ID: 970881707

View in Genome Browser
Species Human (GRCh38)
Location 4:20939885-20939907
Sequence TTCAGACATTGCTAAAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970881707 Original CRISPR TTCAGACATTGCTAAAAGCT TGG (reversed) Intronic
900011547 1:114978-115000 TTCAGAAATTCCTATAAGCTTGG + Intergenic
900027650 1:291542-291564 TTCAGAAATTCCTATAAGCTTGG + Intergenic
900041607 1:470984-471006 TTCAGAAATTCCTATAAGCTTGG + Intergenic
900063042 1:705961-705983 TTCAGAAATTCCTATAAGCTTGG + Intergenic
902438874 1:16416226-16416248 TTAACACCTTGCAAAAAGCTGGG - Intronic
904103990 1:28061375-28061397 TTTAAACATTGATAAATGCTGGG - Intronic
906610639 1:47199558-47199580 TTCAGACAGTGCTTGAAACTTGG + Intergenic
907706139 1:56834381-56834403 TTCTCACATTGCTAGAGGCTGGG - Intergenic
908034693 1:60039346-60039368 TTCAGACATAGGTATGAGCTTGG + Intronic
909038122 1:70618314-70618336 TTCTCACAGTTCTAAAAGCTGGG + Intergenic
910277729 1:85466073-85466095 TCCAGAGTTTCCTAAAAGCTGGG - Intronic
911472862 1:98339892-98339914 TTCAGACATGACCAAAAGCTGGG + Intergenic
916332622 1:163634324-163634346 TGCACAGCTTGCTAAAAGCTAGG + Intergenic
916370881 1:164092934-164092956 TGCATACATTCCTAAAATCTAGG + Intergenic
916934755 1:169616089-169616111 AGCAGACATTCCTGAAAGCTTGG - Intronic
917618469 1:176770133-176770155 TTCACACATTGCTCAAAGGATGG - Intronic
917919453 1:179738481-179738503 TTCACATATTGCTAAATTCTTGG - Intergenic
918093295 1:181315506-181315528 TTCAGACATAACAAAAAGATTGG - Intergenic
918127430 1:181596817-181596839 TTCCAACATTGTTAGAAGCTGGG + Intronic
919534425 1:198769418-198769440 TTCAGACATGACTAAAACCAAGG - Intergenic
919757273 1:201073972-201073994 TTCAGACATTTCTAAAGAGTTGG - Intronic
919860959 1:201739435-201739457 TTTAGAAATTTCTAAAAGCCTGG + Intronic
921107350 1:211995906-211995928 TTCGGACATTTCTGGAAGCTGGG - Intronic
922259986 1:223930986-223931008 TTCAGAAATTCCTATAAGCTTGG + Intergenic
923253888 1:232201875-232201897 TTCAGCCATTGCTTAAGGGTAGG - Intergenic
924341150 1:243033545-243033567 TTCAGAAATTCCTATAAGCTTGG + Intergenic
1063717649 10:8544496-8544518 TCCAAACATTTCTAAAAACTGGG - Intergenic
1066735319 10:38471862-38471884 TTCAGAAATTCCTATAAGCTTGG - Intergenic
1067935401 10:50607721-50607743 TTCAAACAGTGCACAAAGCTGGG + Intronic
1068974007 10:62988788-62988810 TTCAGATATTGCTACAGGCCCGG + Intergenic
1069146978 10:64905464-64905486 TTGAGAGATGGCTAAAAGTTTGG + Intergenic
1069200809 10:65613557-65613579 TTCATACATTACTTATAGCTAGG + Intergenic
1070445440 10:76496173-76496195 TTCAGACATTACACAGAGCTGGG - Intronic
1070993114 10:80750388-80750410 TTCAGAAATTGCTAGAAAATGGG - Intergenic
1074796922 10:116956040-116956062 TTCTGACATTCCTAAAAGATGGG - Intronic
1076967882 11:107212-107234 TTCAGAAATTCCTATAAGCTTGG + Intergenic
1077638245 11:3857963-3857985 TTGAGACCTGGCTGAAAGCTTGG + Intronic
1078630448 11:12998566-12998588 TTCATACATTGATAGACGCTTGG + Intergenic
1079273532 11:19012178-19012200 ATAAGACAATTCTAAAAGCTTGG - Intergenic
1079643098 11:22830682-22830704 TTCAAACATTACAAAAAGGTAGG + Intergenic
1079795925 11:24802956-24802978 TTCTCACAATTCTAAAAGCTGGG - Intronic
1080442757 11:32310618-32310640 TTCAGACACTTCAAAAAGCCAGG - Intergenic
1081837049 11:46164626-46164648 TTAAGAGAGTGCTAAAAGCGGGG + Intergenic
1084113640 11:67029206-67029228 CTCAGTCATTCCTAAAAGCTGGG + Intronic
1087729720 11:101764969-101764991 TTCATACCTTTCTAAAATCTAGG + Intronic
1088057854 11:105607312-105607334 TCTAGACACTGCTAAAAGCTTGG - Intergenic
1091142969 11:133251890-133251912 TTCAGGCAGTGCAAAATGCTGGG + Intronic
1092720905 12:11439533-11439555 TTCAGCAGTGGCTAAAAGCTTGG + Intronic
1092824800 12:12388877-12388899 TTCAACCATTGCTAAAAGAATGG - Intronic
1093389735 12:18603416-18603438 AGAAGACATTTCTAAAAGCTTGG + Intronic
1095263326 12:40124159-40124181 TTCAGAAACTGCTAAAATTTTGG + Intergenic
1095454528 12:42368842-42368864 TTAAGATATTGGTAAAAGATGGG + Intronic
1098431621 12:70425803-70425825 TTCAGCCATTGTCAAAAACTAGG + Intronic
1099308124 12:80983476-80983498 TTAGGATATTGCTAAAAACTTGG + Intronic
1100291426 12:93218318-93218340 TCCAGATATTGATAAAAGATGGG + Intergenic
1101397804 12:104363740-104363762 TTCTGGCATTGCTAACTGCTCGG + Intergenic
1102832266 12:116014176-116014198 GTATGAAATTGCTAAAAGCTGGG + Intronic
1104293549 12:127491170-127491192 TCCAGACATTGCTAAATGCCTGG + Intergenic
1105552988 13:21415576-21415598 TTCAGACATTTCTGACAGATTGG + Intronic
1106227862 13:27798495-27798517 TCCAGACATTGCCAAAAGTCTGG + Intergenic
1106269947 13:28142949-28142971 TTCAGATAGTGTTAAAACCTTGG + Intronic
1107888685 13:44895351-44895373 TTAGCACATCGCTAAAAGCTTGG - Intergenic
1107934663 13:45335524-45335546 TTCAGGCAGTGGTCAAAGCTGGG - Exonic
1108706955 13:52997918-52997940 TGGAGAAATGGCTAAAAGCTTGG - Intergenic
1110039840 13:70739912-70739934 TTTTGGCATTGCTAGAAGCTGGG + Intergenic
1110115652 13:71812939-71812961 TTCACATCTTGCAAAAAGCTGGG - Intronic
1110410458 13:75199037-75199059 TTCAAATGTTGGTAAAAGCTGGG + Intergenic
1110798357 13:79666705-79666727 TTCAGAAATTAAGAAAAGCTTGG + Intergenic
1111042904 13:82774196-82774218 GTCAGACATTGTTGAAAACTAGG + Intergenic
1114995891 14:28351377-28351399 TTGAGACATTTATAAAATCTGGG - Intergenic
1115438953 14:33409893-33409915 TGGAGACATTGCTAAAACATTGG + Intronic
1116732133 14:48637202-48637224 ATAAGACAATTCTAAAAGCTTGG + Intergenic
1118091151 14:62480879-62480901 CTCAGTGATGGCTAAAAGCTAGG - Intergenic
1119226885 14:72951276-72951298 ATCAGATATAGTTAAAAGCTGGG - Intronic
1120204075 14:81568788-81568810 GTCAGAAATTGCTCAAACCTTGG + Intergenic
1120568704 14:86091322-86091344 TTCAGATATTGATAAGAGGTGGG - Intergenic
1121025178 14:90610387-90610409 TTCAGACCTTGCTGAAAGCAAGG - Intronic
1123692477 15:22850052-22850074 TTCAGTGATGGGTAAAAGCTGGG - Intronic
1124557274 15:30737506-30737528 ATAAGAGATTTCTAAAAGCTTGG + Intronic
1124673991 15:31668243-31668265 ATAAGAGATTTCTAAAAGCTTGG - Intronic
1125137359 15:36359088-36359110 TTCAGAGATTGCTAGTAGTTTGG + Intergenic
1125152644 15:36550616-36550638 TTCAGACAGTGTTTAAAACTTGG - Intergenic
1125372809 15:38996521-38996543 TTCAGACATTGCTGTGAACTTGG - Intergenic
1126199245 15:45967076-45967098 GTCAGACATTGCTCTAAACTGGG + Intergenic
1133397127 16:5456997-5457019 TTCACACAGTTCTAAAGGCTGGG + Intergenic
1133752456 16:8735577-8735599 TTCTGACATTGTCAAATGCTTGG - Intronic
1141428535 16:83958831-83958853 TTCTGAGATTGCTAAGAACTAGG - Intronic
1142452798 16:90191927-90191949 TTCAGAAATTCCTATAAGCTTGG - Intergenic
1143456802 17:7073330-7073352 TTCAGACATTCCTATATGCCAGG + Intergenic
1143612238 17:8025459-8025481 TTCAGCCATTGCCAGAAGCCAGG + Intergenic
1145846741 17:28044869-28044891 TACATACAATGCTAAAAACTAGG + Intronic
1146368691 17:32250271-32250293 TTCAGACATTCTTAAAATGTTGG - Intronic
1148379626 17:47185899-47185921 TCTAGACATTGCTAAATGTTGGG - Intronic
1149115376 17:53088018-53088040 TTCAGAGATTGGAGAAAGCTGGG + Intergenic
1150221060 17:63496204-63496226 CTCAGACAATGCTAAGAGCTGGG + Intronic
1150920996 17:69482183-69482205 TCCTGACATTGCCAAAACCTAGG - Intronic
1155525267 18:26709807-26709829 TTAAGAAATTTCTTAAAGCTTGG + Intergenic
1158094704 18:53757633-53757655 TTCTCACAGTCCTAAAAGCTGGG + Intergenic
1158304140 18:56086055-56086077 TTCAGAAATTGTTAAAAACTGGG + Intergenic
1159261924 18:66025157-66025179 TTAAGAAAATGCTAAAAGCTAGG - Intergenic
1159288196 18:66380129-66380151 TTAAGACATTGTTCTAAGCTAGG - Intergenic
1160644687 19:176835-176857 TTCAGAAATTCCTATAAGCTTGG + Intergenic
1162234127 19:9292558-9292580 TTCAGACATGGCTAAATCCTGGG - Intergenic
926716368 2:15927478-15927500 TGCAGCCATTGCCAAAAGCAAGG - Intergenic
927092908 2:19726058-19726080 GTCAGATATTCCTAAAAGGTTGG - Intergenic
929124815 2:38513471-38513493 CTCAAACATTGCTCACAGCTGGG - Intergenic
933073665 2:77894743-77894765 TTCATACATTGTCAAAAGCAAGG - Intergenic
933285761 2:80383076-80383098 TTGGGTGATTGCTAAAAGCTGGG - Intronic
935936563 2:108191004-108191026 TTCAGCCATTGCGGAAAGCAGGG - Intergenic
939314173 2:140525960-140525982 TGCACACATTTCTATAAGCTTGG - Exonic
939904410 2:147893088-147893110 CTCAGAGATTGCCAGAAGCTGGG - Intronic
940278047 2:151960405-151960427 TGCAGACACTGCTAAAAGCAAGG + Intronic
940927114 2:159376844-159376866 TTCAGACATTAAAAAAACCTTGG + Intronic
942544233 2:177045854-177045876 TTCTCACAGTTCTAAAAGCTGGG + Intergenic
945147458 2:206753205-206753227 TTCAGACATAGCTGGATGCTGGG - Intronic
948148311 2:235724929-235724951 ATCAGAGTTTGCTAAAGGCTTGG + Intronic
948880533 2:240855092-240855114 TTCAGAAATTGCTAGAAAATGGG + Intergenic
949084239 2:242136588-242136610 TTCAGAAATTCCTATAAGCTTGG - Intergenic
1169285583 20:4304610-4304632 TCCACACAGTGCTGAAAGCTTGG - Intergenic
1176280822 20:64309072-64309094 TTCAGAAATTCCTATAAGCTTGG - Intergenic
1178313402 21:31548928-31548950 TCCAGACATTGCCAAATGTTTGG + Intronic
1179126072 21:38591796-38591818 TTCAGAAATTACTAGTAGCTAGG + Intronic
1180111523 21:45657220-45657242 TTAAGACATTGCTTAATCCTAGG + Intronic
1182742034 22:32574842-32574864 TTCAGACAGTGCTAAGTGCGAGG - Intronic
1182875990 22:33691322-33691344 TTCACCCATTTCTAAAAGATGGG + Intronic
1183048222 22:35239344-35239366 TGAAGACAATTCTAAAAGCTTGG - Intergenic
1184112034 22:42401239-42401261 CTTAGACATTGCGAACAGCTCGG + Intronic
949358399 3:3205722-3205744 ATCAGACATTGCTAAATGTTGGG - Intergenic
949649029 3:6133462-6133484 TTCAGCCATTGCTAAGAGAAAGG + Intergenic
949890828 3:8732817-8732839 TTCAGGATTTGCTAATAGCTGGG - Intronic
950369907 3:12520408-12520430 GTCAGACATTTCTAAAAGCGTGG - Intronic
950980766 3:17302185-17302207 TTCAGCCATTACCAGAAGCTAGG - Intronic
951072363 3:18346362-18346384 TTCAGAGACTTTTAAAAGCTGGG - Intronic
952002708 3:28805190-28805212 TTGAGACAATGCTAAGTGCTAGG - Intergenic
953641862 3:44715485-44715507 TTCAAACATTACAAAAAGATAGG + Intronic
953683135 3:45054745-45054767 TTCAGCCATTGCTCAACTCTTGG + Intergenic
953727234 3:45410671-45410693 CTCAGACATTTCTACAAGCTAGG + Intronic
955724064 3:61913835-61913857 ATCAGACAAAACTAAAAGCTGGG - Intronic
957913810 3:86659650-86659672 TTTATACATGGCTCAAAGCTTGG + Intergenic
960477719 3:118149822-118149844 TTCAGACAGTCCTAAGAGATTGG - Intergenic
962520279 3:136192263-136192285 TCCAGACATTGCTTGAACCTGGG - Intronic
962609251 3:137059758-137059780 GTCATGCATTGCTTAAAGCTTGG + Intergenic
963582281 3:147140906-147140928 CTCACACATTGTTAAAACCTGGG - Intergenic
963993005 3:151674831-151674853 GTCAGAAAATGCTAAAAGCCTGG + Intergenic
964260440 3:154829211-154829233 TTCAAACATCACTAAAAGGTGGG + Intergenic
965680876 3:171250045-171250067 TGCAGGCATCGCTAAGAGCTTGG - Intronic
967209866 3:187158911-187158933 TTCAGGCATTCCTAGAAGGTAGG - Intronic
969383791 4:6828414-6828436 TTCAGACCTCACTAACAGCTAGG + Intronic
970881707 4:20939885-20939907 TTCAGACATTGCTAAAAGCTTGG - Intronic
972719264 4:41679464-41679486 TTCAGAAGTTACTTAAAGCTAGG + Intronic
972859864 4:43154194-43154216 TTCACACCTTGATAAAAGCAAGG + Intergenic
973913565 4:55609532-55609554 TACAGATTTTGCTACAAGCTGGG - Intronic
974882168 4:67773402-67773424 TCCAGACATTGCTAAATGTGGGG - Intergenic
976337396 4:83906174-83906196 TCCAGACATGGCCAAAATCTGGG + Intergenic
977853313 4:101856962-101856984 TTCAGACTATACTAAAATCTAGG - Intronic
979261674 4:118654826-118654848 TTCAGAAATTCCTATAAGCTTGG - Intergenic
979465591 4:121034230-121034252 TTCAGATATTGCTTAATGCCTGG - Intergenic
979873444 4:125855735-125855757 TTCAGACATTGCCAAACGTCTGG - Intergenic
980241270 4:130179281-130179303 TTCAGAAATTGCCCAAAACTAGG + Intergenic
980568596 4:134579887-134579909 TTCAGCCACTGCTGAAAGCAAGG + Intergenic
981916110 4:150035137-150035159 TTCAAAACTTGTTAAAAGCTAGG - Intergenic
982186234 4:152803509-152803531 ACCAGACATTGCTAAATGGTGGG + Intronic
983150157 4:164268501-164268523 TTCAGAAATTCCTATAAGCTTGG + Intronic
983361646 4:166731674-166731696 TTTAGAGATTCCTAATAGCTGGG - Intergenic
983693600 4:170502025-170502047 TTCACAAATTGCTGAGAGCTAGG - Intergenic
985349799 4:189047255-189047277 TTCTGTTTTTGCTAAAAGCTGGG - Intergenic
985938171 5:3112476-3112498 TTCTGCCATGGCTAAAAGCTTGG - Intergenic
986575035 5:9203522-9203544 TTCAGACATTGACAAAGGGTTGG + Intronic
986677795 5:10202190-10202212 TCCAGACATAGCTAAAGGGTAGG + Intergenic
987535427 5:19181316-19181338 TCCAGACATTGCTAATTCCTAGG + Intergenic
988556590 5:32241405-32241427 TTCAGAGAATGATAAAAGCTTGG + Intronic
990277449 5:54213159-54213181 TTCACACATTGCTAAAACACTGG + Intronic
991130815 5:63120541-63120563 TGCAGACATTCCTAAAAGGAAGG + Intergenic
993244982 5:85439454-85439476 TTCACATATTTCTAATAGCTTGG - Intergenic
994613414 5:102074590-102074612 TTCAGATATGGCTGAAAGGTTGG - Intergenic
994850931 5:105054041-105054063 TTCAGACTTTGCTAACATCAGGG + Intergenic
996046766 5:118882721-118882743 TCCAGCCATTGCTAAAGGGTAGG - Intronic
997571796 5:134934500-134934522 TTCTGACATTGATCAAAGATTGG + Intronic
998191253 5:140026780-140026802 TTTTGACATTTCTAACAGCTTGG + Intronic
998859216 5:146426409-146426431 TCCAGACATTGCCAAAAGTGGGG - Intergenic
1000466518 5:161584844-161584866 TTCAGACATAGCAAAAACTTAGG + Intronic
1001168115 5:169390250-169390272 TTCCAACATTGCTTAAAGGTAGG - Intergenic
1002449209 5:179309469-179309491 TCCAGACACTGCAGAAAGCTGGG + Intronic
1002732237 5:181347945-181347967 TTCAGAAATTCCTATAAGCTTGG - Intergenic
1002752299 6:126160-126182 TTCAGAAATTCCTATAAGCTTGG + Intergenic
1003642021 6:7883847-7883869 ATCAGACTGTGCTAACAGCTTGG + Intronic
1004821234 6:19370082-19370104 TGCAATCATTGCTAAAGGCTTGG + Intergenic
1005084666 6:21992777-21992799 TTCAAACCTTGCTAAAGGCTTGG + Intergenic
1006534315 6:34685737-34685759 TTCAGCCATCACTAAAAGTTGGG - Intronic
1007853204 6:44825221-44825243 TTAAGACATTATTAAAAACTTGG + Intronic
1009318418 6:62253988-62254010 TTCAGTCTTTGTTAAAAGTTAGG - Intronic
1009985193 6:70773723-70773745 TTCATACATTTCTAGAATCTAGG - Intronic
1011921596 6:92583724-92583746 TTCATTAATTGCTAAAAACTGGG - Intergenic
1012602209 6:101112611-101112633 TACAGAAATTGTTAAATGCTTGG + Intergenic
1015877828 6:137841966-137841988 AGAAGACAATGCTAAAAGCTTGG - Intergenic
1019236489 6:170620260-170620282 TTCAGAAATTCCTATAAGCTTGG - Intergenic
1020067646 7:5201179-5201201 TTCAGTCATTCGTAAAAGCCTGG - Intronic
1023274003 7:38498420-38498442 ATCAGCCTTTGTTAAAAGCTTGG + Intronic
1024050327 7:45617115-45617137 TGCACACTCTGCTAAAAGCTAGG - Intronic
1024162261 7:46688701-46688723 TTCAGACACTGCTTATGGCTTGG - Exonic
1027821717 7:83054441-83054463 TTCAAACAATGCTATAATCTTGG - Intronic
1030928698 7:115494065-115494087 TCCAGAGACTGCTAAAATCTTGG - Intergenic
1031463251 7:122077877-122077899 TTCAGCCATGGCTAAAACCGTGG - Exonic
1032399102 7:131611312-131611334 ATCAGACCTTGCTAAGTGCTGGG - Intergenic
1034010266 7:147521984-147522006 TTCTGACAGTTCTAGAAGCTGGG + Intronic
1034345072 7:150381038-150381060 TTCAGAGATTGTTAGCAGCTGGG + Intronic
1035423306 7:158747790-158747812 GTAAGACATTGATAAAAGATTGG - Intronic
1035511281 8:186348-186370 TTCAGAAATTCCTATAAGCTTGG + Intergenic
1040449180 8:47526987-47527009 TTCACACATTGCCAGAGGCTCGG + Intronic
1042178499 8:66060968-66060990 ATCAGATGTTGCTAAATGCTAGG + Intronic
1042813232 8:72848813-72848835 TTCAGGCACTGTTAAATGCTAGG + Intronic
1043835453 8:85040131-85040153 TGCAGACATTGCAAAGAGCTTGG + Intergenic
1045093590 8:98772850-98772872 TGCAGACACTGCAAAAAGCACGG - Intronic
1045789628 8:105967459-105967481 TTCAGTTCTTTCTAAAAGCTTGG + Intergenic
1046680205 8:117160547-117160569 TGCAGACATTTGTAAAAGCTTGG - Intronic
1051358049 9:16257799-16257821 TTCAGAGATTGATGAGAGCTTGG - Intronic
1054823139 9:69543813-69543835 TTCAGACATTGCTAGCAAATTGG - Intronic
1059080947 9:111249380-111249402 TTCAGCCTTTGCTACAAGCAGGG + Intergenic
1059579558 9:115529568-115529590 TGCTGACATTGCTAAGATCTAGG - Intergenic
1061250394 9:129423029-129423051 TCCCGACCTTGCTAGAAGCTCGG + Intergenic
1062756639 9:138300271-138300293 TTCAGAAATTCCTATAAGCTTGG - Intergenic
1189006649 X:37002065-37002087 TTCACAAATGGCTAAAATCTTGG - Intergenic
1189041937 X:37551536-37551558 TTCACAAATGGCTAAAATCTTGG + Intronic
1191914978 X:66191794-66191816 TACAGATAGTGCTTAAAGCTTGG + Intronic
1192128185 X:68522110-68522132 TTGAGAATTTGTTAAAAGCTAGG - Intronic
1193886457 X:86987982-86988004 TTCAGACTGTACTGAAAGCTTGG + Intergenic
1193955429 X:87854102-87854124 TTCACATTTTGCTAAAAGCAAGG - Intergenic
1194131489 X:90087887-90087909 TTCAGACTTTACTAAAGGCTTGG + Intergenic
1195209483 X:102639187-102639209 TTCACAAATTGCTGAAGGCTAGG - Intergenic
1197294377 X:124699878-124699900 TAGAGACATTGCTAGAAGGTTGG + Intronic
1198257330 X:134935590-134935612 TTAAGCTATTGCTAAAAGATCGG + Intergenic
1198946084 X:142015822-142015844 TTCAGACATTGCTGACAGAAAGG + Intergenic
1202383761 Y:24303290-24303312 TTCAGAAATTCCTATAAGCTTGG - Intergenic
1202487022 Y:25366830-25366852 TTCAGAAATTCCTATAAGCTTGG + Intergenic