900799-132900821 GTTACAAAACAGAAGAAGCTTGG + Intergenic
962719253 3:138157641-138157663 CTAAAAATACAGTATTAGCCAGG - Intergenic
962975940 3:140445924-140445946 TTGAAAATACTGTAGAAGCATGG + Intronic
963097079 3:141555098-141555120 CTAAAAATACAGAATTAGCTGGG + Intronic
963232408 3:142921726-142921748 CTAAAAATACAAAAGGAGCTGGG - Intergenic
963823563 3:149926503-149926525 CTAAAAACACAGAAGAGGCTGGG - Intronic
964501972 3:157357841-157357863 TTTAAAATAAAGAAAAAGCTTGG - Intronic
964676530 3:159288574-159288596 CTAAAAATACAATATTAGCTGGG + Intronic
964683413 3:159367229-159367251 CTAAAAATACAAAATAAGCTGGG + Intronic
964750212 3:160047486-160047508 CTAAAAATACAGAATTAGCTGGG + Intergenic
965056108 3:163718434-163718456 CTAAAAATACAATATTAGCTGGG + Intergenic
965440452 3:168706648-168706670 CTCAAAATACAGAGGAAGTTTGG + Intergenic
966418697 3:179716083-179716105 CTAAAAATACAGAATTAGCTTGG - Intronic
966427688 3:179797901-179797923 CTTAAAGTACAGTCCAATCTTGG + Exonic
966549914 3:181193543-181193565 ATAAAAATACAGTTGAAGCTTGG + Intergenic
966792698 3:183688496-183688518 CTAAAAATACAAAACAAGCTGGG - Intergenic
966841716 3:184094736-184094758 CTAAAAATACAGAATTAGCTGGG + Intergenic
966848841 3:184151717-184151739 CTAAAAATACAATATTAGCTGGG + Intronic
967365410 3:188681155-188681177 CTAAAAATACAAAAGTAGCTGGG - Intronic
968772798 4:2518781-2518803 CTAAAAATACAAAAGTAGCTGGG + Intronic
969030178 4:4205578-4205600 GTTAAAATACTGTCGAAGCAAGG + Intronic
969299616 4:6290232-6290254 CTTAAAATATGATACAAGCTGGG - Intronic
970047335 4:11869846-11869868 CTGAAAAGACAATAGAAGTTGGG + Intergenic
970393310 4:15639001-15639023 CTAAAAATACAGAAGTAGCCGGG + Intronic
970518837 4:16862470-16862492 CTAAAAATACAATATTAGCTAGG + Intronic
970816653 4:20163948-20163970 CTTAAAATAAGGTAAATGCTAGG + Intergenic
970875067 4:20859689-20859711 CTTAAAATACAGTAGAAGCTTGG + Intronic
970988657 4:22187944-22187966 CTAAAAATACAGAATTAGCTGGG + Intergenic
971210516 4:24611573-24611595 CTTAAAATACAAAATTAGCTGGG + Intergenic
972439674 4:39075168-39075190 CTAAAAATACAAAAGTAGCTGGG + Intronic
973153937 4:46924581-46924603 CTTTAAAGACAGTAGAATATTGG - Exonic
973666765 4:53167670-53167692 CTAAAAATACATGAGAACCTAGG + Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974474656 4:62362953-62362975 CTAAAAATACAAAAGTAGCTGGG - Intergenic
974634012 4:64535049-64535071 CTTTAAAGACAGTAGAAAATTGG + Intergenic
975158320 4:71096285-71096307 AATAGAATACAGTAGTAGCTAGG + Intergenic
975581712 4:75912611-75912633 CTAAAAATACAGAATAAGCTGGG + Intergenic
975924663 4:79434211-79434233 TTCAAAATACAGTAAAAACTAGG - Intergenic
975935111 4:79570247-79570269 CTAAAAATACAGAATTAGCTGGG - Intergenic
976272121 4:83241253-83241275 CTTAAAATAAAGTGGAAGCCAGG - Intergenic
976525176 4:86078826-86078848 CTAAAAATACAAAAGCAGCTGGG + Intronic
976527983 4:86115620-86115642 CTAAAAATACAAAATAAGCTGGG - Intronic
976528121 4:86117111-86117133 CTTTAAATACATTATAAGCTGGG + Intronic
978082282 4:104608119-104608141 CTTAAAGTCCAGTAGAAGCAAGG - Intergenic
978432131 4:108643765-108643787 CTTAAAATACAAAATTAGCTGGG - Intergenic
978773938 4:112486753-112486775 CTAAAAATACAAAAAAAGCTGGG + Intergenic
979994962 4:127420684-127420706 CTGAAAATACAGTGCAAGCTTGG + Intergenic
980020034 4:127697957-127697979 CTAAAAATACAAAATAAGCTGGG + Intronic
980033169 4:127853795-127853817 CTTAAAATGCTATAGAAACTTGG + Intergenic
980122597 4:128743272-128743294 CTAAAAATACAAAATAAGCTGGG - Intergenic
980834425 4:138173471-138173493 CTAAAAATACAAAATAAGCTGGG + Intronic
981322252 4:143406163-143406185 CTAAATATTCAGTAGAAGGTAGG - Intronic
981770305 4:148300731-148300753 CTAAAAATACAAAAGTAGCTGGG - Intronic
981855208 4:149281193-149281215 CTAAAATTACAGAACAAGCTCGG - Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982854170 4:160360932-160360954 CTAAAAATACAGAATTAGCTGGG - Intergenic
985125956 4:186694665-186694687 CTTAAAATACAAAACAGGCTGGG + Intronic
986816518 5:11418243-11418265 CTAAAAATACAAAAGTAGCTGGG + Intronic
986884653 5:12218124-12218146 CTAAAAATACAGTTTAGGCTGGG + Intergenic
987787500 5:22520564-22520586 CTTAAAATACAGAAAAAAATAGG + Intronic
988292422 5:29305621-29305643 CTAAAAATACAGAATTAGCTAGG - Intergenic
988496083 5:31747465-31747487 CTGAAAAAACAGCAGAAGCAGGG - Intronic
988575220 5:32416451-32416473 CTAAAAATACAGAATTAGCTGGG + Intronic
988589359 5:32535485-32535507 CTGAAAATACAATATTAGCTGGG + Intronic
988822523 5:34901599-34901621 CTAAAAATACAGAATTAGCTGGG + Intergenic
989054510 5:37354305-37354327 CTAAAAATACAAAATAAGCTGGG - Intronic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
989160115 5:38382858-38382880 TTTAAAATATGGTAGATGCTGGG - Intronic
989388484 5:40876530-40876552 CTAAAAATACAGAATTAGCTGGG + Intergenic
991061329 5:62379499-62379521 CTAAAAATACAGAATTAGCTGGG + Intronic
991770913 5:70040040-70040062 CTTAAAATACAGAATTAGCTGGG - Intronic
991850207 5:70915457-70915479 CTTAAAATACAGAATTAGCTGGG - Intronic
992193871 5:74320633-74320655 CTTGAAATACAGTAGATCCCTGG + Intergenic
992294475 5:75313899-75313921 CTGAAAATACAAAATAAGCTGGG - Intergenic
992314954 5:75543201-75543223 CTTAAAATACAAAATTAGCTGGG - Intronic
992588623 5:78270071-78270093 CTTAAAATACAAAATTAGCTGGG - Intronic
992835306 5:80635300-80635322 CTTAAAATACAAAATTAGCTGGG + Intronic
993069166 5:83136897-83136919 CTTCAAATACAGTACAATATTGG - Intronic
993118014 5:83740946-83740968 TTTAAAATACTGTGGTAGCTAGG - Intergenic
993363620 5:87007677-87007699 CTTAAAACACAGTTGAGGCTGGG - Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994932999 5:106213665-106213687 CTAAAAATACAAAATAAGCTGGG + Intergenic
995160194 5:108970513-108970535 CTAAAAATAAAGTATAGGCTGGG - Intronic
995407571 5:111817508-111817530 TTTAAAATATATTAGAGGCTTGG + Intronic
995732568 5:115262117-115262139 CTTCATTTACAGTAAAAGCTGGG - Intronic
996406502 5:123110725-123110747 CTAAAAATACAGAATAAGCTGGG - Intronic
997146778 5:131443103-131443125 CTAAAAATACAGAATTAGCTGGG - Intronic
997209863 5:132070863-132070885 TTTAAAATACAGTGCAATCTAGG + Intergenic
997492698 5:134291611-134291633 CTAAAAATACAAAAGTAGCTGGG + Intronic
997551486 5:134757325-134757347 CTAAAAATACAAAATAAGCTGGG + Intergenic
997773861 5:136580538-136580560 CTAAAAATACAAAAGTAGCTGGG + Intergenic
997776325 5:136610119-136610141 CTAAAAATACAGAATTAGCTGGG + Intergenic
998141486 5:139702049-139702071 CTAAAAATACAAAAGTAGCTGGG - Intergenic
998259084 5:140614345-140614367 CTAAAAATACAGAATTAGCTGGG + Intergenic
998562423 5:143183892-143183914 CTTAAGTTTCAGTAGAAGTTTGG + Intronic
998675870 5:144407331-144407353 CTTAACATAAAGTAAAAGTTTGG + Intronic
998826126 5:146103318-146103340 CTAAAAATACAGAATTAGCTGGG - Intronic
998834319 5:146189385-146189407 CTAAAAATACAGAATTAGCTGGG - Intergenic
999386776 5:151159131-151159153 CTAAAAATACAGAATTAGCTGGG - Intergenic
999488029 5:152019691-152019713 CTCAAAAAACAAAAGAAGCTAGG - Intergenic
999553147 5:152712093-152712115 CATAAAATACTTAAGAAGCTAGG + Intergenic
1000323354 5:160152725-160152747 CTAAAAATACAGAATTAGCTGGG - Intergenic
1000465342 5:161568875-161568897 CTGAAAATACAGTACAAACAGGG - Intronic
1000731386 5:164838536-164838558 CTTAAAATTCAGTACTATCTTGG - Intergenic
1002197004 5:177506848-177506870 CTAAAAATACAGAAGTAGCTGGG - Intronic
1002628497 5:180551025-180551047 CTTAAAACACAGTATATGCCAGG - Intronic
1004591306 6:17054501-17054523 CTAAAAATACAAAATAAGCTGGG - Intergenic
1004846556 6:19649273-19649295 TTTAAAAGACAGTAGTATCTGGG + Intergenic
1004859485 6:19787609-19787631 CTTAAAATACAAAATTAGCTGGG - Intergenic
1005251433 6:23950734-23950756 CTTAAAATACAAAATTAGCTGGG - Intergenic
1005387339 6:25298913-25298935 CTAAAAATACAAAATAAGCTGGG - Intronic
1005635596 6:27750440-27750462 CTAAAAATACAGTATTAGCGGGG + Intergenic
1005641812 6:27803358-27803380 CTTAAAATACAAAATTAGCTGGG - Intergenic
1005965262 6:30722148-30722170 CTTAAAAATTAGAAGAAGCTGGG + Intronic
1006102685 6:31695560-31695582 CTAAAAATACAATATTAGCTGGG + Intronic
1006172114 6:32099178-32099200 CTTAGAAGACAGTAGGAGCTGGG - Intronic
1006769098 6:36536695-36536717 CTAAAAATACAGAATTAGCTGGG - Intronic
1006819101 6:36876561-36876583 CTAAAAATACAAAATAAGCTGGG + Intronic
1006918595 6:37613044-37613066 CTAAAAATACAGAATCAGCTGGG + Intergenic
1007058461 6:38912968-38912990 CTAAAAATACAAAACAAGCTGGG - Intronic
1007458981 6:42002999-42003021 CTAAAAATACAATATTAGCTGGG + Intronic
1007533081 6:42560431-42560453 CTAAAAATACAAAAAAAGCTGGG - Intergenic
1008192991 6:48482751-48482773 CTAAAAATACAAAATAAGCTGGG + Intergenic
1009218191 6:60948287-60948309 CTAAAAATACAGAATTAGCTGGG - Intergenic
1009581874 6:65546730-65546752 CTAAAAATACAAAAGTAGCTGGG - Intronic
1009640571 6:66330625-66330647 CAAAAAATTCAGTTGAAGCTGGG - Intergenic
1010114470 6:72286034-72286056 CTAAAAATACAAAAGTAGCTGGG + Intronic
1010275310 6:73962263-73962285 CTAAAAATACAAAAGTAGCTGGG - Intergenic
1010569313 6:77458829-77458851 CTTAAAATACAGGAGGAACTGGG - Intergenic
1010620848 6:78072213-78072235 TTGAAAATACAGTAGTTGCTAGG - Intergenic
1010712210 6:79188153-79188175 ATTAAAACACAGTAGATTCTAGG - Intergenic
1011421422 6:87177164-87177186 CTAAAAATACAGAATTAGCTGGG + Intronic
1011481955 6:87803332-87803354 TTTAAAATACAGAAAAAGTTGGG - Intergenic
1012200097 6:96395186-96395208 CTTAAAATACAAAAGGAGTTTGG + Intergenic
1013102218 6:106996584-106996606 CTAAAAATACAATATGAGCTGGG - Intergenic
1013114781 6:107094458-107094480 CTTAAAATACAAAATTAGCTGGG + Intronic
1013131823 6:107240557-107240579 CTAAAAATACAAAAAAAGCTGGG - Intronic
1013525222 6:110967982-110968004 TTTAAAATACAGTTTAGGCTGGG + Intergenic
1013563920 6:111336577-111336599 CGTAAAATAGAGTAGTTGCTTGG + Intronic
1013835495 6:114330360-114330382 CTTAGAGTACAGTAGTTGCTCGG + Intronic
1014097399 6:117475356-117475378 CTTAAAATATTGTAGATCCTTGG - Intronic
1014451358 6:121585494-121585516 CTGAAAATACAGAATTAGCTGGG + Intergenic
1014460868 6:121693870-121693892 CTAAAAATACAGAATTAGCTGGG + Intergenic
1015040736 6:128715718-128715740 CTTATGAAACAGGAGAAGCTGGG - Intergenic
1015298466 6:131626342-131626364 CTTAGAAGACAGTAGAAGATTGG + Intronic
1015402758 6:132805388-132805410 CTAAAAATACAATATTAGCTGGG - Intergenic
1015630370 6:135226495-135226517 CATAAAATAAAGGAAAAGCTTGG + Intergenic
1015691481 6:135929005-135929027 CCTAAAATACAGTAAGAACTGGG + Intronic
1016971202 6:149765803-149765825 CTAAAAATACAATATTAGCTGGG + Intronic
1017385362 6:153876476-153876498 CTAAAAATACAGAATTAGCTGGG + Intergenic
1017492342 6:154955627-154955649 CTAAAAATACAGTATTAGCTGGG - Intronic
1017914560 6:158821076-158821098 CTAAAAATACAGAATTAGCTGGG + Intergenic
1019056585 6:169227918-169227940 CTTAAAATACAAAATTAGCTAGG + Intronic
1019405273 7:880178-880200 CTAAAAATACAGAATTAGCTGGG + Intronic
1019744738 7:2693247-2693269 CTAAAAATACAATATTAGCTGGG - Intronic
1020016008 7:4832441-4832463 TTTAAAAAATAGTAGAGGCTGGG + Intronic
1020053659 7:5101441-5101463 CTAAAAATACAGTATTAGCTAGG - Intergenic
1020407497 7:7854192-7854214 CTAAAAATACAGAATTAGCTGGG + Intronic
1021069991 7:16225264-16225286 CTTAAAATACTTTTGAAGTTAGG - Intronic
1021492078 7:21230160-21230182 CTAAAAATACAAAATAAGCTGGG + Intergenic
1021511140 7:21433777-21433799 CTAAAAATACAGAATTAGCTGGG + Intronic
1021713093 7:23435916-23435938 CTAAAAATACAGTATTAGCCAGG - Intronic
1021720385 7:23499164-23499186 CTAAAAATACAGAATTAGCTGGG - Intergenic
1022008403 7:26288420-26288442 CTTAAAATACAAAATTAGCTGGG - Intergenic
1022491439 7:30822937-30822959 ATTAAAATAGACTAGAGGCTGGG - Intronic
1022835697 7:34111872-34111894 CTAAAAATACAGAAGTAGCCAGG - Intronic
1023502343 7:40864316-40864338 CTTAAAATACAAAATTAGCTGGG - Intergenic
1023754050 7:43399441-43399463 CTTCAAAAACAGTAGAAACCAGG + Intronic
1023917954 7:44604563-44604585 CTAAAAATACAAAATAAGCTGGG + Intergenic
1023936467 7:44743558-44743580 CTAAAAATACAGAATTAGCTGGG - Intergenic
1024208378 7:47182946-47182968 CTAACAATACGGTAGATGCTGGG - Intergenic
1024450204 7:49531301-49531323 CTAAAAATACAATATTAGCTGGG + Intergenic
1025246802 7:57323703-57323725 CTTAAAATACAAAATTAGCTGGG - Intergenic
1025296597 7:57780074-57780096 CTAAAAATACAGAAGTAGCCAGG + Intergenic
1025917372 7:65876339-65876361 CTAAAAATACAAAACAAGCTGGG + Intronic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026347604 7:69488113-69488135 CTAAAAATACAAAATAAGCTGGG - Intergenic
1026451652 7:70534585-70534607 CTAAAAATACAGAATTAGCTGGG - Intronic
1026619417 7:71937144-71937166 CTAAAAATACAAAAGTAGCTGGG + Intronic
1026637176 7:72094413-72094435 CTAAAAATACAGAATTAGCTGGG - Intronic
1026820800 7:73547000-73547022 CTAAAAATACAAAAGTAGCTGGG + Intronic
1028315907 7:89402918-89402940 CTTAAAATACAGTAAGAAATGGG + Intergenic
1028597305 7:92559114-92559136 TTTAAAATACAGCAAAGGCTGGG + Intergenic
1029853729 7:103491666-103491688 CTAAAAATACAAAATAAGCTGGG + Intronic
1029868959 7:103667932-103667954 TTTAAAATACATTACAGGCTGGG + Intronic
1030352058 7:108500746-108500768 CTAAAAATACAAAAGTAGCTGGG + Intronic
1030397804 7:109010179-109010201 CTTAAATTCCAGTAAAAGCCAGG - Intergenic
1031346705 7:120675534-120675556 ATTAAGAAACAGTAGAAACTTGG - Intronic
1031376486 7:121032950-121032972 CTTTAGATACAGAGGAAGCTGGG - Intronic
1032244122 7:130193375-130193397 CTTAAAATACAAAATTAGCTGGG + Intronic
1032442312 7:131951329-131951351 CTAAAAATACAGAATTAGCTGGG + Intergenic
1032852577 7:135807973-135807995 CTTAAAATAGAGGAGATGCTTGG + Intergenic
1033058459 7:138081741-138081763 CTAAAAATACAGAATTAGCTGGG - Intronic
1033114421 7:138612674-138612696 CTAAAAATACAATATTAGCTGGG - Intronic
1033198430 7:139347424-139347446 CTAAAAATACAGAATTAGCTGGG + Intronic
1033302495 7:140198953-140198975 CTAAAAATACAAAAGTAGCTGGG - Intergenic
1034727094 7:153346613-153346635 CCTTAAATACAGTAGAAAATAGG + Intergenic
1035514823 8:223747-223769 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1036015394 8:4777633-4777655 TTTAAAATACTGTATTAGCTTGG + Intronic
1036016779 8:4794461-4794483 CTTAAAATCCAGTACAAAATGGG + Intronic
1037004184 8:13756938-13756960 CTAAAAATACAAAATAAGCTGGG - Intergenic
1037336679 8:17799160-17799182 CTTGAAATACAGTTGATGGTTGG - Intronic
1038469969 8:27806909-27806931 CTTAAAAAAAAGTAACAGCTGGG - Intronic
1039914400 8:41849101-41849123 CCTAAAATAATGTTGAAGCTTGG - Intronic
1039942341 8:42101993-42102015 CTAAAAATACAGAATTAGCTGGG + Intergenic
1040032197 8:42835163-42835185 CTAAAAATACAATATTAGCTGGG + Intergenic
1040051859 8:43023043-43023065 CTAAAAATACAGTATTAGCCAGG + Exonic
1040778923 8:51083025-51083047 CTTAAAATTCAGTTAAATCTTGG - Intergenic
1042263184 8:66881523-66881545 CTAAAAATACAAAAGTAGCTGGG + Intronic
1042562700 8:70085069-70085091 CTAAAAATACAAAATAAGCTGGG - Intergenic
1043037224 8:75213277-75213299 CTTAAAATAAAGTGGATGATAGG + Intergenic
1043112630 8:76206931-76206953 CCTAGTATATAGTAGAAGCTTGG - Intergenic
1043806977 8:84683845-84683867 CTTAATATACAGAATAAGCTGGG - Intronic
1044110589 8:88268179-88268201 CTAAAAATACAAAAGTAGCTGGG + Intronic
1044124924 8:88447743-88447765 CTTAGAGAAAAGTAGAAGCTTGG - Intergenic
1044143252 8:88680817-88680839 CTTAACAGACAGTGGAAGTTTGG + Intergenic
1044245682 8:89942149-89942171 CTTACAACACAGAAGGAGCTAGG + Intronic
1045303698 8:100937967-100937989 CTAAAAATACAGAATTAGCTGGG + Intronic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1047271188 8:123360667-123360689 CTGAGACTAGAGTAGAAGCTAGG - Intronic
1047363671 8:124192896-124192918 CTAAAAATACAATATTAGCTGGG - Intergenic
1047701828 8:127456667-127456689 CTAAAAATACAAAAAAAGCTGGG - Intergenic
1048079551 8:131110590-131110612 CTAAAAATACAGAATTAGCTGGG - Intergenic
1048245413 8:132791722-132791744 ATTAAAATAGAGAAGAATCTTGG + Intronic
1049122158 8:140748330-140748352 CTAAAAATACAGAATTAGCTGGG + Intronic
1049631223 8:143658901-143658923 CTAAAAATACAAAATAAGCTGGG - Intergenic
1050238229 9:3605716-3605738 CTAAAAATACAGAATTAGCTGGG - Intergenic
1050667115 9:7951832-7951854 CTTAAAATACACTTGAAGTTTGG - Intergenic
1050705837 9:8395940-8395962 CTTAAAATACAGTAGACCTTAGG + Intronic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1051439324 9:17067132-17067154 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1051461875 9:17327790-17327812 CTAAAAATACAAAAGTAGCTGGG + Intronic
1052208794 9:25875884-25875906 CTTAAAATACAACAGTTGCTAGG - Intergenic
1053525883 9:38830122-38830144 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1054198114 9:62054547-62054569 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1054640240 9:67533816-67533838 CTTTAAAAACAGAAGAATCTGGG - Intergenic
1054842957 9:69762160-69762182 CTTAAAATACAAAATTAGCTGGG + Intergenic
1055228603 9:74032030-74032052 CTTAAAATACAGAAAAAGTTGGG + Intergenic
1055430139 9:76235091-76235113 CTTAAAATACAGCAGAAACAAGG - Intronic
1056234335 9:84577010-84577032 CTAAAAATACAGAATTAGCTGGG + Intergenic
1056369039 9:85936073-85936095 CTAAAAATACAATATTAGCTGGG + Intergenic
1056616102 9:88167259-88167281 CTAAAAATACAAAAGTAGCTGGG + Intergenic
1056991347 9:91414362-91414384 CTAAAAATACAAAAGTAGCTGGG - Intronic
1057052627 9:91937053-91937075 CTGAAACTAAAGTAGAAGATGGG - Intronic
1057636095 9:96769117-96769139 TTTAAAATACAGTATAAGGTAGG - Intronic
1057655353 9:96946990-96947012 CTAAAAATACAATATTAGCTGGG + Intronic
1057779292 9:98036638-98036660 CTGAAAATACAGTATTAGCCAGG + Intergenic
1058417500 9:104803766-104803788 CTAAAAATACAAAATAAGCTGGG - Intronic
1059234911 9:112752658-112752680 CTTAAAATAGTGTAGGAACTGGG + Intronic
1059583568 9:115579476-115579498 CTAAAAATACAAAATAAGCTGGG + Intergenic
1060010946 9:120042327-120042349 CTAAAAATACAAAATAAGCTGGG + Intergenic
1061038498 9:128126561-128126583 CTTAAAACACGGTAGAGGCTGGG + Intronic
1061172250 9:128965956-128965978 CTAAAAATACAAAAAAAGCTGGG - Intronic
1061333892 9:129916454-129916476 CTAAAAATACAGTATTAGCCGGG + Intronic
1062488791 9:136794284-136794306 CTAAAAATACAGAATTAGCTGGG - Intronic
1203585052 Un_KI270746v1:60035-60057 CCTAAAATACAGTATAGGTTTGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1187033311 X:15510724-15510746 ATTAAAATACTGAAGTAGCTAGG + Intronic
1187686356 X:21819505-21819527 CTTAAAAGTCAGTAGCAGCCAGG - Intergenic
1187903452 X:24045627-24045649 CTTAAAATACAAAATTAGCTGGG - Intergenic
1188215995 X:27477718-27477740 CCTAAAATACAGTAGATGCAGGG - Intergenic
1188348884 X:29102503-29102525 CTAAAAATACAGAATTAGCTGGG + Intronic
1189420028 X:40848776-40848798 CTAAAAATACAATATTAGCTGGG - Intergenic
1189816449 X:44829181-44829203 CTAAAAATACAAGAGTAGCTGGG + Intergenic
1190712513 X:53080984-53081006 CTTAAAATACAGCATACACTGGG + Intergenic
1190719842 X:53138499-53138521 CTAAAAATACAGAATTAGCTGGG + Intergenic
1191800556 X:65074017-65074039 ATTAGAATACTGGAGAAGCTGGG - Intergenic
1192107869 X:68333472-68333494 CTAAAAATACAGAATTAGCTGGG + Intronic
1192121117 X:68456830-68456852 CTTAAAATCCAGTAGCAATTAGG + Intergenic
1192483589 X:71505857-71505879 CTAAAAATACAGTATTAGCCAGG + Intronic
1192749848 X:73978237-73978259 CTTAAAATACAAAATTAGCTGGG + Intergenic
1193090296 X:77486740-77486762 CTAAAAATACAAAATAAGCTGGG + Intergenic
1193232437 X:79064232-79064254 CTAAAAATACAGAATTAGCTGGG - Intergenic
1194391999 X:93330408-93330430 CTAAAAATACAGAATTAGCTGGG - Intergenic
1195242570 X:102967225-102967247 CTAAAAATACAAAATAAGCTGGG - Intergenic
1195621881 X:106964846-106964868 CTAAAAATACAAAAGTAGCTGGG + Intronic
1196038389 X:111173137-111173159 ATTAAAATTCAGTAAGAGCTTGG + Intronic
1196501968 X:116394727-116394749 CTGAAAATGCAATAGCAGCTGGG - Intergenic
1196677127 X:118431462-118431484 CTAAAAACACAGTATTAGCTGGG - Intronic
1197215869 X:123866232-123866254 CTTAAAATACAAAAAAGGCTGGG - Intronic
1198729125 X:139708430-139708452 CACAAAATGCAGAAGAAGCTGGG + Intergenic
1199636692 X:149820106-149820128 CTTAAAATACAAAATTAGCTGGG + Intergenic
1200689007 Y:6287235-6287257 CTTAAAATACAAAATTAGCTGGG - Intergenic
1200794832 Y:7331468-7331490 CTAAAAATACAAAATAAGCTGGG - Intergenic
1200965620 Y:9034111-9034133 CTTAAAATACAAAATTAGCTGGG - Intergenic
1201013795 Y:9576978-9577000 CTTAAAATACAAAATTAGCTGGG - Intergenic
1201046265 Y:9887487-9887509 CTTAAAATACAAAATTAGCTGGG + Intergenic
1201224397 Y:11803966-11803988 GTTAAAAAACAGTAGAGGCTGGG + Intergenic