ID: 970882407

View in Genome Browser
Species Human (GRCh38)
Location 4:20947398-20947420
Sequence GAGGCAGGTGGACCACATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1346
Summary {0: 1, 1: 4, 2: 132, 3: 331, 4: 878}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970882407_970882419 23 Left 970882407 4:20947398-20947420 CCCTCATGTGGTCCACCTGCCTC 0: 1
1: 4
2: 132
3: 331
4: 878
Right 970882419 4:20947444-20947466 CAGGCATGAGCCACCACACCTGG 0: 5377
1: 28995
2: 87460
3: 165025
4: 199163
970882407_970882412 -5 Left 970882407 4:20947398-20947420 CCCTCATGTGGTCCACCTGCCTC 0: 1
1: 4
2: 132
3: 331
4: 878
Right 970882412 4:20947416-20947438 GCCTCGGCCTCCCAAAGTGCTGG 0: 81513
1: 207817
2: 222817
3: 151393
4: 177060
970882407_970882414 -4 Left 970882407 4:20947398-20947420 CCCTCATGTGGTCCACCTGCCTC 0: 1
1: 4
2: 132
3: 331
4: 878
Right 970882414 4:20947417-20947439 CCTCGGCCTCCCAAAGTGCTGGG 0: 120847
1: 270445
2: 211583
3: 123288
4: 170743
970882407_970882416 4 Left 970882407 4:20947398-20947420 CCCTCATGTGGTCCACCTGCCTC 0: 1
1: 4
2: 132
3: 331
4: 878
Right 970882416 4:20947425-20947447 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970882407 Original CRISPR GAGGCAGGTGGACCACATGA GGG (reversed) Intronic
900401828 1:2475892-2475914 GAGGCAGGTGGCCCAGAGCAGGG - Intronic
900587380 1:3439797-3439819 GAGGCAGGAGGGCCCCAGGAAGG - Intergenic
900650725 1:3728870-3728892 GAGGCAGGAGGATCACCTGAGGG + Intronic
901009623 1:6192464-6192486 AAGGCGGGTGGATCACTTGAGGG + Intronic
901091892 1:6647312-6647334 GAGGCAGGTGGATCACCTGGGGG - Intronic
901296542 1:8165432-8165454 GAGGCAGGAGGATCACTCGAGGG - Intergenic
901342621 1:8509176-8509198 GAGGCAGGCGGATCCCTTGAGGG - Intronic
901367720 1:8767728-8767750 AAGGCAGGCGGATCACTTGAAGG + Intronic
901574722 1:10191678-10191700 GAGGCAGGCGGATCACATGAGGG + Intergenic
901701657 1:11047664-11047686 AAGGCAGGTGGATCACCTGAGGG - Intergenic
901754257 1:11431591-11431613 GAGGTGGGTGGATCACCTGAGGG - Intergenic
901754311 1:11432004-11432026 GAGGCGGGCGGATCACCTGAGGG - Intergenic
901778513 1:11576926-11576948 AAGGCGGGTGGATCACCTGAAGG + Intergenic
902042101 1:13500017-13500039 GAGGCAGGCAGATCACCTGAGGG + Intronic
902320907 1:15665028-15665050 AAGGCGGGTGGATCACCTGAGGG + Exonic
902412999 1:16222659-16222681 GAGGCAGGCAGATCACTTGAGGG - Intergenic
902433292 1:16380241-16380263 GAGGCAGGAGGATCGCTTGAGGG + Intronic
902577938 1:17390065-17390087 GAGGCAGGAGGATCACCTGAGGG + Intronic
902756442 1:18552418-18552440 GGGGCAGGAGGAAGACATGATGG - Intergenic
903052706 1:20613434-20613456 GAGGTGGGTGGATCACCTGAGGG - Intronic
903132201 1:21287292-21287314 GAGGCAGGCAGATCACCTGAGGG + Intronic
903155252 1:21438343-21438365 GAAGCGGGTGGATCACCTGAAGG - Intergenic
903251878 1:22060108-22060130 GAGGCAGGCAGATCACCTGAGGG + Intronic
903297777 1:22356109-22356131 AAGGCAGGCGGATCACTTGAGGG + Intergenic
903881352 1:26511907-26511929 GAGGCAGGTAGATCACTTGAGGG - Intergenic
903988174 1:27244576-27244598 GAGGCAGGAGGATCACTTGAAGG - Intronic
904078184 1:27855481-27855503 AAGGCAGTTGGATCACCTGAGGG - Intergenic
904152645 1:28455099-28455121 GAGACAGGTGGATCACTTGAGGG - Intronic
904338875 1:29819627-29819649 GAGGCAGGTGGATCACCTGAGGG - Intergenic
904522867 1:31109556-31109578 AAGGCGGGTGGATCACCTGAGGG - Intergenic
904673409 1:32182427-32182449 GAGGCGGGTGGATCACCTGAGGG + Intronic
904697961 1:32341027-32341049 GAGGCAGGCAGATCACTTGAGGG + Intergenic
904781652 1:32954141-32954163 GAGGCAGGAGGATCACTTGAAGG - Intronic
905476349 1:38231110-38231132 GAGGCGGGTGGATCACTTGAGGG + Intergenic
905587429 1:39131876-39131898 GAGGCAGGAGGATCACTTGAAGG - Intronic
905680596 1:39868409-39868431 GAGGCAGGTGAATCATCTGAGGG + Intronic
905696098 1:39974759-39974781 GAGGCAGATGGTCCACAACATGG + Intergenic
905714380 1:40135451-40135473 GAGGCGGGTGGATCACCTGAGGG - Intergenic
905987640 1:42301432-42301454 GAGGCGGGTGGATCACTTGAGGG - Intronic
906066304 1:42983161-42983183 AAGGCAGGTGGATCACCTGAGGG - Intergenic
906118583 1:43372123-43372145 GAGGCAGGAGAACCACTTGAAGG + Intergenic
906419624 1:45653928-45653950 GAGGCGGGTGGATCACCTGAGGG - Intronic
906445209 1:45890450-45890472 CAGGCTGGTGTACCACATAAAGG - Intronic
906645342 1:47470580-47470602 GAGTCAGGTGGACCTTAAGAAGG + Intergenic
907035947 1:51216413-51216435 GAGGCTGGCGGATCACTTGAGGG - Intergenic
907042688 1:51277644-51277666 GAGGCAGGCGGATCACCTGGAGG - Intergenic
907470427 1:54670371-54670393 GAGGCGGGAGGAGCACTTGAGGG + Intronic
907883704 1:58574640-58574662 GACGCAGGTGGATCACCTGAGGG + Intergenic
907933046 1:59017916-59017938 GAGGCGGGAGGACCACTTGAAGG - Intergenic
908187849 1:61669820-61669842 GAGGCAGGTGGATCACCTGAGGG + Intergenic
908198699 1:61771951-61771973 AAGGCAGGTGGATCACCTGAGGG - Intronic
908554981 1:65248739-65248761 GAGGCAGGAGAATCACTTGAAGG - Intronic
908733920 1:67256316-67256338 GAGCCAGGTGGAGCCCAAGAAGG + Intronic
908847361 1:68338644-68338666 GAGGCGGGTGGATCACCTGAGGG + Intergenic
909642736 1:77886157-77886179 GAGGTGGGTGGATCACTTGAGGG + Intergenic
910254543 1:85234725-85234747 GAGACAGGTGGATCACTTGAGGG - Intergenic
910604216 1:89066209-89066231 GAGGCAGGGGGATCATTTGAAGG - Intergenic
911041030 1:93591241-93591263 GAGGTGGGTGGATCACTTGAGGG + Intronic
911076500 1:93880419-93880441 GAGGCGGGTGAATCACCTGAAGG - Intergenic
911647214 1:100350184-100350206 GAGGCAGGTGGATCACCTGAGGG - Intergenic
911889833 1:103354161-103354183 AAGGCTGGTGGATCACCTGAGGG - Intergenic
911969802 1:104417712-104417734 GAGGCAGGTGGATCACCTGAGGG - Intergenic
912331984 1:108828341-108828363 GCTGCAGGTGGGCCACAGGAAGG - Intronic
912402741 1:109408920-109408942 GAGACAGGTGGATCGCTTGAGGG - Intronic
912691079 1:111805040-111805062 GTGGCGGGTGGATCACATAAAGG + Intronic
913018735 1:114765305-114765327 GAGGTGGGTGGATCACTTGAGGG - Intergenic
913178924 1:116300557-116300579 GAGGCAGGCGGATCACCTGAGGG - Intergenic
913976933 1:143467175-143467197 GAGGTGGGTGGATCACTTGAGGG - Intergenic
914071335 1:144292802-144292824 GAGGTGGGTGGATCACTTGAGGG - Intergenic
914107820 1:144673554-144673576 GAGGTGGGTGGATCACTTGAGGG + Intergenic
914786312 1:150835029-150835051 GAGGCAGGAGGACTGCTTGAGGG + Intronic
914818199 1:151078901-151078923 GAGGCAGGCGGGTCACTTGAGGG - Intronic
914830808 1:151169655-151169677 GAAGCAGGCAGACAACATGAAGG - Exonic
914842112 1:151256978-151257000 GAGGCGGGCGGATCACCTGAGGG - Intronic
914851697 1:151319239-151319261 GAGGCAGGTGGATCACTTTGAGG + Intronic
915060247 1:153175851-153175873 AAGGCAGGTGGATCACCTGAGGG + Intergenic
915126550 1:153669671-153669693 GAGGCAGATGGATTACCTGAAGG - Intronic
915132313 1:153704135-153704157 GAGGCAGGAGGATCACTTGAGGG + Intergenic
915191674 1:154155996-154156018 GAGGCAGGTGGATCACCTGAAGG + Intronic
915200713 1:154226043-154226065 GAGGCAGGTGGATCACCTGAGGG - Intronic
915370975 1:155350251-155350273 GAGGCAGGTGAATCACCTGAGGG - Intronic
915380614 1:155436421-155436443 GAGGCAGCTGGATCACCTGAGGG - Intronic
915728927 1:158039032-158039054 GAGCCAGGCTGACCACATGCTGG + Intronic
915750654 1:158206800-158206822 GAGGCAGGCGGATCACTTGAGGG - Intergenic
916056725 1:161073361-161073383 GAGGCTGGTGGAGGACAAGAGGG - Intronic
916771812 1:167916436-167916458 AAGGCAGGTGAATCACCTGAGGG - Intergenic
917374112 1:174330346-174330368 GAGGCAGGAGGATCTCTTGAAGG + Intronic
917446788 1:175112852-175112874 GAGGCAGGCAGATCACTTGAAGG - Intronic
917781388 1:178400980-178401002 AAGGTAGGTGGATCACCTGAGGG - Intronic
917790142 1:178494161-178494183 GAGGCAGGAGGATCATTTGAAGG + Intergenic
918600626 1:186355134-186355156 GAGGCAGGTGGGTCATTTGAGGG - Intronic
918640178 1:186830374-186830396 GAGGCGGGTGGATCACTTGAGGG + Intronic
918830207 1:189386103-189386125 GAGGCAGGTGGATCACCTGAGGG - Intergenic
919294350 1:195675818-195675840 GAGGTGGGTGGATCACCTGAGGG - Intergenic
919396781 1:197059462-197059484 CAGGCAGGTGAAAGACATGAAGG - Intronic
919696525 1:200582140-200582162 GAGGCAGGAGGATCACTTGAAGG + Intronic
919821194 1:201473117-201473139 GAGGCTGGTGGATCGCCTGAGGG - Intergenic
919849184 1:201660887-201660909 GTGGCAGGGGGAGCACATGAGGG + Intronic
919909160 1:202099887-202099909 GAGGCAGGTGGATCACCTTGAGG - Intergenic
919942211 1:202296103-202296125 AGGGCAGGGGGACCACATGGAGG - Intronic
920143161 1:203834873-203834895 GAGGCGGGTGGATCACCTGAGGG - Intronic
920199074 1:204248383-204248405 AAGGCGGGTGGATCACCTGAGGG - Intronic
920335606 1:205243150-205243172 GAGGTGGGTGGATCACTTGAGGG + Intronic
920383099 1:205547305-205547327 AAGACAGGTGGATCACTTGAGGG + Intergenic
920419913 1:205826081-205826103 GAGGCAGGAGGATCGCTTGAGGG - Intergenic
920759499 1:208768819-208768841 TAGGCTGGTGGATCACCTGAGGG - Intergenic
920997323 1:211007505-211007527 GAAACGGGAGGACCACATGAGGG - Intronic
921647229 1:217632964-217632986 GAGGCAGATGGATCACTTGAGGG + Intronic
921708909 1:218353663-218353685 GAGGCGGGAGGATCACTTGAGGG + Intronic
921888978 1:220334952-220334974 GAGGCAGGAGAATCACTTGAGGG - Intergenic
922434181 1:225586790-225586812 AAGGCAGGCGAACCACTTGAGGG + Intronic
922648069 1:227311120-227311142 AAGGCAGGCGGATCACTTGAGGG + Intronic
922822629 1:228494520-228494542 GAGGCAGGTGGAGCACAGGGAGG - Exonic
923610561 1:235488820-235488842 GAGGCTGGTGGATCCCTTGAGGG + Intronic
923855722 1:237843434-237843456 AAGGCGGGTGGATCACCTGAAGG + Intergenic
924340635 1:243027191-243027213 GAGGCAAGAGGATCACTTGAGGG + Intergenic
924364956 1:243283077-243283099 GAGGCAGGCGGATCATGTGAGGG - Intronic
924445620 1:244127773-244127795 GAGGAAGGTGGGCCTCATTAGGG - Intergenic
924448746 1:244158824-244158846 AAGGCAGGTGGATTACTTGAGGG - Intergenic
1062871631 10:909551-909573 AAGGCAGGTGGATCACCTGAGGG + Intronic
1063471014 10:6285462-6285484 GAGGCAGGTGGATCACTTGAGGG - Intergenic
1063637833 10:7800724-7800746 AAGGCAGGTGGATCACTTGAGGG - Intronic
1064050606 10:12056376-12056398 GAAGCGGGTGGATCACCTGAGGG - Intergenic
1064134673 10:12740365-12740387 GAGGCAGGCGAATCACCTGAGGG + Intronic
1064150817 10:12863098-12863120 GAGGCGGGTGGATCACCTGAGGG + Intergenic
1064217724 10:13414613-13414635 GAGGCGGGTGGACCACTTGAGGG - Intergenic
1064391115 10:14942891-14942913 GAGGCGGGAGGATCACCTGAGGG + Intronic
1064401472 10:15024912-15024934 GAGGCGGGAGGATCACCTGAGGG + Intergenic
1064659790 10:17595088-17595110 GAGGCGGGTGGATCACCTGAAGG - Intronic
1065220836 10:23494142-23494164 GAGGCAGGTGGATCATTGGAAGG + Intergenic
1065285921 10:24187657-24187679 GAGGCAGGTGGATCACCTGAGGG + Intronic
1065355012 10:24832167-24832189 CAGGCAGGAGGATCACTTGATGG + Intergenic
1066120144 10:32278271-32278293 AAGGCAGGTGGATCACTTGAGGG - Intronic
1066567924 10:36739844-36739866 AAGGCGGGTGGATCACTTGAGGG + Intergenic
1066683516 10:37958814-37958836 GAAGCAGGTGGATAACCTGAAGG + Intronic
1067095004 10:43294485-43294507 GAGGTAGGGGGACCACAGGTCGG - Intergenic
1068234989 10:54221832-54221854 GAGGCCAGTGGATCACCTGAGGG - Intronic
1068533781 10:58217455-58217477 GAGGCAGGTGGATCACCTGAGGG + Intronic
1068869124 10:61924970-61924992 GAGGCGGGTGGATCACTTAAAGG + Intronic
1069388755 10:67910141-67910163 GAGGTAGGTGGATCGCTTGAGGG + Intronic
1069485533 10:68820371-68820393 GAGGCAGGTGGATCACTTGAGGG - Intergenic
1069644820 10:69986730-69986752 GAGGCGGGTGGATCACCTGAGGG - Intergenic
1069784105 10:70977103-70977125 GAGGAAGGTGGCCCATATGAGGG + Intergenic
1069832694 10:71290887-71290909 GGGACAGGAGGACCACATAAGGG - Intronic
1069946590 10:71990592-71990614 GAGGCAGGTGGATCACCTGAGGG - Intronic
1070072692 10:73105043-73105065 GAGGCTGGTGGATCACTTGAGGG + Intergenic
1070253276 10:74791784-74791806 GAGGCAGGTGGATCACTTGAAGG + Intergenic
1070281917 10:75056140-75056162 GAGGCAGGAGGATCGCTTGAGGG - Intronic
1070368392 10:75758129-75758151 GAGGCAGGTGAACCGTAAGAGGG + Intronic
1070545646 10:77450285-77450307 GAGGCAGGTGGATCACCTCAGGG - Intronic
1070720165 10:78751502-78751524 AAAGCAGGTGGATCACCTGAGGG - Intergenic
1071300483 10:84252743-84252765 GAGGCTGGTGGATCACTTGAAGG + Intronic
1071535848 10:86429384-86429406 GTGGCAGGAGGATCACTTGAGGG - Intergenic
1071556878 10:86611208-86611230 AAGGTAGGTGGATCACCTGAGGG - Intergenic
1071707048 10:88010633-88010655 GAGGCAGGCGGATCACCTGAGGG - Intergenic
1072081624 10:92038356-92038378 AAGGCAGGTGGATCACTTGAGGG + Intergenic
1072239313 10:93480705-93480727 GAGGTGGGTGGATCACATGAGGG - Intronic
1072312164 10:94167056-94167078 AAGGCAGGTGGATCACCTGAGGG + Intronic
1072731236 10:97848741-97848763 GAGACGGGTGGATCACCTGAGGG - Intergenic
1072872146 10:99131878-99131900 GAGGCAGGAGGATCACCTGAGGG + Intronic
1073272232 10:102275084-102275106 GAGGCCGGTGGATCACTTGAGGG - Intronic
1073400715 10:103254938-103254960 GAGGCAAGAGGATCACCTGAGGG - Intergenic
1073797249 10:107001693-107001715 GAGGCAGGCAGATCACCTGAGGG - Intronic
1073806216 10:107101275-107101297 AAGGCGGGTGGATCACCTGAAGG - Intronic
1074569507 10:114611716-114611738 AAGGCAGGTGCAGCACATCAGGG - Intronic
1074803182 10:117022822-117022844 GAGGCAGGAGAATCACTTGAAGG + Intronic
1074853379 10:117456242-117456264 GAGGCAGGTGGATCACCTGAGGG + Intergenic
1075011919 10:118879354-118879376 GAGGTAGGCGGATCACCTGAGGG + Intergenic
1075334915 10:121601690-121601712 GAGGCAGGCGGATCACTTGAAGG + Intergenic
1075364370 10:121871221-121871243 GAGGCGGGTGGATCACCTGAGGG + Intronic
1075703023 10:124481610-124481632 GAGGTGGGTGGATCACTTGAGGG - Intronic
1075918636 10:126191231-126191253 GAGGCAGGCAGATCACTTGAGGG - Intronic
1075962386 10:126580422-126580444 GAGGCAGGTGGATCACAGTCAGG + Intronic
1076372585 10:129964777-129964799 GAGGCAGGTCGACCGCAGGGAGG + Intergenic
1076800251 10:132818619-132818641 GAGGTGGGTGGATCACCTGAGGG + Intronic
1077067778 11:651189-651211 GAGGCAGGTGGATCACCGGTCGG - Intronic
1077197479 11:1288653-1288675 GAGGCAGGGGGACGACAAGGAGG - Exonic
1077298619 11:1837362-1837384 CAGGGAGGTGGACCGCATGCTGG + Exonic
1077507412 11:2936944-2936966 AAGGCAAGTGGATCACCTGAGGG - Intergenic
1077784341 11:5366373-5366395 GAGGCAGGAGGATCACCTGAGGG + Intronic
1078236045 11:9485576-9485598 AAGCCAGGTGGATCACTTGAGGG - Intronic
1078286669 11:9963231-9963253 GAGGCGGCTGGATCACTTGAGGG + Intronic
1078292397 11:10025830-10025852 AAGGCAGGTGGATCACTTTAGGG - Intronic
1078367525 11:10719029-10719051 GAGGCAGGAAAACCACATTACGG - Intergenic
1078519406 11:12051217-12051239 GAGGCAGGAGCCCCACATCATGG + Intergenic
1078643486 11:13117158-13117180 GAGGCTGCTGGACAAGATGATGG + Intergenic
1078888273 11:15527684-15527706 AAGGCAGGCAGACCACCTGAGGG + Intergenic
1079071077 11:17348176-17348198 GAGGCAGGAGGACTGCTTGAGGG - Intronic
1079372463 11:19863247-19863269 GGGGCATGTTGACCACATAAAGG - Intronic
1079394860 11:20052983-20053005 GAGGTAGGTGGATCACTTGAGGG + Intronic
1079512918 11:21232065-21232087 GCGGCGGGTGGATCACCTGAGGG + Intronic
1080541509 11:33270209-33270231 GAGGCAGGTGGATCACCTGAGGG - Intronic
1080558467 11:33439141-33439163 AAGGCAGGTGGATCACCTGAGGG - Intergenic
1080832341 11:35907402-35907424 GAGGCAGGAGGATCTCTTGAAGG - Intergenic
1080996456 11:37608220-37608242 GAGGAGGGTGGATCACCTGAAGG + Intergenic
1081155046 11:39680035-39680057 AAGGCAGCTGCCCCACATGATGG - Intergenic
1081881046 11:46452412-46452434 GAGGCAGGAGGATCACTTAAGGG - Intronic
1081902597 11:46642015-46642037 GAGGCAGTTGGATCACTTGCAGG - Intronic
1082200839 11:49364875-49364897 GAGGCAGGTGGATCGCTTGATGG + Intergenic
1082767303 11:57180084-57180106 GGGGCAGGGGGACCGCAGGACGG + Intergenic
1082860064 11:57847083-57847105 GAGGCAGGTGGATCACTTGAGGG - Intergenic
1082939460 11:58688657-58688679 GAGGCAGGTGGATCACTTGAAGG - Intronic
1083057256 11:59834622-59834644 GAGGCGGGTGGATCAGTTGAGGG - Intronic
1083284516 11:61649671-61649693 GAGGCAGGAGGATCACTTGAGGG - Intergenic
1083653006 11:64214576-64214598 GAGGCAGGTGGATCGCCTGAGGG - Intronic
1083773972 11:64884146-64884168 GTGGCAGCTGGGCCACAGGACGG - Intronic
1083957094 11:65990166-65990188 AAGGCGGGTGGATCACCTGAGGG + Intergenic
1084043134 11:66554204-66554226 GAGGCGGGCAGACCACTTGAAGG + Intronic
1084487567 11:69458846-69458868 AAGGCAGGTGGATCATTTGAGGG - Intergenic
1084865988 11:72057836-72057858 GAGGCAGGTGGATCGCCTGAGGG + Intronic
1084885113 11:72199086-72199108 GAGGCAGGCGGATCACTTGAGGG + Intergenic
1085085299 11:73662628-73662650 GAGACTGGTGGACCACCTGAGGG - Exonic
1085110768 11:73885608-73885630 GAGGTGGGTGGATCACCTGAGGG + Intronic
1085334175 11:75678535-75678557 GAGGCATGTGGACAACTGGAGGG + Intergenic
1085432678 11:76467758-76467780 GAGGCAGGCGGATCACCTGAGGG + Intronic
1085579967 11:77641631-77641653 GAGGTGGGTGGATCACTTGAAGG - Intergenic
1085616265 11:78001518-78001540 AAGGCAGGAGGATCACTTGAGGG - Intergenic
1085801246 11:79591676-79591698 GAGGCAGGTGGATCACTTGAAGG - Intergenic
1086091587 11:83009996-83010018 AAGGCAGGAGGATCACTTGAGGG - Intronic
1086107610 11:83163000-83163022 GAGGCAGGTGGATCACCTGAGGG - Intronic
1086268465 11:85029800-85029822 GAGGCAGGAGAATCACTTGAAGG - Intronic
1086655798 11:89353048-89353070 GAGGCAGGTGGATCGCCTGAGGG - Intronic
1087351565 11:97040069-97040091 GAGTCAGGAGGCACACATGAAGG - Intergenic
1087666763 11:101058164-101058186 GAGGTAGGTGAAACACATTAAGG + Intronic
1087776629 11:102262550-102262572 GAGGCAGGCAGATCACTTGAGGG + Intergenic
1088129711 11:106472649-106472671 GAGGCAGATGGACCTCACCAGGG + Intergenic
1088552054 11:111023138-111023160 GAGGTAGGAGGACCACAGCAAGG + Intergenic
1088652652 11:111972093-111972115 GAAGCAGGTGGTACACATGCAGG - Intronic
1088851882 11:113711477-113711499 GAGGTGGGTGGATCACTTGAGGG + Intergenic
1089011440 11:115135380-115135402 GAGGCGGGTGGATGACCTGAGGG + Intergenic
1089495290 11:118905275-118905297 GAGGCGGGCGGATCACTTGAGGG + Intronic
1089734850 11:120543339-120543361 GAGGCAGGTGGATCACCTGAGGG + Intronic
1089780630 11:120870977-120870999 GAGGCAGGTGGATCACTTTGAGG - Intronic
1090007094 11:123012294-123012316 GAGGTGGGTGGATCACCTGAAGG - Intergenic
1090393002 11:126401622-126401644 GAGGCAGGAGGAAAACCTGAAGG + Intronic
1090701353 11:129298710-129298732 GAGGAGGGTGGATCACCTGAGGG + Intergenic
1092222701 12:6725957-6725979 AAGGCAGGTGGATCACCTGAGGG + Intronic
1092236019 12:6810119-6810141 GAGGCAGGTGGATCACCTGAGGG - Intronic
1092274416 12:7048367-7048389 GAGGCAGGTGGATCACCTGAGGG - Intronic
1092374516 12:7944171-7944193 GAGGCAGGCAGATCACCTGAGGG + Intergenic
1092876863 12:12856173-12856195 GAGGAAGGTGTCCCACATAAGGG - Intergenic
1093449156 12:19295998-19296020 AAGGCAGGTGCATCACCTGAGGG + Intronic
1093449473 12:19298598-19298620 GAGGCGGGTGGATCACCTGAGGG - Intronic
1093531210 12:20166428-20166450 GAGGCAGGTGGATCACCTGAGGG + Intergenic
1093697356 12:22176665-22176687 GAGGCAAGTGGATCACTTGAGGG + Intronic
1093824033 12:23659733-23659755 GAGGTGGGTGGATCACGTGAGGG + Intronic
1093826263 12:23693353-23693375 GAGGCAGGTGGATCACTTGAGGG - Intronic
1093864143 12:24204558-24204580 GAGGCAGGTGGATCACTTGAGGG - Intergenic
1094143450 12:27204466-27204488 GAGGCAGGCGGATCACTTGAGGG - Intergenic
1094436971 12:30431356-30431378 GAGGTGGGTGGATCACCTGAGGG + Intergenic
1094549339 12:31435891-31435913 GAGGTGGGCGGATCACATGAAGG - Intronic
1094691834 12:32777047-32777069 GAGGCAGGTGGATCACCTGGAGG - Intergenic
1095125067 12:38467130-38467152 GAGGTAGGTGGATCACTTGAGGG + Intergenic
1095213704 12:39524256-39524278 AAGGCAGGTGGATCACAACAAGG + Intergenic
1095420072 12:42016244-42016266 GAGGCAGGCAGATCACCTGAGGG - Intergenic
1095462455 12:42456941-42456963 GAGGCAGGTGGATCACCTGAAGG + Exonic
1095708897 12:45267556-45267578 GAGGCGGGTGGATCACTTGAGGG + Intronic
1095729883 12:45494857-45494879 GAGGTAGGAGGATCACTTGAGGG + Intergenic
1096254042 12:50052118-50052140 GAGGCAGGTGGATCACTTGAGGG - Intergenic
1096562996 12:52450473-52450495 GAGGCAGCTGGACAACATCGTGG - Exonic
1096719175 12:53508328-53508350 AAGGCGGGTGGATCACCTGAGGG + Intronic
1096768252 12:53912706-53912728 AAGGCAGGGGGATCACTTGAGGG - Intergenic
1096805149 12:54136046-54136068 GAGGCAGGTGGGGGACAAGAGGG + Intergenic
1096971906 12:55673351-55673373 GAGGCAGGAGGATCCCTTGAGGG + Intergenic
1097231028 12:57511210-57511232 GACGCAGGAGGATCACTTGAGGG - Intronic
1097307332 12:58083977-58083999 GATGCAGGTTGGCCACATGAGGG + Intergenic
1097841023 12:64321404-64321426 GAGGCAGGAGGATCACTTGAGGG - Intronic
1097879356 12:64672960-64672982 GAGGCAGGTGGAGCCCATCTGGG - Intronic
1098129352 12:67332604-67332626 GAGGCAGGCAGATCACTTGAGGG - Intergenic
1098352108 12:69573692-69573714 GAAGCGGGTGGATCACTTGAGGG - Intronic
1098771856 12:74562477-74562499 GAGGCAGGAGGATCACTTGAGGG - Intergenic
1098967496 12:76806604-76806626 GAGGCGGGTGGATCACCTGAGGG - Intronic
1099073331 12:78074468-78074490 AAGGCAGGTGGATCACTTGAGGG + Intronic
1099949384 12:89283845-89283867 GAGGCAGGCAGATCACTTGAAGG + Intergenic
1100125595 12:91420954-91420976 GAGGCGGGTGGATCACATGAGGG + Intergenic
1100334365 12:93615825-93615847 GAGGCGGGAGGATCACTTGAAGG - Intergenic
1100573416 12:95864671-95864693 AAGGCAGGAGGATCACTTGAAGG + Intronic
1100640152 12:96474794-96474816 GAGGCAGGTGGATCACCTGAAGG + Intergenic
1100827668 12:98490012-98490034 AAGGCAGGTGAATCACCTGAAGG - Intronic
1101354904 12:103967686-103967708 GAGGCAGGTGGATCACTTGAGGG - Intronic
1101595221 12:106158703-106158725 GGGGCAGGTTGAGCTCATGATGG + Intergenic
1101641765 12:106590711-106590733 GAGGCAGGAGGATCACTTGAGGG + Intronic
1101874705 12:108590462-108590484 GAGGCAGGTGGATCACCTGAAGG + Exonic
1102129574 12:110516000-110516022 GAGGCAGAAGGATCACTTGAGGG + Intronic
1102530236 12:113540939-113540961 GTGGAAGGGGGACTACATGAGGG + Intergenic
1102653346 12:114459525-114459547 GAGGCAGGTGGATCACGAGGTGG + Intergenic
1102842652 12:116142454-116142476 GAAGCAGGTGGCTCACCTGAGGG + Intronic
1102911154 12:116715163-116715185 GAGGCAGGTGGATCACCTGAAGG - Exonic
1102923296 12:116808829-116808851 GAGCCAGGGGGAGCACAGGACGG - Intronic
1103076905 12:117990760-117990782 GAGGCAGGTGGATCACCTGAGGG + Intergenic
1103094854 12:118124486-118124508 AAGGCAGGTGGATCATTTGAGGG - Intronic
1103445393 12:120991360-120991382 AAGGCAGGTGGCTCACTTGAGGG + Intronic
1103490216 12:121312330-121312352 GAGGCGGGTGGATCACCTGAGGG + Intronic
1103632544 12:122273962-122273984 GAGGCGGGCGGACCACTTGAGGG - Intronic
1103648806 12:122417064-122417086 GAGGCAGGCAGATCACCTGAGGG + Intronic
1103807205 12:123582960-123582982 GAGGCGGGTGGATCATCTGAAGG + Intergenic
1104449117 12:128854726-128854748 GAGGCAGGCGGATCACCTGAGGG - Intronic
1104959927 12:132483812-132483834 GAGGCAGGTGGGCCTCAGGTGGG + Intergenic
1105222295 13:18342640-18342662 GAGGCGGGTGGATCACTTGAGGG + Intergenic
1105254167 13:18729730-18729752 GAGGCAGGAGGATCACCTGAGGG - Intergenic
1105491712 13:20894607-20894629 AAGGCAGGTGGATCACCTGAGGG + Intronic
1105644352 13:22301584-22301606 AAGGCGGGTGGATCACCTGAGGG - Intergenic
1105822436 13:24091576-24091598 AAGGCAGGTGGATCACTTAATGG + Intronic
1106150321 13:27094270-27094292 GAGGCAGGTGGGTTACTTGAGGG + Intronic
1106237016 13:27871235-27871257 GAGGCAGGAGGATCACTTGAGGG - Intergenic
1106399533 13:29416010-29416032 GAGGCAGGAGAATCACTTGATGG - Intronic
1106434602 13:29712548-29712570 AAGGCGGGTGGATCACCTGAGGG + Intergenic
1106435739 13:29721625-29721647 GAGGCATGTGGGCCACTTCATGG + Intergenic
1106700270 13:32221742-32221764 CAGGCGGGTGGATCACTTGAAGG - Intronic
1107520378 13:41174746-41174768 AAGGCAGGAGGATCACATGAGGG - Intergenic
1107528755 13:41261100-41261122 GAGGCAGGCGGATCACCTGAGGG + Intronic
1107844392 13:44496449-44496471 GAGGCGGGTGGATCACCTGAGGG + Intronic
1108035871 13:46290369-46290391 GAGTCAGGTGGACCAGAGGGAGG + Intergenic
1108155082 13:47576497-47576519 GAGGCAGGTGGATCACCTGAGGG - Intergenic
1108204175 13:48071686-48071708 GAGGCAGGTGGATCATCTGAGGG - Intronic
1108248303 13:48539662-48539684 TAAGCAGGAGGACAACATGATGG + Intergenic
1108378083 13:49832319-49832341 GAGGCGGGTGGATCACCTGGTGG - Intergenic
1108906901 13:55487087-55487109 GAGGCAGGTTAATCACTTGAGGG - Intergenic
1109253130 13:60045108-60045130 GAGGCGGGCGGATCACCTGAGGG + Intronic
1109279074 13:60335130-60335152 GAGGCAGGAGGATCACTTGAGGG + Intergenic
1109462460 13:62679619-62679641 GAGGCAGGTGGATAACATGAGGG - Intergenic
1109528571 13:63608219-63608241 AAGGCAGGTGGATCATCTGAGGG + Intergenic
1110216197 13:73027564-73027586 AAGGCAGGAGGATCCCATGAAGG - Intergenic
1110612615 13:77505948-77505970 GAGGGAAGTGGACCACAGTAGGG + Intergenic
1110764146 13:79263777-79263799 GAGGCTGGTGGATCACCTAAGGG + Intergenic
1110846687 13:80197658-80197680 AAGGCAGGTGGATCACTTGAGGG + Intergenic
1110869927 13:80438927-80438949 GAGGTAGGTGGATCACAAGATGG + Intergenic
1110999333 13:82158397-82158419 GAGGCAGGAGGAAGAGATGAGGG - Intergenic
1111041745 13:82757644-82757666 GGGACAGGTGCACCTCATGATGG - Intergenic
1111261877 13:85751464-85751486 AAGGCGGGTGGATCACCTGAGGG + Intergenic
1111341536 13:86892266-86892288 GAGGCAGGCGGATCACCTGAGGG - Intergenic
1111436882 13:88222693-88222715 GAGGCTGGTGGATCACCTGAGGG + Intergenic
1111701249 13:91692873-91692895 GAGGGAGGTGGATCACCTGAGGG - Intronic
1111982261 13:95029069-95029091 GAGGCAGGAGAATCACTTGATGG + Intronic
1112090071 13:96073762-96073784 AAGGCAGGAGGATCACTTGAGGG - Intergenic
1112403321 13:99095306-99095328 GAGGTGGGTGGATCACCTGAGGG + Intergenic
1112479951 13:99766082-99766104 GAAGCAGGAGGATCACTTGAAGG - Intronic
1112577977 13:100653812-100653834 AGGGCAGGTGGACACCATGAGGG + Intronic
1112789882 13:102991565-102991587 AAAGCAGGTGGATCACTTGAGGG + Intergenic
1112895312 13:104292455-104292477 GAGGCAGGAGAGCCACATCAGGG - Intergenic
1113398387 13:109969700-109969722 GAGGCGGATGGATCACTTGAGGG - Intergenic
1113887983 13:113670922-113670944 GAGCCAGGCGGACCACAAGGCGG - Intronic
1114006196 14:18315950-18315972 GAGGCGGGAGGATCACTTGAGGG + Intergenic
1114211306 14:20617417-20617439 GAGGCAGGCGGATCACCTGAGGG + Intergenic
1114413176 14:22519243-22519265 GAGGCAGGTGGATCACTTGAAGG + Intergenic
1114469641 14:22951095-22951117 GAGGCAGGAGGATGACTTGAGGG - Intronic
1114735515 14:25039938-25039960 GAGGCAGGCGGATCACTTGAGGG - Intronic
1114738961 14:25074341-25074363 CTGACATGTGGACCACATGAGGG + Intergenic
1114769236 14:25409894-25409916 GAGGCAGGCAGATCACCTGAGGG + Intergenic
1115018418 14:28645142-28645164 GAGGCAGGAGAACCGCTTGAAGG + Intergenic
1115219584 14:31046186-31046208 GAGGCTGGTGGATCACCTGAGGG - Intronic
1115326879 14:32149536-32149558 GAGGCAGGTGGATCACCTGAGGG + Intronic
1115600069 14:34947619-34947641 GAGGCAGGCAGATCACCTGAGGG - Intergenic
1115633874 14:35271791-35271813 AAGGCAGGTGGATCACTTGAGGG + Intronic
1115983243 14:39076993-39077015 GAGGTGGGTGGATCACCTGAGGG + Intronic
1116020451 14:39453988-39454010 GAGGCAGGTGGATCACTTGAGGG - Intergenic
1116881866 14:50178577-50178599 GAGGCAGGAGGATCACTTGGAGG - Intronic
1117011772 14:51477967-51477989 GAGGCAGGTGGATCACCTGAGGG - Intergenic
1117181264 14:53194170-53194192 GAAGCAGGTGGATCACTTGCGGG - Intergenic
1117483473 14:56171632-56171654 GAGGCAGATGGGCCAGATGGGGG + Intronic
1117877969 14:60275701-60275723 GAGGTGGGAGGACCACTTGAGGG - Intronic
1117982184 14:61352429-61352451 GAGGCAGATGGATCATTTGAGGG + Intronic
1118064418 14:62175310-62175332 GAAGCAGGAGGATCACTTGAGGG + Intergenic
1118825986 14:69381920-69381942 GAGGCGGCTGGATCACTTGAGGG - Intronic
1119339666 14:73866233-73866255 GAGGTGGGTGGATCACCTGAAGG - Intronic
1119375889 14:74192517-74192539 AAGGCAGGCGGACTACCTGAGGG - Intronic
1119453678 14:74735664-74735686 GAGGCAGGAGAATCACTTGAAGG - Exonic
1119623179 14:76148385-76148407 GGGGCAGGAGGATCACTTGATGG + Intergenic
1119760865 14:77150797-77150819 GAGGTGGGTGGATCACCTGAAGG - Intronic
1119904384 14:78288209-78288231 GAGGCGGGTGGATCACCTGAGGG - Intronic
1120808659 14:88780182-88780204 GAGGCAGGTGGATCACTTAGAGG - Intronic
1121082320 14:91118324-91118346 GAGGCAGGTGGATCACTTGGAGG - Intronic
1121201071 14:92118739-92118761 GAGGCGGGTGGACGACAACAAGG + Intronic
1121270453 14:92634309-92634331 GAGGTGGGTGGATCACCTGAAGG - Intronic
1121457769 14:94049659-94049681 GAGGCAAGAGGATCACTTGAGGG + Exonic
1121545064 14:94757154-94757176 GAGGCAGGTGGATCACTTGACGG - Intergenic
1121748994 14:96330530-96330552 GAGGCAGGTGGATCACTGGAGGG + Intronic
1121908329 14:97767494-97767516 GAGGCGGGTGGATCATCTGAGGG - Intergenic
1122472876 14:101983906-101983928 GAGGCAGGTGGAACACTTGAAGG - Intronic
1122495631 14:102152644-102152666 GAGGCAGGTGGATCATATGAGGG - Intronic
1122708925 14:103641154-103641176 GAGGCAGGTGGATCACTTAAGGG - Intronic
1122710506 14:103653550-103653572 AAGGCAGGCGGATCACTTGATGG - Intronic
1122757436 14:103993222-103993244 GAGGCAGGTGGATCACTTCATGG - Intronic
1123003121 14:105307235-105307257 GAGGCAGGTGGGACTCATGATGG - Exonic
1123221430 14:106860464-106860486 AATGCAGGTGGACAACATGGAGG - Intergenic
1123390117 15:19862615-19862637 GAGGCGGGAGGATCACTTGAGGG + Intergenic
1123810394 15:23919539-23919561 GTGGCAGGTAGACCCAATGATGG - Intergenic
1123857961 15:24433791-24433813 GAGGCAGATGGATCACTTGAGGG - Intergenic
1123913587 15:24997043-24997065 GAGGCGGGTGGATCACCTGAGGG + Intergenic
1124010511 15:25835029-25835051 GAGGCAGGATGATCACTTGAGGG + Intronic
1124157090 15:27235411-27235433 GAGCCATGTGGAGCAAATGATGG - Intronic
1124186842 15:27538071-27538093 AAGGCGGGTGGATCACCTGAAGG - Exonic
1124206615 15:27726063-27726085 AAGGCGGGTGGATCACCTGAGGG + Intergenic
1124700518 15:31908248-31908270 GAGGCGGGTGGATCACCTGAGGG - Intergenic
1124828262 15:33121760-33121782 GAGGCAGGCGGATCACTTGAGGG - Intronic
1125280654 15:38039095-38039117 GAGGCAGGTGGAAAAAATGCAGG + Intergenic
1125365758 15:38913895-38913917 AAGGCGGGTGGATCACCTGAGGG - Intergenic
1125439549 15:39687383-39687405 AAGGCGGGTGGATCACCTGAGGG - Intronic
1126039190 15:44574233-44574255 GAGGCGGGTGGATTACTTGAGGG - Intronic
1126315802 15:47368233-47368255 GAGGCAGCTGGATGAGATGAAGG + Intronic
1126487206 15:49194824-49194846 AAGGCAGGCGGATCACCTGAGGG - Intronic
1126554816 15:49974319-49974341 GAGGTGGGTGGATCACCTGAGGG - Intronic
1126746849 15:51834732-51834754 GAGGCAGGAGGATCATCTGAGGG + Intronic
1126917745 15:53484391-53484413 GAGGCGGGCGGATCACTTGAGGG + Intergenic
1127140024 15:55965881-55965903 GAGGCAGGCGGATCAGTTGAGGG - Intronic
1127182283 15:56434188-56434210 GAAGCAGCTGGAACACAGGAGGG - Exonic
1127290479 15:57565975-57565997 TAGGCATGTGGATCACTTGAGGG + Intergenic
1127297210 15:57619472-57619494 GAGGCAGGAGGATCACTTGAGGG - Intronic
1127495726 15:59510132-59510154 AAGGCAGATGGATCACCTGAGGG + Intronic
1127561836 15:60146244-60146266 AAGGCAGGTGGATCACCTGAGGG - Intergenic
1127675760 15:61237085-61237107 GAGGCAGGCAGATCACCTGAGGG - Intergenic
1127789002 15:62381651-62381673 GAGGCGGGTGGATCACTTGAGGG - Intergenic
1127811255 15:62567601-62567623 AAGGCGGGTGGATCACTTGAGGG + Intronic
1128018241 15:64367033-64367055 GAGGCAGGAGGATCACTTCAAGG + Intronic
1128140562 15:65297572-65297594 GAGGCGGGTGGATCACTTGAGGG - Intronic
1128202451 15:65820912-65820934 GAGGCAGGTGGATCACGAGGAGG - Intronic
1128288844 15:66461256-66461278 GAGGCAGGTGGATCATGGGAGGG + Intronic
1128336140 15:66786909-66786931 GAGGCAGGTGTACATCCTGAGGG - Intergenic
1128487602 15:68110361-68110383 GAGGTGGGTGGATCACCTGAAGG + Intronic
1128617621 15:69122285-69122307 GAGGCAGGCAGATCACTTGAGGG + Intergenic
1129077776 15:73012097-73012119 GAGGTGGGTGGACCACTTGAGGG - Intergenic
1129377230 15:75141501-75141523 GAGGCAGGTGGATTACCTGAGGG + Intergenic
1129518953 15:76173699-76173721 GAGGCAGGCAGATCACCTGAGGG + Intronic
1130646495 15:85731848-85731870 GAGGCAAGTGGATCACCTGAGGG + Intronic
1130736332 15:86554089-86554111 GAGGCAGGTGGATCACCTGAGGG - Intronic
1131238990 15:90722051-90722073 GAGGCAGGTGGATCACTTAAGGG + Intronic
1131322144 15:91404684-91404706 AAGGCAGGCGGATCACCTGAGGG - Intergenic
1132142981 15:99410028-99410050 GAGGCGGGTGGATCACTTGAGGG + Intergenic
1132884055 16:2174718-2174740 GAGGCAGGCGGGCCACCTGGAGG - Intronic
1133182662 16:4069862-4069884 GAGGCAGGTGGATCACTTGAGGG + Intronic
1133357185 16:5145216-5145238 GAGGAGGGTGGATCACCTGAGGG - Intergenic
1133388498 16:5389928-5389950 GAGGAAGGGGGATCACCTGAAGG - Intergenic
1133525956 16:6605866-6605888 GAGGCGGGTGGATCACTTGAGGG + Intronic
1133688652 16:8191356-8191378 GAGGCAGGTGGATCACTTCTTGG + Intergenic
1133754982 16:8755677-8755699 GAGGTGGGTGGATCACTTGAGGG + Intronic
1133755409 16:8758864-8758886 GAGGCAGGCAGAGCACTTGAGGG + Intronic
1133789507 16:8998716-8998738 GAGGCAGGTGGATCACCTGAGGG - Intergenic
1133941633 16:10314116-10314138 AAGGCAGGTGGATCACCTGACGG - Intergenic
1134155904 16:11843300-11843322 GTGGCAGGTGGATCAGTTGAGGG - Intronic
1134243027 16:12519755-12519777 GAGGCAGGTGGATCACCTGAGGG + Intronic
1134447367 16:14341069-14341091 GAGGTGGGTGGATCACCTGAGGG + Intergenic
1134618227 16:15668264-15668286 GAGGCAGGAGAATCACTTGATGG + Intronic
1134625863 16:15722088-15722110 GAGGCAGGAGGCTCACTTGAGGG - Intronic
1135111981 16:19697429-19697451 GAGGCTGGAGGATCACTTGAGGG - Intronic
1135170260 16:20177629-20177651 GAGGCAGGTTGACAAGATGGGGG + Intergenic
1135213052 16:20540472-20540494 AAGGCGGGTGGATCACCTGAGGG - Intronic
1135539815 16:23321271-23321293 GAGGCAGGTGGATCACTTGAGGG - Intronic
1135582947 16:23643422-23643444 GAGGTGGGTGGATCACTTGAGGG - Intronic
1135589241 16:23693353-23693375 GAGGTAGGTGAATCACCTGAGGG + Intronic
1135686746 16:24503844-24503866 GAGGCAGGCAGATCACCTGAGGG + Intergenic
1135809252 16:25572586-25572608 GAGGCAAGAGGATCACTTGAGGG - Intergenic
1136023728 16:27456559-27456581 GAGGTGGGTGGATCACCTGAGGG + Intergenic
1136121978 16:28142940-28142962 GAGGCAGGAGGATCACTTGAGGG - Intronic
1136479300 16:30531913-30531935 GAGGTGGGTGGATCACCTGAGGG + Intronic
1136525574 16:30827614-30827636 GAGGCAGGCGGATCACCTGAGGG + Intergenic
1136563133 16:31052913-31052935 GAGGTGGGTGGATCACCTGAGGG - Intergenic
1136594199 16:31236165-31236187 AAGGCGGGTGGATCACCTGAGGG + Intergenic
1137430314 16:48413177-48413199 GAAGCAGGCAGACCACTTGAAGG - Intronic
1137600521 16:49753010-49753032 GAGGCAGGTGGATCACTTGAGGG + Intronic
1137779409 16:51085098-51085120 GAGGCAGGTGGATCACCTGAGGG + Intergenic
1138569438 16:57859788-57859810 GAGGCGGGCAGACCACTTGAGGG + Intronic
1138619610 16:58200187-58200209 TTGGCAGGAGGACCACATGGGGG - Intergenic
1138662680 16:58533304-58533326 GAGGCAGGCGGGTCACTTGAGGG + Intronic
1138903277 16:61300247-61300269 GAGGCGGGTGGATCACAAGGTGG - Intergenic
1138968419 16:62114504-62114526 GAGGCCAGTGGATCACCTGACGG - Intergenic
1139686340 16:68606521-68606543 GAGGCAGGTGGATCACCTGAGGG + Intergenic
1139698780 16:68694388-68694410 AAGGCAGTTGGATCACTTGAGGG + Intronic
1139744215 16:69061331-69061353 GAGGCAGGTGGATCACCTGAGGG + Intronic
1139820268 16:69715534-69715556 AAGGCGGGTGGATCACTTGAGGG + Intronic
1139918935 16:70446741-70446763 GAGGCAGGCGGATCATCTGAGGG - Intergenic
1139938505 16:70588252-70588274 GAGGTGGGTGGATCACCTGAAGG + Intronic
1140103235 16:71936712-71936734 GAGGCAGGCGGATTACCTGAGGG - Intronic
1140118425 16:72062779-72062801 AAGGCGGGTGGATCACTTGAGGG + Intronic
1140178136 16:72685662-72685684 GAGGCAGGTGGATCACCTGAGGG + Intergenic
1140467237 16:75192302-75192324 GAGGTGGGTGGATCACTTGAGGG - Intergenic
1140492422 16:75349279-75349301 AAGGCAGGTGGATTACTTGAGGG + Intronic
1140883104 16:79217039-79217061 GAGGCAGTTGGATCACTTTAGGG - Intergenic
1141018343 16:80470893-80470915 GAGGAAGGAGAACCACAAGACGG + Intergenic
1141079526 16:81037869-81037891 GAGGTGGGTGGATCACCTGAGGG - Intronic
1141156399 16:81600180-81600202 GAGGCAGGAGAATCACTTGACGG + Intronic
1141289726 16:82706560-82706582 GAGGTGGGTGGATCACCTGAGGG + Intronic
1141298050 16:82788392-82788414 GAGTCACGTGGACCACATCAGGG - Intronic
1141714844 16:85720854-85720876 GAGGCGGGTGGATCACTTGAGGG + Intronic
1141976907 16:87522811-87522833 GCAGCAGGTGGATCACCTGAGGG - Intergenic
1141995341 16:87633568-87633590 GAGGCAGGCGGAGTACCTGAGGG + Intronic
1142003564 16:87678310-87678332 GAGGCGGTTGGATCACCTGAGGG + Intronic
1142219777 16:88848397-88848419 GAGGCAGGTGGATCACGAGGTGG + Intronic
1142253928 16:89004873-89004895 GAGGCAGGCGGAGCAGAGGAGGG + Intergenic
1142347666 16:89564474-89564496 GAGGCGGGTGGATCACCTGATGG + Exonic
1142730934 17:1856761-1856783 GAGGCAGGCAGATCACTTGAGGG - Intronic
1142781408 17:2184128-2184150 GAGGCGGGTGGACCACTGGAGGG + Intronic
1142862851 17:2773987-2774009 GAGGCAGGCAGATCACCTGAGGG - Intergenic
1143001892 17:3799891-3799913 GAGGCAGGTCGATCACCTGAGGG + Intronic
1143054695 17:4154093-4154115 TAGGCTGGTGGACCACTTGCTGG + Intronic
1143056718 17:4168219-4168241 GAGGCAGGCGCATCACTTGAGGG + Intronic
1143075507 17:4339534-4339556 AAGGCAGGTGGATCATCTGAGGG - Intronic
1143439528 17:6958376-6958398 CAGGCAGGTGGATCACTTGAGGG - Intronic
1143906505 17:10213477-10213499 GAGGCTGGAGGATCACTTGAAGG + Intergenic
1144028662 17:11300835-11300857 AAGGGAGGTGGAGCACATGGGGG + Intronic
1144085635 17:11805961-11805983 GAGGCAGGAGGATCACCTGAGGG - Intronic
1144268194 17:13591889-13591911 GAGGCAGGCAGATCACTTGAGGG - Intronic
1144353953 17:14426661-14426683 GATGCAAGTGGATGACATGAAGG + Intergenic
1145233728 17:21193791-21193813 GAGGCAGGAGAATCACTTGAAGG - Intergenic
1145727272 17:27142167-27142189 AAGGCAGTTGGATCACTTGAGGG + Intergenic
1146054264 17:29573421-29573443 GAGGGAGGTGGCAGACATGAAGG - Intergenic
1146385490 17:32368771-32368793 GAGGCGGGTGGATCACCTGAGGG + Intronic
1146721460 17:35127005-35127027 GAGACAGGTGAATCAGATGAAGG - Intronic
1146774388 17:35599670-35599692 GAGGCAGGCGGATCACTTGAGGG + Intronic
1146796348 17:35784047-35784069 GAGGCAGGTGGATCACTTGAGGG + Intronic
1146896137 17:36543856-36543878 GAGGTGGGTGGATCACCTGAGGG - Intergenic
1146920863 17:36710070-36710092 AAGGCAGGTGGATCACCCGAGGG - Intergenic
1146939130 17:36831929-36831951 GAGGCTGGTGGATTAGATGAAGG + Intergenic
1147056723 17:37840455-37840477 AGGGCAGGTGGATCACTTGAGGG - Intergenic
1147196178 17:38768316-38768338 AAGGCAGGTGGAACACCTGCAGG + Exonic
1147276540 17:39322092-39322114 AAGGCAGGAGGATCACTTGAGGG + Intronic
1147401510 17:40182914-40182936 GGGGCGGGTGGATCACTTGAGGG + Intronic
1147529945 17:41266140-41266162 GAGGCAGGTGGATCACCTGAGGG - Exonic
1147593432 17:41700760-41700782 GAGGCGGGTGGATCATTTGAGGG - Intergenic
1147964875 17:44189229-44189251 GGGGCATGTGGACCACCTGGTGG + Exonic
1148016700 17:44526963-44526985 GAGGCAGGTGGATCACCTGAGGG - Intergenic
1148030902 17:44620183-44620205 GAGGTGGGTGGATCACCTGAGGG + Intergenic
1148057740 17:44811311-44811333 GAGGTGGGTGGATCACCTGAGGG - Intronic
1148217233 17:45839915-45839937 AAGGCAGGTGGAGCAGAAGAAGG + Intergenic
1148526808 17:48346390-48346412 CAGGCAGGCGGATCACCTGAGGG + Intronic
1148545004 17:48511581-48511603 GAGGTGGGTGGATCACTTGAGGG - Intergenic
1148579841 17:48735950-48735972 GAGGGAGGTAGGCCACAAGATGG - Intergenic
1148650950 17:49249643-49249665 GAGGCAGGATGACCACATGCCGG + Intergenic
1148756954 17:49978216-49978238 GAGGCAGGAGGGGGACATGATGG + Intergenic
1148875720 17:50685962-50685984 AAGGCAGGTGGATCACTTGAGGG + Intronic
1149183420 17:53968285-53968307 AAGGCGGGTGGATCACCTGAGGG - Intergenic
1149606674 17:57930032-57930054 GAGGCGGGTGGATCACCTGAGGG - Intronic
1149748775 17:59125220-59125242 AAGGCGGGTGGATCACCTGAGGG - Intronic
1149982211 17:61320119-61320141 GAGGCGGGAGGATCACCTGAGGG - Intronic
1150005581 17:61466922-61466944 GAGGCAGGAGGATGACTTGAAGG + Intronic
1150156121 17:62854887-62854909 AAAGCAGGAGGACCACTTGATGG + Intergenic
1150224234 17:63514368-63514390 GAGGCAGGCGGATCACCTGAGGG + Intronic
1150425993 17:65077524-65077546 AAGGCAGTAGGACCACTTGAGGG + Intergenic
1150537174 17:66054987-66055009 GAGGCGGGTGGATCACTTGAGGG - Intronic
1151266791 17:72962766-72962788 GAGGCGGGTGGACCACCTGAGGG - Intronic
1151355757 17:73557532-73557554 GAGGTAGGCAGACCACTTGAGGG - Intronic
1151469475 17:74309228-74309250 GTGGGAGGTAGACCACATCATGG - Intronic
1151639390 17:75378291-75378313 GAGGCAGGAGAATCACAGGAGGG + Intronic
1151721887 17:75861586-75861608 CAGGCAGGTGGATCACCTGAGGG + Intergenic
1151857490 17:76732269-76732291 GAGACAGGTGGATCACCTGTCGG + Intronic
1151919740 17:77145223-77145245 AAGGCAGGAGGATCACCTGAGGG - Intronic
1152106997 17:78336173-78336195 GAGGCAGGAGAACCACTTGATGG + Intergenic
1152394177 17:80022568-80022590 AAGGCAGGTGGATCACCTGAGGG - Intronic
1152441431 17:80312466-80312488 GAGGCAGGGGGAGGGCATGATGG + Intronic
1152441458 17:80312553-80312575 GAGGCAGGGGGAGGGCATGATGG + Intronic
1152827654 17:82477743-82477765 GAGGCAGGCGGATCACTTGAGGG - Intronic
1152830972 17:82496907-82496929 GAGGCAGCTGGCCCAAAAGAGGG + Intergenic
1153039112 18:794239-794261 GAGGCAGGAGTACCACTTAAAGG - Intronic
1153275244 18:3361187-3361209 GAGGCGGGCGGATCACTTGACGG + Intergenic
1153849620 18:9080873-9080895 GAGGCGTGTGGATCACCTGAGGG - Intergenic
1153876148 18:9373295-9373317 GAGGCAGGTGGATCACTTGAGGG + Intronic
1154040378 18:10849241-10849263 AAGGCAGGTGGATCACCTGAGGG - Intronic
1154134931 18:11768367-11768389 GAGGCAGGAGGATCACCTGAGGG + Intronic
1154144423 18:11855169-11855191 GAGGCAGGCGGATCACTTGAGGG - Intronic
1154153404 18:11925432-11925454 GAGGCGGGTGGATCACTTGAGGG + Intergenic
1154414531 18:14169867-14169889 GAGGCAGGTGGATTACCTGAGGG + Intergenic
1154436854 18:14350872-14350894 GAGGCAGGAGGATCACCTGAGGG + Intergenic
1154437330 18:14357076-14357098 GAGGCAGGCAGATCACATGAAGG + Intergenic
1154531279 18:15348236-15348258 GAGGCGGGAGGATCACTTGAGGG - Intergenic
1155000141 18:21677892-21677914 GAGGCGGGTGAATCACATGCTGG - Intronic
1155032270 18:21995094-21995116 GAGGCGGGAGGATCACTTGAGGG + Intergenic
1155186458 18:23391127-23391149 GATGCAGGAGAACCACTTGAAGG + Intronic
1155252106 18:23962707-23962729 GAGGCAGGAGGATCACCTGAAGG + Intergenic
1157234214 18:45948004-45948026 GAGGCAGGTGGATCACCTGAGGG - Intronic
1157335895 18:46737146-46737168 GAGGCAGGAGGAGCAGGTGATGG - Intronic
1157358839 18:46960203-46960225 CAGGTAGGTGGATCACCTGAAGG + Intronic
1158356783 18:56629965-56629987 AAGGCAGGTGGATCACTTTAGGG + Intronic
1158469000 18:57717975-57717997 GAGGTAGGTGGATCACTTGAGGG - Intronic
1159905374 18:74085360-74085382 AAGGTAGGTGGATCACCTGAGGG + Intronic
1160180691 18:76633181-76633203 GAGGCAGGCGGATCACAAGGAGG + Intergenic
1160458139 18:79017442-79017464 GAGGTAGGTGGATCACCTGAAGG + Intergenic
1160481127 18:79240512-79240534 GAGGCAGGCGGATCACCTGAGGG + Intronic
1160749434 19:727067-727089 GAGGCAGCTGCAGCACCTGAAGG + Exonic
1160893470 19:1391712-1391734 GAGGCAGGCGGATCACCTGAGGG - Intronic
1160906253 19:1453037-1453059 GAGGCAGGTGGAGGCCTTGAAGG + Exonic
1161335888 19:3713083-3713105 GAGGCTGGAGGACCTCATGGGGG - Intronic
1161838018 19:6660957-6660979 GAGGGAGGTGGCCCTGATGAGGG - Intergenic
1162277115 19:9664706-9664728 GATGCAGGTGGATCACCTGAGGG + Intronic
1162290921 19:9779802-9779824 GAGGTGGGTGGATCACCTGAAGG - Intronic
1162387814 19:10370584-10370606 GAGGCAGGTGAAGCACTTGAGGG + Intronic
1162489228 19:10982105-10982127 AAGGCGGGTGGATCACCTGAAGG + Intronic
1162503736 19:11069798-11069820 GAGGGAGATTCACCACATGAGGG - Intergenic
1162530776 19:11235339-11235361 AAGGCAGGGGGATCACTTGAGGG - Intronic
1162543978 19:11317032-11317054 GAGGCAGGCGGATCACTTGAGGG - Intronic
1162669110 19:12239485-12239507 GAGGCAGGAGGATCACTTGAGGG - Intronic
1162755490 19:12856534-12856556 AAGGCAAGTGGATCACCTGAAGG - Intronic
1162849213 19:13417655-13417677 GAGGCGGGTGGATCACAACAAGG + Intronic
1162852889 19:13444904-13444926 GAGGTGGGCGGACCACCTGAGGG + Intronic
1163074731 19:14879690-14879712 GAGGCAGGCGGATCCCCTGAGGG + Intergenic
1163096301 19:15059827-15059849 AAGGCGGGTGGATCACTTGAGGG + Intergenic
1163155131 19:15435889-15435911 GAGGCAGGCGGATCACTGGAAGG + Intronic
1163262965 19:16202216-16202238 GAGGCAGGTGGTTCCCAGGATGG + Intronic
1163279116 19:16304336-16304358 AAGGCAGGTTGATCACCTGAGGG + Intergenic
1163450458 19:17373928-17373950 AAGGCAGGTGGATCACTTGAAGG + Intronic
1163467632 19:17477784-17477806 GAGGTGGGTGGATCACCTGAGGG - Intronic
1163569314 19:18071003-18071025 GAGGTGGGTGGATCACCTGAGGG + Intronic
1163632620 19:18425073-18425095 GAGGCAGGAGGACAGCAGGAGGG + Intronic
1163651127 19:18518556-18518578 GAGGCAGATGGATCACTTGAGGG + Intronic
1163695906 19:18763330-18763352 GAGGCAGGCGGATCACCTGAGGG - Intronic
1163766072 19:19164197-19164219 GAGGTGGGTGGATCACCTGAAGG - Intronic
1163838880 19:19593536-19593558 AAGGCAGGTGGCCCACAGGTGGG + Intronic
1163854640 19:19691598-19691620 GAGGTGGGTGGACCACTTGAGGG - Intergenic
1163951806 19:20595455-20595477 GAGGCATGAGGATCACCTGAGGG + Intronic
1164256004 19:23528844-23528866 GAGGCAGGTGGATCACCTAAGGG + Intronic
1164438814 19:28255922-28255944 GAGGCGGGTGGATCACCTGAGGG + Intergenic
1164552060 19:29220142-29220164 AAGGCTGGTGGATCACCTGAGGG + Intergenic
1164605155 19:29592671-29592693 GAGGCAGGAGGCTCACTTGAGGG + Intergenic
1164994580 19:32710660-32710682 GAGGCGGGTGGATCACCTAAGGG + Intronic
1165160004 19:33810446-33810468 GAGGCAGGTGGATCACATGAGGG + Intronic
1165410009 19:35653933-35653955 AAGGCAGGTGGATCACTTGAGGG - Intronic
1165477826 19:36041847-36041869 GAGGCAGGAGGATCTCCTGAAGG + Intronic
1165598511 19:37032240-37032262 GAGGCAGGAAAACCACTTGAAGG + Intronic
1165616441 19:37205845-37205867 GAAGCAGGTGGATCACCTGAGGG + Intronic
1165724516 19:38103393-38103415 GAGGCAGGTGGATCACCTGAGGG + Intronic
1165840472 19:38786387-38786409 GAGGTGGGTGGATCACTTGAGGG + Intergenic
1165855074 19:38874901-38874923 GAGGCGGGTGGATCACCTGAGGG + Intronic
1165955043 19:39497309-39497331 GAGGTGGGTGGACCACTTGAAGG + Intergenic
1166195583 19:41203594-41203616 GAAGCGGGTGGTCCGCATGAGGG - Exonic
1166341409 19:42139669-42139691 GAGGTGGGTGGATCACTTGAGGG - Intronic
1166366936 19:42282544-42282566 GAGCCACGTGGACCACAGAAAGG - Intronic
1166615899 19:44245934-44245956 GAGGCAGGTGGATCACTTCAGGG - Intronic
1166628104 19:44379408-44379430 GAGGCAGAAGGATCACTTGAGGG - Intronic
1166668025 19:44693120-44693142 GAGGCAGGCAGATCACTTGAGGG + Intergenic
1166724090 19:45015132-45015154 GAGGCAGGTGGATTACCTGAGGG - Intronic
1166766748 19:45255794-45255816 GAAGCAGGAGGACAACAGGAGGG - Intronic
1167128501 19:47568573-47568595 GAGGCAGGTGGATTGCTTGACGG - Intergenic
1167160036 19:47761376-47761398 GAGGCAGGCGGATCACCTGAGGG + Intergenic
1167219089 19:48185753-48185775 GAGGCAGATGGATCACCTGATGG + Intronic
1167276363 19:48542441-48542463 GAGGCAGGTGGATCACCTGAGGG + Intergenic
1167303095 19:48690919-48690941 GAGGCAGGTGAATCATGTGAGGG - Intergenic
1167396893 19:49235326-49235348 GAGGCAGGTGGATCACTTGAGGG + Intergenic
1167435388 19:49475824-49475846 GGGGAAGGGGGATCACATGAGGG - Intronic
1167940086 19:52939748-52939770 GAGGCAGGAGAATCACTTGAAGG - Intronic
1167953471 19:53046028-53046050 GAGGGGGGTGGATCACCTGAGGG + Intronic
1168127071 19:54290378-54290400 GAGGCAGGCGGATCAGGTGAGGG - Intergenic
1168222464 19:54970417-54970439 GAGGCGGTTGGACCACCTGAGGG + Intronic
1168235783 19:55062448-55062470 GAGGCAGGCGGATCACCTGAGGG + Intronic
1168402598 19:56094261-56094283 AAGGCGGGTGGATCACTTGAGGG - Intronic
1168601886 19:57725230-57725252 GAGGCGGGTGGATCTCCTGAGGG + Intronic
925203262 2:1986057-1986079 CAGGCAGGTGGACGTCCTGACGG + Intronic
925562639 2:5214107-5214129 GAGGCAGGTGCATCACTTGAGGG + Intergenic
926041587 2:9677703-9677725 GAGGTGGGTGGATCACCTGAGGG - Intergenic
926190517 2:10723991-10724013 GAGGCAGGTGGATCACCTGAGGG - Intronic
926401359 2:12500297-12500319 GAGGAGGGTGGATCACCTGAGGG - Intergenic
926493653 2:13557269-13557291 GAGGCAGGTGTGGCACATGTGGG - Intergenic
926846536 2:17147213-17147235 GAGGAGGGTGGATCACCTGAAGG - Intergenic
927165496 2:20316650-20316672 GAGGCAGGAGGATCACTTGAGGG + Intronic
927190319 2:20512685-20512707 GAGGCGGGCGGATCACCTGAGGG + Intergenic
927761711 2:25762432-25762454 AAGGCAGGTGAACCACTTGAGGG + Intronic
927766338 2:25812224-25812246 GAGGCAGGTGGATTACCTGAAGG + Intronic
927772409 2:25874984-25875006 GAGGCAGGAGGATCACTTGAGGG + Intronic
927799524 2:26085255-26085277 GAGGCGGGTGGATCACTTGAGGG + Intronic
927880030 2:26683821-26683843 GAGGCAGTTGGGGGACATGAAGG - Intergenic
929100309 2:38305295-38305317 AAGGCAGGTGGACCACTTGAGGG + Intronic
929563716 2:42971497-42971519 GAGGAAGGTGTAACACATTATGG + Intergenic
929588183 2:43129003-43129025 GAGGCGGGAGGATCACCTGAGGG + Intergenic
929715073 2:44301830-44301852 GAGGCTGGTGGATCACCTGACGG + Intronic
930029330 2:47048832-47048854 GAGGCAGGAGGATCACCTGAGGG - Intronic
930118978 2:47744334-47744356 CAGGCAGCTGCCCCACATGATGG + Intronic
930176391 2:48305419-48305441 GAGGCAGGTGGGTCACTTGAGGG - Intergenic
930530680 2:52584497-52584519 GAGGTGGGTGGATCACCTGAGGG - Intergenic
930640704 2:53851914-53851936 GAGGCGGGTGGATCACCTGAGGG - Intergenic
931214090 2:60225578-60225600 GAGGCTGGTGGGCCACATGCAGG - Intergenic
931319298 2:61160387-61160409 GAGGCGGGTGGATCACCTGAGGG - Intronic
931349579 2:61475265-61475287 GAGGCGGGCGGATCACCTGAGGG - Intergenic
931491857 2:62756535-62756557 GAGGCAAGTGGATCACCTGAGGG + Intronic
931680040 2:64738848-64738870 GAGGCAGGTGGATCACCTGAAGG + Intronic
932124136 2:69127993-69128015 TAGGCGGGTGGATCACTTGAGGG + Intronic
932157259 2:69429330-69429352 AAGGCAGGAGGATCACTTGAGGG + Intronic
932161198 2:69461821-69461843 GAGGTGGGTGGATCACTTGAGGG - Intronic
932232805 2:70096419-70096441 GAGGCAGGTGGATCGCTTGGAGG - Intergenic
932244517 2:70185167-70185189 GAGGCGGGTGGAACACCTGAGGG + Intronic
932246316 2:70199663-70199685 GCTGCAGGTGGGACACATGAGGG - Intronic
932251250 2:70246153-70246175 GAGGAGGGTGGATCACTTGAGGG - Intronic
932895383 2:75634566-75634588 GAGGCGGGTGGTTCACTTGAGGG + Intergenic
933267328 2:80195846-80195868 GAGGCAGGAGGATCACTTGAGGG + Intronic
933328232 2:80865073-80865095 GAGGCAGGAGGATCATTTGAGGG + Intergenic
933486750 2:82933929-82933951 AAGGCGGGTGGATCACCTGAGGG - Intergenic
934181636 2:89628153-89628175 GAGGCAGGTGGATCACTTGAGGG - Intergenic
934291937 2:91702372-91702394 GAGGCGGGTGGATCACTTGAGGG - Intergenic
934488501 2:94739193-94739215 GAAACAGGCGGATCACATGAGGG - Intergenic
934489134 2:94746667-94746689 GAAGCAGGAGGATCACCTGAGGG - Intergenic
935249034 2:101245488-101245510 AAGGCAGGCGGATCACCTGAGGG + Intronic
935400915 2:102659194-102659216 GAGGCAGGTGGATCACTTGAAGG + Intronic
935403211 2:102681993-102682015 GAGTGAGGAGGACCACATGATGG + Intronic
935466931 2:103410043-103410065 GAGGCGGGTGGATCACTTGAGGG - Intergenic
935565366 2:104600538-104600560 GAGGCAGGAGGATCACTTGAGGG + Intergenic
935581473 2:104759286-104759308 GAGGTAGGTGGATCACTTGAAGG + Intergenic
935867401 2:107405208-107405230 GAGGTGGGTGGATCACATGAGGG + Intergenic
936017030 2:108967164-108967186 AAGGCAGGTGGATCAGTTGAGGG - Intronic
936391339 2:112076968-112076990 AAAGCAGGAGGATCACATGAGGG + Intronic
936463869 2:112730079-112730101 GAGGCAAGTGGATCACCTGAGGG + Intronic
936604597 2:113937335-113937357 AAGGCAGGTGGATCACTTGAGGG - Intronic
936703298 2:115039811-115039833 GAGGCAGGCAGACGACTTGATGG - Intronic
937184552 2:120028093-120028115 GAGGCGGGTGGATCACCTGAGGG - Intronic
937369572 2:121287908-121287930 GAGGTGGGTGGATCACCTGAAGG - Intergenic
937393103 2:121509604-121509626 GAGGCAGGTGGAACACACGAGGG + Intronic
937643231 2:124236893-124236915 GAGGCGGGTGGATCACCTGGAGG + Intronic
937952826 2:127401494-127401516 GAGGCAGGTGGACCACCCCTTGG + Intergenic
938014946 2:127859237-127859259 GAGGCGGGTGGATCGCTTGAGGG + Intergenic
938272673 2:129988871-129988893 GAGGCAGGAGGAGAAGATGAAGG + Intergenic
938320797 2:130361817-130361839 GAGGCGGGTGGATCACCTGAGGG - Intronic
938530376 2:132179518-132179540 GAGGCGGGAGGATCACTTGAGGG - Intronic
938545491 2:132325740-132325762 GAGGCAGAAGGATCACTTGAGGG + Intergenic
939181266 2:138804801-138804823 GAGGCAGGAGGATCACTTGAAGG + Intergenic
939243331 2:139591390-139591412 GAAACAGGTAGACCACAAGAGGG + Intergenic
939251172 2:139683412-139683434 AAGGCTGGTGGATCACCTGAGGG + Intergenic
939324807 2:140674179-140674201 GAGGCAGGTGGATCACCTGAGGG - Intronic
939340496 2:140889526-140889548 AAGGCAGGTGAATCACTTGAGGG - Intronic
939686682 2:145208863-145208885 AAGGCAGGAGGATCACCTGAGGG + Intergenic
939921733 2:148124045-148124067 AAGGAAGGTGGATCACTTGAGGG + Intronic
940004589 2:148999111-148999133 AAGGCAGGAGCACAACATGAGGG - Intronic
940081478 2:149807761-149807783 AAGGCAGGAGGACCACAAAAGGG + Intergenic
940209528 2:151242307-151242329 AAGGCGGGTGGATCACCTGAGGG + Intergenic
940232138 2:151466994-151467016 AAGGCAGGTGGATCACCTGAGGG + Intronic
940241839 2:151571235-151571257 GAGGCAGGTGGATCACCTGAGGG - Intronic
940294383 2:152107340-152107362 AAGGCAGGCGGATCACCTGAGGG + Intergenic
940307050 2:152237877-152237899 GAGGCGGGCGGATCACCTGAGGG - Intergenic
940328945 2:152454039-152454061 GAGGTGGGTGGATCACTTGAGGG + Intronic
940364818 2:152836386-152836408 GAGGCAGGTGGATCACCTGAGGG - Intergenic
940763746 2:157767263-157767285 AAGGCAGGTGGATCACCTGAAGG - Intronic
940948153 2:159642468-159642490 GAGGCGGGTGGATCACTTGAGGG - Intergenic
941358082 2:164516790-164516812 GAGGTGGGTGGATCACTTGAGGG + Intronic
941873537 2:170410332-170410354 GAGGCAGGCGGATCACAAGGTGG + Intronic
942039318 2:172042030-172042052 GAGGCAGGTAGATCACTTGTGGG - Intronic
942658572 2:178240333-178240355 GAGGCAGGTGGATTACTTAAGGG + Intronic
942713968 2:178869998-178870020 AAGGAGGGTGGACCACCTGAAGG + Intronic
942986649 2:182151334-182151356 AAGGCAGGTGGATCACCTGAAGG - Intronic
943055796 2:182977255-182977277 GAGGCAGGTGGGTCACCTAAGGG + Intronic
943811007 2:192189310-192189332 GAGGCGGGTGGATCTCCTGAGGG + Intronic
944082331 2:195802277-195802299 GAGGTGGGTGGATCACCTGAGGG + Intronic
944233794 2:197423153-197423175 AAGGCAGGTGGATCACCTGAAGG + Intronic
944314448 2:198269978-198270000 TGGGCAGGTGGACCAGAGGAAGG - Intronic
944330544 2:198460995-198461017 GAGGCAGGTGGATCACTTGAGGG - Intronic
944372410 2:199000308-199000330 AAGGCAGGTGGATTACCTGAGGG + Intergenic
944697287 2:202213470-202213492 GAGGCGGGCGGATCACCTGAGGG - Intronic
945661525 2:212691530-212691552 GAGGCAGGAGGTACACATTAAGG - Intergenic
945875001 2:215268640-215268662 AAGGCAAGTGGATCACCTGAGGG + Intergenic
946072677 2:217047869-217047891 GTGGGAGGGGGAGCACATGAAGG - Intergenic
946162098 2:217841570-217841592 GAGGCAGATGGACCTCCTGCTGG + Intronic
946288247 2:218721890-218721912 GAGGCAAGAGGATCACTTGAGGG + Intronic
947215993 2:227750417-227750439 GAGGCAGGAGGATTACTTGAGGG + Intergenic
947221623 2:227798800-227798822 GAGGCAGGTGGATCATTTGAGGG - Intergenic
947661118 2:231869199-231869221 GAGGCGGGTGGATCACCTGAAGG + Intergenic
947667963 2:231918940-231918962 GAGGCAGGGGGCCCACAGGGAGG - Intergenic
947806181 2:232969743-232969765 GAGGCAGGCAGATCACTTGAGGG - Intronic
948183018 2:235997919-235997941 GAGGCTGGTGTTACACATGAAGG + Intronic
948678825 2:239617207-239617229 GAGGCAGGTGGATCACTTGAGGG - Intergenic
949014246 2:241700855-241700877 GAGGCGGGCGGATCACTTGAGGG - Intergenic
949014291 2:241701193-241701215 GAGGCGGGCGGATCACTTGAGGG - Intergenic
1168988490 20:2072630-2072652 AAGGCAGGTGGATCACTTGAGGG + Intergenic
1169050903 20:2577137-2577159 GAGGCAGGTGGATCACCTGAGGG - Intronic
1169347857 20:4843314-4843336 GAGGCAGGTGGATCACCTTGAGG + Intergenic
1169632310 20:7647324-7647346 GAGGTACCTGGACAACATGAGGG + Intergenic
1169857469 20:10118708-10118730 GAGGTGGGTGGATCACCTGAAGG - Intergenic
1170205045 20:13789394-13789416 GAGACAGGCGGATCACCTGAGGG - Intronic
1170237143 20:14119399-14119421 GAGGTAGGTGGATCACCTGAAGG - Intronic
1170535956 20:17341016-17341038 GAGGCAGGTGGATCACTTTGAGG + Intronic
1170897725 20:20431151-20431173 GAGGCAGGAGGAAAACATCATGG + Intronic
1171095353 20:22327570-22327592 GAGACGGGTGGACCACCTGAGGG + Intergenic
1171499669 20:25584237-25584259 GAGGCAGCTGGATCACCTGAAGG + Intronic
1171874348 20:30558496-30558518 GAGGCAGAAGGATCACTTGAGGG + Intergenic
1172286354 20:33743262-33743284 GAGGCAGGCGGATCACCTGAGGG - Intronic
1172782533 20:37445636-37445658 GAGACAGGAGGATCACTTGAGGG - Intergenic
1173804277 20:45913672-45913694 AAGGCAGGCGGATCACTTGAGGG - Intergenic
1174005347 20:47406516-47406538 GAGGCAGGTGGATCACTTGAGGG + Intergenic
1174021153 20:47530694-47530716 AAGGCAGGTGGATCACTTGAGGG - Intronic
1174335905 20:49860483-49860505 AAGGCAGGTGGATCACTTGAGGG + Intronic
1174476748 20:50801193-50801215 GAGGCGGGTGGATCATTTGAGGG + Intronic
1175609845 20:60341624-60341646 GAGGCTGGAGGATCACTTGAGGG + Intergenic
1176043047 20:63075946-63075968 AAGGCAGGAGGATCACTTGAGGG + Intergenic
1176259664 20:64172958-64172980 GAGGTGGGTGGATCACTTGAGGG - Intronic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1176730843 21:10495063-10495085 GAGGCGGGTGGATCACTTGAGGG + Intergenic
1176766078 21:13019917-13019939 GAGGCGGGAGGATCACTTGAGGG + Intergenic
1176840184 21:13834772-13834794 GAGGCAGGAGGATCACCTGAGGG - Intergenic
1176858500 21:13988379-13988401 GAGGCAGGTGGATTACCTGAGGG - Intergenic
1176895636 21:14375561-14375583 GAGGCGGGTGGATCACGAGATGG - Intronic
1177122039 21:17149921-17149943 AAGGTAGGTGGATCACTTGAGGG + Intergenic
1177192318 21:17865782-17865804 GAGGCAGGAGGATCACTTCAGGG - Intergenic
1177529895 21:22345310-22345332 GAGGCAGGTAGATCATTTGAGGG + Intergenic
1177863216 21:26479741-26479763 GAGGTGGGTGGATCACTTGAGGG - Intronic
1178069298 21:28944988-28945010 GAGGCAAGTGGATCACATGAGGG + Intronic
1178157102 21:29867561-29867583 GAGGCAGTTGAATCACCTGAGGG + Intronic
1178607282 21:34050408-34050430 GAGGCAGGCGGATCACCTGAGGG + Intergenic
1178929932 21:36808980-36809002 GAGGCAAGCGGATCACTTGAGGG + Intronic
1179830372 21:43992733-43992755 GAGGTGGGTGGATCACCTGAGGG - Intergenic
1179934099 21:44591502-44591524 GAGGCAGAGGCACCACAGGAGGG + Exonic
1180080448 21:45485230-45485252 GAGGCAGGTGGATCACCTGAGGG - Intronic
1180430707 22:15246758-15246780 GAGGCGGGAGGATCACTTGAGGG + Intergenic
1180462411 22:15577270-15577292 GAGGCAGGAGGAGAAGATGAAGG - Intergenic
1180513261 22:16114663-16114685 GAGGCGGGAGGATCACTTGAGGG + Intergenic
1180574084 22:16756699-16756721 GAGGCAAGTGGATCACCTGAGGG - Intergenic
1180804928 22:18655756-18655778 GAGGCAGGCAGATCACTTGATGG - Intergenic
1181146208 22:20849619-20849641 GAGGCAGGTGGATCACAACAAGG + Intronic
1181269318 22:21649794-21649816 GAGGCAGGTGGATCACCTGAGGG + Intergenic
1181390697 22:22578914-22578936 GAGGCAGGAGGATCGCTTGAGGG - Intergenic
1181573241 22:23779163-23779185 TAGGCAGGAGGATGACATGAGGG - Intronic
1181694049 22:24584215-24584237 GAGGGAGCTGGACCCCAGGATGG + Intronic
1181799229 22:25333554-25333576 GAGGCAGGTGGATCATCTGAAGG - Intergenic
1181806574 22:25378358-25378380 GAGGTGGGTGGATCACCTGAGGG - Intronic
1181880158 22:25972722-25972744 GAGGCAGGTGGATCACCTGAGGG + Intronic
1182139157 22:27937841-27937863 AAGGCGGGTGGATCACTTGAGGG + Intergenic
1182217410 22:28730624-28730646 GAGGCGGGTGGATCACCCGAGGG + Intronic
1182223770 22:28779435-28779457 GAGGCAGGTGGATCACTTGAGGG - Intronic
1182479941 22:30601543-30601565 GAGGCAGGCAGATCACTTGAGGG - Intronic
1183219009 22:36500030-36500052 GAGGTGGGTGGATCACCTGAGGG - Intronic
1183396642 22:37575438-37575460 GAGGCAGGAGGACCACTTGAGGG - Intronic
1183421653 22:37715244-37715266 GAGGCAGGTGGATCACCTGAGGG - Intronic
1183544143 22:38446721-38446743 GAGGTGGATGGATCACATGAGGG + Intronic
1183686880 22:39366218-39366240 GAGGTAGGTGGATCACTTGAGGG - Intronic
1183879571 22:40815953-40815975 AAGGCAGGCGGATCACCTGAGGG + Intronic
1183949308 22:41343783-41343805 GAGGCAGGTGGGACACATTTGGG + Intronic
1184048641 22:41988333-41988355 GTGACAGGTGGGCCCCATGAAGG + Intronic
1184071008 22:42146542-42146564 GAGGTGGGTGGATCACCTGAGGG + Intergenic
1184131203 22:42517749-42517771 GAGGCGGGCGGATCACCTGAAGG - Intronic
1184141420 22:42579953-42579975 GAGGCGGGCGGATCACCTGAAGG - Intergenic
1184346046 22:43913732-43913754 GTAGCAGGAGGACCACATAATGG - Intergenic
1184517912 22:44974180-44974202 GAGGCAGGTGGATCACTTGAGGG + Intronic
1184559266 22:45252266-45252288 AAGGCGGGTGGATCACTTGAGGG + Intergenic
1184714242 22:46271740-46271762 GAGGCGGGTGGATCACTTGAGGG - Intronic
1184801254 22:46761772-46761794 GAGGCAGGAGGATCACTAGAGGG + Intergenic
1185148392 22:49151283-49151305 GGGGCAGGTGGGCCATTTGACGG + Intergenic
1185245840 22:49772307-49772329 GAGGCAGGTGTATCACTTGAGGG + Intergenic
1185328188 22:50237889-50237911 GAGGCGGGTGGATCACCTGACGG + Intronic
1185356034 22:50371257-50371279 GTGGCAGGAGGATCACTTGAGGG + Intronic
1185403502 22:50631264-50631286 GAGGCAGGTGGATCACCTGAGGG + Intergenic
949404603 3:3701150-3701172 GAGGCAGGAGGAAGGCATGATGG - Intronic
949441929 3:4090868-4090890 GAGGCAGGTGGATCCCATCCTGG + Intronic
949528043 3:4925490-4925512 AAGGCAGGAGGATCACTTGAGGG - Intergenic
949811075 3:8006741-8006763 GAGGGAGGTGGCACAGATGAAGG + Intergenic
949828854 3:8192053-8192075 GAGGCAGGAGGATCACTTGATGG - Intergenic
950238302 3:11343158-11343180 AAGGCAGGCGGATCACTTGAGGG - Intronic
950892555 3:16417229-16417251 GAGGCGGGAGGATCACTTGATGG - Intronic
950971379 3:17191853-17191875 GAAGCAGGCGGATCACTTGAGGG - Intronic
951158381 3:19383602-19383624 AAGGCGGGTGGATCACATGAGGG - Intronic
951523668 3:23632467-23632489 GAGGGAGGTGGATCATTTGAGGG + Intergenic
951756009 3:26092037-26092059 GAGGTGGGTGGATCACTTGAGGG + Intergenic
951872614 3:27381852-27381874 AAGGCAGGCGGATCACCTGAGGG + Intronic
952249930 3:31643020-31643042 GAGGCGGGTGGATCACCTGAAGG - Intergenic
952351425 3:32542634-32542656 AAGGCAGGTGGATCACAAGTCGG - Intronic
952405514 3:33001312-33001334 GAGGCAGGAGGATCGCTTGAGGG - Intronic
952433918 3:33253201-33253223 GAGGCAAGTGGATCACTTGAGGG - Intergenic
952441821 3:33338313-33338335 GAGGCAGGAGAACCACTTGAAGG + Intronic
953347009 3:42184774-42184796 GGAGCAGGTGGAACACATCAGGG + Exonic
953640744 3:44705249-44705271 AAGGCGGGTGGATCACTTGAGGG + Intergenic
954069698 3:48133993-48134015 GAGGCAGGCAGATCACCTGAGGG - Intergenic
954119174 3:48485080-48485102 GAGGCAGGAGGATCACTTGAGGG + Intronic
955018263 3:55092579-55092601 GAGGTGGGTGGATCACCTGAGGG - Intergenic
955270250 3:57490855-57490877 GAGGCGGGTGGACCACCTGAGGG + Intronic
955521761 3:59782183-59782205 GAGGCGGGTGGATCACCTGAAGG - Intronic
955615124 3:60799403-60799425 GAGGCAGGTGGATTACCTGAGGG - Intronic
956427387 3:69150576-69150598 GAGGCAGGTGGATCACTGGAGGG + Intergenic
956734795 3:72230115-72230137 AAGGCAGGTGGCCAACATGTAGG - Intergenic
956833587 3:73077239-73077261 GAGGTGGGTGGATCACCTGAGGG - Intergenic
957068335 3:75545232-75545254 AAGGCAGGCGGATCACTTGAGGG - Intergenic
957326276 3:78699315-78699337 GAGGCAGGTGGATCACTTTGAGG + Intronic
957729478 3:84114805-84114827 GAGGCGGGGGGATCACTTGAGGG - Intergenic
958039279 3:88206865-88206887 AAGGCGGGTGGATCACCTGAGGG - Intergenic
958532147 3:95347997-95348019 GAGGCAGATGGATCACTTTAAGG + Intergenic
958731528 3:97965278-97965300 GAGGCGGGTGGATCACCTGAGGG + Intronic
958941352 3:100318882-100318904 GAGGCAGGCAGATCACCTGAGGG - Intronic
958948766 3:100394732-100394754 GAGGCAGGTGGATCACCTGAGGG - Intronic
959130485 3:102349924-102349946 GAGGCATGTGGATAACAAGAAGG + Intronic
959595236 3:108122316-108122338 CAGGCAGGTGGCTCCCATGAAGG + Intergenic
960090586 3:113634423-113634445 AAGGCGGGTGGATCACTTGAGGG + Intergenic
960324058 3:116273330-116273352 GAGGCAGGTTTCCCACTTGAGGG - Intronic
960701362 3:120442546-120442568 GAGGCGGGTGGATCACTTGAGGG + Intronic
961028186 3:123579533-123579555 AAGGCAGGAGGATCACTTGAGGG - Intronic
961533278 3:127553334-127553356 GAGGCTGGCGGATCACTTGAGGG - Intergenic
961616064 3:128182042-128182064 AAGGCAGGCGGATCACTTGAGGG - Intronic
962341490 3:134588194-134588216 GAGGCAGGAGAATCACTTGAGGG + Intergenic
962505930 3:136046218-136046240 GAGGCAGGTGGATCACCTGAGGG + Intronic
962510210 3:136091518-136091540 GAGGCAGGAGGATCACTTGAGGG + Intronic
962570033 3:136703776-136703798 GAAGCAGGTGGATCACCTGAGGG + Intronic
962736689 3:138331757-138331779 GAGGCAGGTGGATCACTTGAGGG + Intergenic
963133572 3:141879538-141879560 GAGGTGGGTGGATCACTTGAGGG + Intronic
963211916 3:142702151-142702173 GAGGCAGGAGGATCACTTAAGGG - Intronic
963885903 3:150582230-150582252 GAGGCGGGTGGATTACCTGAGGG - Intronic
964116041 3:153137281-153137303 GAGGCGGGCGGATCACCTGAGGG - Intergenic
964133083 3:153312896-153312918 GAGGTGGGTGGATCACCTGAGGG + Intergenic
964202190 3:154130370-154130392 GAGGCAGGCGGATCACTAGAGGG - Intronic
964763154 3:160153362-160153384 GAGGAAGGTGTCCTACATGAGGG - Intergenic
965601509 3:170459039-170459061 GAGGCAGGTGGACCATTGCAAGG + Intronic
965698559 3:171436129-171436151 GAGGGAAGTGGACCAGATGGAGG - Intronic
965828365 3:172753327-172753349 AAGGCAGGAGGATCACTTGAGGG - Intronic
965916066 3:173847638-173847660 GAGGCAGGCAGATCACCTGAGGG + Intronic
966324288 3:178737036-178737058 GAGGCAGGCAGATCACTTGAGGG + Intronic
966521618 3:180880132-180880154 GAGGCGGGCGGACCACCTGAAGG - Intronic
966526111 3:180921136-180921158 GAGGCGGGTGGATCACTTGAGGG + Intronic
966885379 3:184375017-184375039 GAGGCAGGCAGATCACCTGAGGG - Intronic
967015892 3:185481244-185481266 GAGGCAGGAGGATCACTTTAGGG + Intronic
967097061 3:186185863-186185885 GAGGCGGGTGGATCACCTGAGGG + Intronic
967587627 3:191234463-191234485 GAGGCAGGTGGATCGCCTGAGGG + Intronic
967848052 3:194059708-194059730 AAGGCGGGTGGATCACCTGAGGG + Intergenic
967899800 3:194437926-194437948 AAGGCAGGTGGATCACTTGAGGG + Intronic
968193454 3:196687997-196688019 GAGGCGGGCGGATCACCTGAGGG - Intronic
968247973 3:197173870-197173892 GAGGCAGGCAGATCACATGAGGG + Intronic
968330366 3:197864072-197864094 GAGGCAGGTGGATCACCTGAGGG + Intronic
968379175 4:74205-74227 GAGGCAAGAGGATCACTTGAAGG + Intronic
968798596 4:2726697-2726719 GAGGCGGGTGGATCACTTGAGGG + Intronic
969611998 4:8232628-8232650 GAGCCAAGTGGGCCACATGTGGG - Intronic
969741180 4:9027975-9027997 AAGGCAGGCGGATCACTTGAGGG + Intergenic
969807974 4:9625589-9625611 GAGGCGGGCGGATCACCTGAGGG + Intergenic
970004978 4:11401573-11401595 GAGGCAGGCAGATCACCTGAGGG - Intronic
970203583 4:13633465-13633487 GAGGCAGGTGGATCACCTGAAGG + Intergenic
970391690 4:15618607-15618629 AAGGCAGGTGGATCACCTAAAGG + Intronic
970715649 4:18919329-18919351 GAAGCAGATGGAACACATGGAGG + Intergenic
970796954 4:19924180-19924202 GAAGCGGGTGGATCACTTGAGGG + Intergenic
970882407 4:20947398-20947420 GAGGCAGGTGGACCACATGAGGG - Intronic
971028514 4:22611446-22611468 GAGGCGGGTGGATCACTTGAGGG - Intergenic
971320625 4:25603060-25603082 GAGGCAGGGGAATCACTTGAAGG + Intergenic
971591558 4:28475169-28475191 GAGGCAGGAGGATCACTTGAGGG + Intergenic
971594507 4:28511420-28511442 GAGGCAGGCAGATCACCTGAGGG + Intergenic
972303272 4:37806482-37806504 GAGGCAGGAGAATCACTTGAAGG - Intergenic
972358704 4:38306149-38306171 GAGGCAGGTGGATCACTTTGAGG + Intergenic
972424389 4:38918918-38918940 GAGGCAGGTGGATCACCTGAAGG + Intronic
972964585 4:44493863-44493885 GAGGCGGGTGGATCACCTGAGGG + Intergenic
973017298 4:45156911-45156933 GAGGTGGGTGGATCACCTGAGGG + Intergenic
973148374 4:46858325-46858347 GAGGCAGGAGGATCACTTGAGGG - Intronic
974164255 4:58179910-58179932 GAGGCAGGCGGATCACCCGAAGG - Intergenic
974305620 4:60135303-60135325 GAGGCAGATGGATCACTTGAGGG + Intergenic
974335455 4:60538396-60538418 GAGGCGAGTGGATCACTTGAGGG + Intergenic
974634709 4:64545863-64545885 GAGGCAGATGGATCACCTGGAGG + Intergenic
975159777 4:71111926-71111948 GAGGCGGGTGGATCACTTGAGGG - Intergenic
975347091 4:73304469-73304491 GAGGCAGGAGAATCACTTGAAGG - Intergenic
975555552 4:75661358-75661380 GAGGCAGGTGGATCACTTGAGGG - Intronic
975568931 4:75792303-75792325 AAGGCGGGTGGATCACCTGAAGG + Intronic
975585580 4:75944970-75944992 GAGGCAGGAGAATCACTTGAAGG - Intronic
976497836 4:85750727-85750749 GAGGTGGGTGGATCACCTGATGG - Intronic
976946562 4:90777122-90777144 GAGGCGGGTGGATCACCTGAGGG + Intronic
977593575 4:98852900-98852922 GAGGCAGGAGGATCACTTGAAGG + Intergenic
977940441 4:102851899-102851921 GAGGTGGGTGGATCACCTGAGGG - Intronic
978784771 4:112597292-112597314 GAGGCAGCAGGAACACTTGAGGG + Intronic
978805874 4:112799747-112799769 GAGGCGGGCGGATCACCTGAAGG - Intergenic
979120449 4:116892982-116893004 GAGGCAGGTGGATCACCTGAGGG - Intergenic
979383386 4:120035267-120035289 GAGGCAGGAGCACTACATGTTGG + Intergenic
979463276 4:121007160-121007182 GAGGTGGGTGGATCACTTGAGGG + Intergenic
980062591 4:128148197-128148219 GAGGCAGGTAGATCACCTAAGGG + Intronic
980259851 4:130434119-130434141 GAGGCAGGAGAATCACTTGAGGG - Intergenic
980571938 4:134631033-134631055 GAGGCGGGAGGATCACTTGAGGG - Intergenic
981213084 4:142131722-142131744 AAGGCAGGCGGATCACCTGAGGG + Intronic
981402224 4:144326841-144326863 GAGGCAGGTGGATCCCTTGAGGG + Intergenic
981945734 4:150341397-150341419 GAGGCAGGAGGACTGCTTGAGGG - Intronic
982729651 4:158942535-158942557 AAGGCAGGCGGATCACTTGAGGG + Intronic
983067469 4:163228013-163228035 GAGGCAGGTGGATCGCCCGAGGG - Intergenic
983240858 4:165231220-165231242 GAGGCAGGTGGATTGCTTGAGGG + Intronic
983724432 4:170902835-170902857 GAGGCAGGTGGATCACCTGAGGG + Intergenic
983795980 4:171863991-171864013 GAGGCAGGTGGATCACCTGAGGG - Intronic
983884629 4:172966621-172966643 GAGGCGGGTGGATCACCTGAGGG - Intronic
983910406 4:173232665-173232687 GAGGCAGGAGGATCTCTTGAGGG - Intronic
984114736 4:175665547-175665569 GAGGCGGGCGGATCACCTGAGGG + Intronic
984114810 4:175666149-175666171 GAGGCAGGTGGATCACCTAAGGG - Intronic
984391705 4:179142541-179142563 GAGGCAAGTGGGTCACCTGAGGG + Intergenic
984424361 4:179564208-179564230 GAGGCGGGTGGATCACTTGAAGG + Intergenic
984679642 4:182592626-182592648 GAGGCAGGAGAATCACTTGACGG + Intronic
984905112 4:184619245-184619267 GAGGAAGGAGGACCCCATGCTGG - Intergenic
984922854 4:184781005-184781027 GAGGCAGGCAGATCACTTGAGGG + Intronic
985130019 4:186729520-186729542 GAGGCGGGTGGATCACCTGAGGG + Intergenic
985155415 4:186982793-186982815 GAGGGAGGAGGCTCACATGATGG - Intergenic
985268823 4:188175549-188175571 GAGGCAGGAGGAACACAGGAGGG + Intergenic
985777712 5:1853574-1853596 GAGGCAGGTGGGGCATATGTGGG - Intergenic
986186496 5:5446104-5446126 GAGGCTGGAGGATCACCTGAAGG - Intronic
986246269 5:6009881-6009903 AAGGCAGGTGAATCACCTGAAGG + Intergenic
986894506 5:12348747-12348769 GAGGCGGGCGGATCACCTGAGGG - Intergenic
986906541 5:12501185-12501207 GAGCCAGGAGGACCTGATGAGGG - Intergenic
987086107 5:14469639-14469661 GAGGCAAATGGGCCACATGAAGG + Intronic
987563016 5:19548979-19549001 GAGGCAGGCGGATCACCTGAGGG - Intronic
987636892 5:20554952-20554974 GATGCAGTTGGATCAAATGATGG - Intronic
988212944 5:28229732-28229754 GAGGCAGGAGAATCACTTGAAGG + Intergenic
988347431 5:30056480-30056502 GAGGCAGGAGGATCACAACAAGG + Intergenic
988474189 5:31568163-31568185 GAGGCAGGTGGATCACTTTGAGG + Intergenic
988563519 5:32301657-32301679 GAGGTGGGTGGATCACCTGAGGG + Intronic
989560451 5:42844211-42844233 GAGGCAGGAGAATCACTTGAGGG + Intronic
990406469 5:55496087-55496109 GAGGCAGGTGGATCACTTGAGGG - Intronic
990467028 5:56080086-56080108 GAGGCGGGTGGATCACCTGAGGG + Intergenic
990559610 5:56970630-56970652 GAGGCGGGTGGATCACTTGAGGG + Intronic
990833071 5:59982485-59982507 GGGGCACATGGACCACATGTGGG + Intronic
990893028 5:60668505-60668527 GAGGCAGGCGGATCACCTGAGGG - Intronic
991067732 5:62441746-62441768 GAGGCAGGTGGACCACCATGAGG - Intronic
991562167 5:67965438-67965460 CAGGCAGGTGAATCACTTGAGGG - Intergenic
992439157 5:76782914-76782936 GAGGCAGGTGGATCACGTGAGGG + Intergenic
992628355 5:78655472-78655494 AAGGCAGGTAGATCACCTGAGGG + Intronic
992746549 5:79826327-79826349 GAGGCAGGAAGACCAGCTGAAGG - Intergenic
992778679 5:80109411-80109433 AAGGCAGGTGGATCACTTGAGGG - Intergenic
992804746 5:80325610-80325632 AAGGCAGGTGGATCACCCGAGGG + Intergenic
993632591 5:90304551-90304573 GAGGGAGATGGGCCACATGAAGG - Intergenic
993721410 5:91324951-91324973 GAGGCGGGCGGATCACCTGAGGG - Intergenic
994006547 5:94844204-94844226 GAGGCAGGAGAATCACTTGAAGG + Intronic
994246893 5:97488712-97488734 GAGGCATGTGGACAACTGGAGGG + Intergenic
994748719 5:103711619-103711641 GAGGCAGGCGGATCACCTGAGGG + Intergenic
995206758 5:109488500-109488522 GAGGCAGGCGAATCACTTGATGG - Intergenic
995519433 5:112987703-112987725 AAGGCAGGTGGATCACTTGACGG - Intronic
995686684 5:114779974-114779996 GAGGCCGGTGGATCACCTGAGGG - Intergenic
995846628 5:116500771-116500793 GAGGCGGGTGGACCACTTGAAGG + Intronic
996158970 5:120138726-120138748 AAGGCAGGAGGATCACTTGAGGG - Intergenic
996393775 5:122991690-122991712 AAGGCGGGTGGATCACTTGAGGG - Intronic
996750666 5:126885334-126885356 GAGGCAGGTGGATCGTCTGAGGG + Intronic
997348950 5:133216414-133216436 GAGGCAGGAGAATCACTTGACGG - Intronic
997348956 5:133216443-133216465 GAGGCAGGAGAATCACTTGACGG - Intronic
997514745 5:134479206-134479228 GAGGCGGGTGGATCACTTGAGGG - Intergenic
997541172 5:134663876-134663898 GAGTCGGGTGGATCACCTGAGGG + Intronic
997551353 5:134756175-134756197 GAGGCGGGTGGATCACATGAGGG - Intergenic
997766856 5:136513246-136513268 GAGGCAGGTGGATCACGAGGTGG + Intergenic
997915174 5:137917393-137917415 AAGACAGGTGGATCACCTGAGGG - Intronic
998017051 5:138740706-138740728 GAAGCAGGCAGACCACTTGAGGG - Intronic
998222735 5:140300258-140300280 GAGGCGAGTGGATCACTTGAGGG - Intronic
999459057 5:151741979-151742001 GAGGCAGGTGGATCACCTGAGGG + Intergenic
999800800 5:155033651-155033673 AAGGCAGGTAGATCACCTGAGGG - Intergenic
1000006115 5:157186441-157186463 GGGGCAGGTGGATCACCTGAGGG + Intronic
1000067874 5:157712086-157712108 GAGGCAGGTGGATCACTTGAGGG - Intergenic
1000317839 5:160110253-160110275 GAGGCAGGTGGATCCCTTGAAGG - Intronic
1001139828 5:169135341-169135363 GAGGCAGGCAGATCACCTGAGGG - Intronic
1001418861 5:171571626-171571648 GAGGCGGGTGGATCACCAGAGGG - Intergenic
1001464112 5:171947043-171947065 AAGGCAGGTAGATCACTTGAGGG - Intronic
1001496680 5:172192822-172192844 AAGGCGGGTGGATCACTTGAGGG + Intergenic
1001586245 5:172835091-172835113 GAGGCAGCTGGACCCCACAAAGG - Intronic
1001611008 5:173001947-173001969 AAGGCAGGTGGATCACCTGAGGG - Intronic
1001811289 5:174630156-174630178 GAGGCGGGTGGATCACCTGAGGG + Intergenic
1001971379 5:175957493-175957515 GAGGCAGGTGGATCCAAGGAAGG - Intronic
1002027979 5:176408300-176408322 GAGGTGGGTGGATCACTTGAAGG + Intronic
1002078021 5:176720914-176720936 GAGGCAGGAGGAGTAAATGAAGG - Intergenic
1002124289 5:177030385-177030407 GAGGCGGGTGGATCATTTGAGGG + Intronic
1002246063 5:177886284-177886306 GAGGCAGGTGGATCCAAGGAAGG + Intergenic
1002484687 5:179526600-179526622 GACGCAGGTGCAGCAGATGATGG - Intergenic
1002507187 5:179687800-179687822 GAGGCAGGCAGATCACTTGAGGG + Intronic
1002937703 6:1687668-1687690 GAGGCAGGTGAAGAACGTGAGGG + Intronic
1003071335 6:2947763-2947785 GGAGCAGGTGAACCAGATGAGGG - Intergenic
1003255108 6:4468238-4468260 GAGGCGGGTGAATCACCTGAAGG - Intergenic
1003679451 6:8237473-8237495 GAGGCGGGTGGATCACCTGAGGG - Intergenic
1003806377 6:9729728-9729750 GAGGCAGGCGGATCACCTGGAGG + Intronic
1004229927 6:13823011-13823033 GAGGCAGGCAGATCACCTGATGG + Intergenic
1004280944 6:14279211-14279233 AAGACAGGTGGATCACTTGAGGG + Intergenic
1004669004 6:17777908-17777930 GAGGCAGGTGGATCACAGACAGG + Intronic
1004861470 6:19807622-19807644 GAGGCAGGGGAATCACTTGAAGG + Intergenic
1005080457 6:21952032-21952054 GTGGCAAGTGGACAACATGGAGG + Intergenic
1005111136 6:22283382-22283404 GAGGCGGGCGGATCACCTGAGGG - Intergenic
1005164399 6:22902926-22902948 GAGGCGGGTGGATCACCTGAAGG - Intergenic
1005235911 6:23761879-23761901 GAGGGAGTTGGAAAACATGAAGG + Intergenic
1005451517 6:25977436-25977458 GAGGCAGGAGGATCACTTGAGGG + Intronic
1005473235 6:26182541-26182563 GAGGCGGGTGGATCACCTGAGGG - Intergenic
1006016399 6:31084656-31084678 GAGGCCGGCGGATCACGTGAGGG - Intergenic
1006843382 6:37046334-37046356 GAGGCAGGAGGATCACTTGAGGG + Intergenic
1007374426 6:41446509-41446531 GAGGCGGGTGGATCACCTGAAGG + Intergenic
1007461799 6:42024687-42024709 GAGACAGGTGAATCACCTGAGGG + Intronic
1007522133 6:42458820-42458842 GAGGCAACAGGACCAAATGAAGG + Intergenic
1007579701 6:42950246-42950268 GAGGCAGGAGAATCACTTGACGG + Intergenic
1007611736 6:43153932-43153954 GAGGCAGGTGGATCACTTAATGG + Intronic
1007682086 6:43641268-43641290 AAGACAGGTGGATCACTTGAGGG - Intergenic
1007783572 6:44267734-44267756 GAGGCAGGAGAATCACTTGAGGG + Intergenic
1007865353 6:44963264-44963286 CAGGCAGGTGGATCACTTGAAGG + Intronic
1008593817 6:53021087-53021109 GAGGCGGGCGGATCACTTGAAGG + Intronic
1008836147 6:55832877-55832899 AAGGCAGGAGGATCACTTGAGGG + Intronic
1009593864 6:65709262-65709284 AAGGTAGGTGGATCACTTGAGGG - Intergenic
1009876027 6:69506659-69506681 CAGGCAGGAGGATCACTTGAGGG + Intergenic
1009879911 6:69553972-69553994 GAAGCAGGTGGAAAAAATGATGG - Intergenic
1009960749 6:70517648-70517670 GAGGCAGGTGGATCACCTGAGGG - Intronic
1010211566 6:73366408-73366430 AAGGCAGGTGGATCAGTTGAGGG + Intergenic
1010230771 6:73532971-73532993 AAGGCAGGTGGATCACCTGAAGG - Intergenic
1010297428 6:74216296-74216318 GAGGCAGGTGGATCACCTTGAGG - Intergenic
1010306666 6:74331887-74331909 AAGGCTGGTGGATCACCTGAGGG - Intergenic
1010413314 6:75585475-75585497 GAGGCGGGTGGATCGCTTGAGGG + Intergenic
1011133641 6:84076453-84076475 GAGGTAGGTGGATCACCTGAGGG - Intronic
1011185449 6:84670720-84670742 GAGGTAGGAGGATCACTTGAAGG - Intergenic
1011629152 6:89308044-89308066 AAGGCAGGTAGATCACCTGAGGG - Intronic
1012292038 6:97468690-97468712 GAAGCATGTGGATCACTTGAGGG - Intergenic
1012433188 6:99187714-99187736 GAAGGATGTGGACCACAGGAGGG - Intergenic
1012875450 6:104720868-104720890 GAGGCAGGCGGATCACCTGAGGG - Intergenic
1013097009 6:106954558-106954580 AAGGCAGGTGGATCACCTGAGGG + Intergenic
1013246416 6:108291342-108291364 GAGGCGGGAGGAACACTTGAGGG + Intergenic
1013353764 6:109329499-109329521 AAGGCAGGTGGATCACCTGGGGG - Intergenic
1013497366 6:110711734-110711756 AAGGCGGGTGGATCACCTGAGGG + Intronic
1013497595 6:110713782-110713804 GAGGCAGGAGGACTGCTTGAGGG + Intronic
1013498628 6:110724120-110724142 GAGGCGGGTGGATCACCTGAGGG + Intronic
1013560854 6:111303596-111303618 GAGGCAGGAGGATCACTTGAGGG - Intronic
1013805601 6:113992786-113992808 GAGGTGGGTGGATCACCTGAGGG - Intronic
1014237697 6:118978192-118978214 GAGGCAGGTGGATCACCTGAGGG - Intronic
1014262577 6:119236474-119236496 GAGGCAGGTGGATCACTTGCTGG + Intronic
1014562311 6:122906138-122906160 GAGACGGGTGGATCACCTGAGGG - Intergenic
1014948870 6:127530529-127530551 GAGGCAGGTGGATCACCTGAGGG + Intronic
1015271980 6:131345847-131345869 AAGGCTGGTGGATCACTTGAGGG - Intergenic
1016016205 6:139188986-139189008 GAGGTGGGTGGATCACCTGAGGG - Intergenic
1016135956 6:140543400-140543422 GAGGTAGGTTTATCACATGAGGG - Intergenic
1016452267 6:144195373-144195395 AAGGCAGGAGGATCACCTGAGGG + Intergenic
1017160956 6:151365742-151365764 GAGTCAGATGGACAACATGCTGG - Exonic
1017181414 6:151556222-151556244 GAGGCAGGCAGATCACTTGAGGG + Intronic
1017431189 6:154372688-154372710 GAGGCAAGAGGATCACTTGAGGG + Intronic
1017587982 6:155947650-155947672 GAGGTAGGTGGACAACTGGAGGG - Intergenic
1017705802 6:157121857-157121879 GAGGCGGGTGGATCACTTGCAGG - Intronic
1017739348 6:157393108-157393130 GAGGCAGGCGAATCACCTGAGGG - Intronic
1018371306 6:163170649-163170671 GGGGAAGCTGGACCACTTGAGGG - Intronic
1018653822 6:166012875-166012897 GAAGCAGGAGGATCACTTGAAGG + Intergenic
1018804598 6:167249029-167249051 GAAGGAGGTGGAACAGATGACGG - Intergenic
1019963821 7:4483165-4483187 GAGGCGGGTGGATCACCTGAAGG - Intergenic
1020104638 7:5416622-5416644 AAGGCAGGCGGATCACTTGAGGG + Intronic
1020134169 7:5577042-5577064 GAGGCAGGTGCATCACTTGTGGG + Intergenic
1020170044 7:5838011-5838033 GAGGCAGGTGGATCACTTGAGGG - Intergenic
1020238860 7:6376751-6376773 GAGGCGGGCGGATCACTTGAGGG - Intronic
1020240074 7:6387489-6387511 GAGGCGGGTGGATCAACTGAGGG + Intronic
1020684273 7:11274048-11274070 GAGGTGGGTGGATCACTTGAGGG - Intergenic
1021209897 7:17836283-17836305 AAGGCAGGTGGATCACTCGAGGG + Intronic
1021341064 7:19463301-19463323 GAGGCGGGTGGATCACCTGAGGG + Intergenic
1021559849 7:21958724-21958746 GAGGTGGGTGGATCACCTGAGGG + Intergenic
1021653049 7:22850269-22850291 GAGGTAGGTGGATCACATGAGGG - Intergenic
1021772286 7:24017396-24017418 GAGGCAGGAGGATCACTTGAAGG + Intergenic
1022182171 7:27931581-27931603 GAGGCAGGCAGATCACCTGAGGG + Intronic
1022370862 7:29770099-29770121 GAGGGAGGGAGACGACATGAGGG - Intergenic
1022627302 7:32051016-32051038 GAGGCAGGCTGGGCACATGAGGG + Intronic
1023055536 7:36286989-36287011 GAGGCAGGAGGATCACTTGAGGG + Intronic
1023078960 7:36509906-36509928 GAGGCAGGTGGATCACCTGGAGG - Intergenic
1023427054 7:40048969-40048991 GAGGCAGGCGGATCACTTGAGGG + Intronic
1023803968 7:43858331-43858353 GAGGCAGGCAGATCACTTGAGGG - Intergenic
1023811252 7:43913928-43913950 AAGGCAGGTGGATCACTTGAGGG - Intronic
1023896507 7:44438122-44438144 GAGGCAGGAGGACTGCTTGAGGG + Intronic
1024008920 7:45251431-45251453 GAGGCAGGAGGATCACTTGGAGG + Intergenic
1024331443 7:48159556-48159578 GAGGCAGGTGGCTGACATCAGGG + Intergenic
1024641300 7:51331006-51331028 GAGACAGGCGGATCACTTGAGGG + Intergenic
1024857008 7:53794260-53794282 CAGGCAGGTGGTCCCGATGACGG + Intergenic
1025007909 7:55368911-55368933 GAGGCAGGAGGATCACTTGAGGG + Intronic
1025175151 7:56796187-56796209 GAGGCAGGTGGATCACCTTTAGG - Intergenic
1025215269 7:57050928-57050950 GAGGCAGGCGGATCACATCTTGG + Intergenic
1025656679 7:63525902-63525924 GAGGCAGGCGGATCACATCTTGG - Intergenic
1025696650 7:63780228-63780250 GAGGCAGGTGGATCACCTTTAGG + Intergenic
1025986572 7:66458162-66458184 GAGGCAGGTGGATCACATGAGGG + Intergenic
1025994634 7:66520219-66520241 GAGGCGGGAGGATCACCTGAAGG - Intergenic
1026028435 7:66767232-66767254 GAGGCGGGTGGATCACCTGAGGG - Intronic
1026033436 7:66814933-66814955 GAGGCAGGAGGATCACCTGAGGG + Intergenic
1026336936 7:69402264-69402286 GAGGCGGGAGGATCACTTGAGGG - Intergenic
1026393062 7:69921832-69921854 GAGGCAGGCAGATCACCTGAGGG + Intronic
1026974051 7:74485688-74485710 GAGGCAGGTGGATCACTTGAGGG + Intronic
1026986243 7:74556853-74556875 GAGGCAGGAGGATCACCTGAGGG - Intronic
1026989786 7:74578034-74578056 GAGACAGGAGGATCACTTGAGGG - Intronic
1027135936 7:75623963-75623985 GAGGCAGGAGGATCGCTTGAGGG + Intronic
1027209837 7:76137006-76137028 GAGGCAGGTGGATCACCTGAGGG + Intergenic
1027748041 7:82103074-82103096 AAGGCAGGCGGATCACTTGAGGG + Intronic
1028448279 7:90950301-90950323 AAGGCAGGTGGGTCACCTGAAGG - Intronic
1028449237 7:90962253-90962275 AAGGCGGGTGGATCACCTGAGGG + Intronic
1028894863 7:96029682-96029704 AAGACAGGTGGATCACTTGAGGG + Intronic
1029071335 7:97901422-97901444 AAGGCAGGCGGATCACTTGAGGG - Intergenic
1029369206 7:100137204-100137226 GAGGCAGGCGGATTACCTGAGGG - Intergenic
1029521540 7:101065961-101065983 GAGGTGGGTGGATCACCTGAGGG + Intergenic
1029589749 7:101499449-101499471 GAGGTGGGTGGATCACCTGAAGG + Intronic
1029667541 7:102005565-102005587 GAGGCAGGAGGATCACTTGAGGG - Intronic
1029669495 7:102019454-102019476 AAGGCAGGTGGATCACATGAGGG - Intronic
1029743583 7:102504766-102504788 GAGGCAGGCAGATCACCTGAGGG + Intronic
1029957834 7:104658567-104658589 GAGGCAGGTGGATCACTTGAGGG + Intronic
1030226288 7:107155319-107155341 GAGGCAGGTAGATCACTTCAAGG + Intronic
1030300079 7:107965867-107965889 AAGGCAGGTGGATCACTTGCAGG + Intronic
1030520233 7:110589271-110589293 AAGGCAGGAGGATCACCTGAGGG - Intergenic
1031057012 7:117003053-117003075 GAGGCAGGTGGATCACCTGAGGG - Intronic
1031228979 7:119080882-119080904 GAGGCAGGTGAATCACCTGGAGG - Intergenic
1031856577 7:126929663-126929685 GAGGGGGGTGGATCACCTGAGGG - Intronic
1032009331 7:128332581-128332603 GAGGCAGATGGATCACTTGAGGG - Intronic
1032231430 7:130078134-130078156 GAGGCGGGCGGATCACTTGAGGG + Intronic
1032607881 7:133377118-133377140 GAGGTAGGTGGATCATTTGAGGG + Intronic
1032619368 7:133512196-133512218 GTGGCAGGTGGATCACCTGAGGG + Intronic
1032812092 7:135430404-135430426 GAGGCAGGAGGAACACCTGAGGG + Intronic
1032828459 7:135596163-135596185 AAGGCAGGCGGATCACCTGAGGG - Intronic
1033038559 7:137897592-137897614 GAGGCAGGTGGGTCACCTGTTGG - Intronic
1033103198 7:138494500-138494522 GAGGCAGGAGGACCACTTGATGG + Intronic
1033337396 7:140465265-140465287 GAGGCAGGTGGATTACTTGAGGG + Intronic
1033709931 7:143932365-143932387 GAGGCATGTGGATCATTTGAGGG - Intergenic
1033736031 7:144222745-144222767 AAGGCGGGTGGATCACTTGAGGG - Intergenic
1033747022 7:144328207-144328229 AAGGCGGGTGGATCACTTGAGGG + Intergenic
1033876411 7:145823763-145823785 AAGGCAGGCGGATCACCTGAGGG - Intergenic
1033942954 7:146678303-146678325 GAGGTTGGTGGATCACTTGAGGG - Intronic
1034290793 7:149929760-149929782 GAGGCGGGCGGATCACCTGAGGG - Intergenic
1034598740 7:152226461-152226483 GAGGCAGGTGGATCACTTGAGGG - Intronic
1034660279 7:152763082-152763104 GAGGCGGGCGGATCACCTGAGGG + Intronic
1035196915 7:157229546-157229568 AAGGCAGGTGGGTCACCTGAGGG - Intronic
1035441508 7:158905370-158905392 GAGGCAGGCGGATCACTTGAGGG - Intronic
1035667405 8:1389182-1389204 GAGGCACGTGGACCTCTTTATGG + Intergenic
1036146327 8:6258153-6258175 GAGGCAGGTGGATCACCTGAGGG - Intergenic
1036254423 8:7193858-7193880 AAGGCAGGCGGATCACTTGAGGG - Intergenic
1036363072 8:8093630-8093652 AAGGCAGGCGGATCACTTGAGGG + Intergenic
1036392081 8:8332393-8332415 GAGGTGGGTGGATCACCTGAAGG - Intronic
1036927544 8:12921743-12921765 GAGGCAGGCAGATCACCTGAGGG - Intergenic
1037171587 8:15899106-15899128 GAGGCACGTGGGCGAGATGATGG - Intergenic
1037385358 8:18334186-18334208 AAGGCAGGCGGATCACCTGAGGG + Intergenic
1037432569 8:18829148-18829170 GAGACAGGTGGATCAACTGAAGG + Intronic
1037786213 8:21904834-21904856 GAGGCAGGTGGATCACCTGAAGG + Intergenic
1037814722 8:22106050-22106072 GAGGCAGGAGGATCGCTTGAAGG - Intergenic
1037847138 8:22293554-22293576 GAGGCAGGCGGATTACCTGACGG - Intronic
1038022255 8:23560541-23560563 CAGGCAGGTGGAAGAAATGATGG + Intronic
1038073261 8:24041699-24041721 GAGGCAGGTGGATCACCTGAGGG - Intergenic
1038245408 8:25850343-25850365 AAGGCAGGTGGATCACTTGGAGG - Intronic
1038300546 8:26342958-26342980 GAGGCAGGTGGATCACTTGAGGG + Intronic
1038399672 8:27273549-27273571 GAGGCAGGTGGATCACTTGAGGG - Intergenic
1038412613 8:27369741-27369763 AAGGCAGGTGGATCACCTGAGGG + Intronic
1038528538 8:28297618-28297640 GAGGCAGGAAGACCACATTCTGG - Intergenic
1038568929 8:28643010-28643032 GAGGCAGATGGATCACCTGAGGG + Intronic
1038597076 8:28897212-28897234 AAGGCGGGTGGATCACCTGAGGG - Intronic
1038737133 8:30180798-30180820 GAGGCAGGAGGATGACTTGAGGG + Intronic
1038782395 8:30579408-30579430 GAGAAAGGAGGAGCACATGAAGG + Intronic
1038787433 8:30631862-30631884 GAGGCAGGCGGATCACTTGAGGG + Intronic
1038973704 8:32667979-32668001 GAGGCAAGCGGATCACCTGAGGG + Intronic
1039121517 8:34152977-34152999 GAGGCGGGTAGATCACCTGAAGG + Intergenic
1039198841 8:35063592-35063614 GAGGCGGGTGGGTCACTTGAGGG + Intergenic
1039512271 8:38101760-38101782 GAGGTGGGTGGATCACATGGGGG + Intergenic
1039541205 8:38372725-38372747 GAGGCGGGCGGAGCACCTGAGGG - Intronic
1039637840 8:39185030-39185052 GAGGCAGGTGGATCACTTGAGGG + Intronic
1039896315 8:41719158-41719180 GAGGCAGAGGAACCACAGGAGGG + Intronic
1039981616 8:42413457-42413479 GAGGCGGGTGGATCACTTGAGGG - Intergenic
1040504990 8:48039129-48039151 AAGGCAGGTGGATCACCTGAGGG - Intronic
1040722694 8:50345361-50345383 GAAGCAGGTGGACCACTCGCAGG - Intronic
1041034974 8:53779925-53779947 AAGGCAGGCGGATCACCTGAAGG + Intronic
1041063868 8:54062087-54062109 GAGGCGGGTGGGTCACCTGAAGG - Intronic
1041229075 8:55730905-55730927 GACACAGGTGGATCACCTGAGGG + Intronic
1041763458 8:61392624-61392646 GAGGCAGGTGGATCACTTGAGGG + Intronic
1041763649 8:61394113-61394135 GAGGCAGGTGGATCACTTGAGGG + Intronic
1042118780 8:65461310-65461332 GAGGTGGGTGGATCACCTGAGGG - Intergenic
1042122487 8:65503583-65503605 GAGGCAGGTGGATCACTTAAGGG - Intergenic
1042323046 8:67498302-67498324 GAGGCGGGTGGATCACTTGAGGG + Intronic
1042525435 8:69759878-69759900 GAGGCAGGTGGATCACTTGAAGG - Intronic
1042603477 8:70523100-70523122 GAGGCAAGTGAATCACTTGAAGG + Intergenic
1043293972 8:78641245-78641267 GAGTCAGGTGGATCACTTGAGGG + Intergenic
1043391378 8:79795509-79795531 TAGGCAGGCGGATCACTTGAGGG - Intergenic
1043542695 8:81280920-81280942 GAGGTAGGTGGACCACGGGGTGG - Intronic
1043650979 8:82591806-82591828 GAGGCAGGCAGATCACTTGAGGG + Intergenic
1043806985 8:84683931-84683953 GAGGTGGGTGGATCACCTGAGGG - Intronic
1044208754 8:89523681-89523703 GAGGCAGGCAGATCACCTGAGGG - Intergenic
1044655669 8:94545821-94545843 GAGGCAGGAGGATCACTTGAGGG + Intronic
1044997122 8:97848030-97848052 GAGGCAGTCGGATCACCTGAGGG + Intronic
1045023878 8:98067833-98067855 GAGGCGGGTGGATCACCTGAGGG - Intronic
1045182879 8:99804899-99804921 GAGGCAGGAAGATCACTTGAGGG + Intronic
1045862763 8:106831584-106831606 GAGGCGGGCGGATCACTTGAGGG - Intergenic
1046912602 8:119645591-119645613 GAGGCAGGTGGACCTGAGGTTGG + Intronic
1047596696 8:126385283-126385305 GAGGCAGGATGATCACTTGAGGG + Intergenic
1047613774 8:126545891-126545913 GAGGCAGGGGGATCACTTGAGGG + Intergenic
1047973153 8:130103743-130103765 GAGGCAGGTGGATCACCTGAGGG - Intronic
1048953948 8:139518633-139518655 GAGGCAGGTGGATCACCTGAGGG + Intergenic
1049171300 8:141162702-141162724 GAGGTGGGTGGATCACCTGAGGG + Intronic
1049198227 8:141326973-141326995 GAGACAGATGTGCCACATGAAGG + Intergenic
1049395836 8:142400101-142400123 CAGGCAGGTTGATCACCTGAAGG + Intronic
1049395854 8:142400210-142400232 GAGGCAGGTTGATCACCTAAAGG + Intronic
1049851725 8:144835907-144835929 AAGGCGGGTGGATCACCTGAAGG - Intronic
1049957359 9:705830-705852 GAGGAGGGTGGATCACTTGAAGG - Intronic
1049966204 9:782391-782413 GAGGCAGGTGGATTACCTGAGGG - Intergenic
1050715232 9:8517040-8517062 GAGGTAGGTGGATCACTTGAGGG - Intronic
1051333682 9:16047491-16047513 GAGACAGGGGGACCACCTGGAGG - Intronic
1051527729 9:18065747-18065769 GAGGCGGGTGGATCACCTGAAGG + Intergenic
1052440384 9:28489399-28489421 GAGGCAGGTGGATCACTTTGAGG - Intronic
1052528642 9:29654596-29654618 GAGGTGGGTGGATCACCTGAGGG + Intergenic
1052597359 9:30576440-30576462 GAGGCAGGTGGATCACTTAAGGG - Intergenic
1052891183 9:33701654-33701676 GAGGCAGGTGGATCACTTTGAGG + Intergenic
1053402522 9:37838657-37838679 GAGGCAGGCAGATCACCTGAGGG + Intronic
1053650893 9:40168480-40168502 GAGGCAGTTGGTCCACACCAAGG - Intergenic
1053668652 9:40337677-40337699 GAAGCAGGAGGATCACCTGAGGG + Intergenic
1053669287 9:40345171-40345193 GAAACAGGCGGATCACATGAGGG + Intergenic
1053670853 9:40359616-40359638 GAAACAGGCGGATCACATGAGGG - Intergenic
1053918459 9:42963951-42963973 GAAGCAGGAGGATCACCTGAGGG + Intergenic
1053919088 9:42971411-42971433 GAAACAGGCGGATCACATGAGGG + Intergenic
1054379789 9:64477719-64477741 GAAGCAGGAGGATCACCTGAGGG + Intergenic
1054380419 9:64485193-64485215 GAAACAGGCGGATCACATGAGGG + Intergenic
1054381973 9:64499678-64499700 GAAACAGGCGGATCACATGAGGG - Intergenic
1054513760 9:66016685-66016707 GAAACAGGCGGATCACATGAGGG + Intergenic
1054515329 9:66031119-66031141 GAAACAGGCGGATCACATGAGGG - Intergenic
1054515959 9:66038617-66038639 GAAGCAGGAGGATCACCTGAGGG - Intergenic
1054533687 9:66207723-66207745 GAGGCAGTTGGTCCACACCAAGG + Intergenic
1055076736 9:72222937-72222959 AAGGCAGGTGGATCACCTGAGGG - Intronic
1055709822 9:79048679-79048701 GAGGCAGGAGGACTACTTAAGGG + Intergenic
1055745222 9:79436894-79436916 GATTCAGGTGGTACACATGAAGG - Intergenic
1056497680 9:87176161-87176183 GAAGCAGGTGCATCACATGGGGG - Intergenic
1056664545 9:88571299-88571321 GAGGCAAGTGGATCACCTGAAGG - Intronic
1056989929 9:91401207-91401229 GAGGCAGGCGGATCACCTGAGGG - Intergenic
1057014160 9:91635695-91635717 GAGATAGGTGGATCACTTGAGGG + Intronic
1057172710 9:92973344-92973366 AAGGCAGATGGATCACTTGAGGG - Intronic
1057680937 9:97184072-97184094 GAGGCGGGTGGATCACCTAAGGG - Intergenic
1058360700 9:104143082-104143104 GGTACAGGTGGACCAGATGACGG + Intergenic
1058718219 9:107740673-107740695 GAGACAGGGGGAAGACATGAAGG + Intergenic
1058908768 9:109501797-109501819 GAGGCAGGATCACAACATGATGG + Intergenic
1058974191 9:110110776-110110798 GGGGCAGGTGGATCATTTGAGGG - Intronic
1058996400 9:110302830-110302852 GAGGCAGGAGGATCACTTGAGGG + Intergenic
1059072720 9:111155847-111155869 GAGGCAGAAGGACCACTTGAAGG - Intergenic
1060475746 9:123985302-123985324 GAGGTGGGTGGATCACTTGAGGG - Intergenic
1060641076 9:125239645-125239667 GAGGCAGGAGGATCACCTGAGGG + Intronic
1061232963 9:129325572-129325594 GAGGTGGGTGGATCACCTGAGGG + Intergenic
1061337657 9:129951958-129951980 GAGGCGGGAGGATCACCTGAAGG + Intronic
1061407923 9:130402957-130402979 GAGGCAGGTGGGGCTCAGGATGG + Intronic
1061580900 9:131535368-131535390 GAGGCAGGAGGATCACCTGAGGG - Intergenic
1061697762 9:132390209-132390231 GAGGCAGGCAGATCACTTGAGGG - Intronic
1061754808 9:132804880-132804902 GAGGCAGGGGCAGGACATGAGGG - Intronic
1061965011 9:134008465-134008487 GAGGCAGGAGGACCACCTGGAGG - Intergenic
1062301116 9:135870560-135870582 GAGGCAGATGGATCACTTGAAGG + Intronic
1062378219 9:136274555-136274577 GAGGCAGGTGCACAACAGGGAGG - Intergenic
1062647713 9:137557585-137557607 GAGGCAGGTGGATCACATGAGGG + Intronic
1203783336 EBV:113554-113576 GAAGCAGGTGGCACACATTACGG - Intergenic
1185600417 X:1335341-1335363 GAGGCGGGTAGATCACCTGAGGG - Intergenic
1185661649 X:1733267-1733289 GAGGCAGGCCGATCACCTGAGGG + Intergenic
1186086589 X:5996826-5996848 GAGGCCGGCGGATCACTTGAGGG - Intronic
1186675111 X:11808298-11808320 GAGGTAGGAGGATCACCTGAGGG + Intergenic
1186957393 X:14698445-14698467 GAGGTGGGTGGATCACCTGAGGG + Intronic
1187015485 X:15323423-15323445 GAGGCAGGGGGACATCAAGATGG + Intronic
1187055916 X:15741297-15741319 GAGGAGGGTGGATCACTTGATGG - Intronic
1187333818 X:18364530-18364552 GAGGCAGGCTGATCACCTGAGGG + Intergenic
1187408626 X:19026725-19026747 GAGGCAGGTGGATCACCTGAAGG - Intronic
1187551371 X:20309197-20309219 GAGGCAGGAGAACCACTTGAGGG - Intergenic
1187706473 X:22014503-22014525 GAGGCGGGTGGATCACCTGTGGG - Intergenic
1187900445 X:24022964-24022986 GAGGCGGGCGGATCACCTGAGGG - Intronic
1188021332 X:25161917-25161939 AAGGCAGGCGGATCACTTGAGGG - Intergenic
1188023208 X:25181253-25181275 GAGGCAGGTGGATCACTTGAAGG - Intergenic
1188080127 X:25828646-25828668 GATGCAGTTGGACCAGATGTGGG + Intergenic
1188105518 X:26143509-26143531 GAGGCAGGAGAATCACTTGAAGG - Intergenic
1188145617 X:26608728-26608750 AAGACGGGTGGACCACTTGAGGG + Intergenic
1189273596 X:39768960-39768982 GATTCAGGAGGGCCACATGAGGG + Intergenic
1189410251 X:40764154-40764176 GAGGCGGGTGGATCACCTTAAGG + Intergenic
1189687764 X:43583588-43583610 GAGGTGGGTGGATCACCTGAGGG - Intergenic
1189718941 X:43895207-43895229 GAGGTAGGGGGATCACTTGAAGG - Intergenic
1189913070 X:45830375-45830397 GAGGAAGGTGGAGGACAAGAAGG + Intergenic
1190078690 X:47338062-47338084 GAGGCAGGTGGATCACCTGAGGG - Intergenic
1190228992 X:48566906-48566928 GAGGCAGGTGGATCACTTGAAGG + Intergenic
1190286384 X:48964148-48964170 GAGGCAGGTGGACCACCTGAAGG + Intronic
1192075360 X:67989853-67989875 GAGGCAGGAGGATCACTTGAGGG + Intergenic
1192099195 X:68246034-68246056 GAGGTGGGTGGATCACCTGAGGG - Intronic
1192223504 X:69213087-69213109 GAGGTGGGTGGATCACCTGAGGG - Intergenic
1192339143 X:70248130-70248152 GAGGCAGGTGGATCACTTGAGGG - Intergenic
1192449236 X:71233124-71233146 GAGGCGGGTGGATCGCTTGAGGG + Intergenic
1192991273 X:76460197-76460219 GAGGCTGGTGGATCATTTGAGGG - Intergenic
1193843460 X:86438455-86438477 GAGGCAGGTGGATCACCTGAGGG - Intronic
1193946821 X:87747709-87747731 GAGGCGGGTGGATTACCTGAGGG - Intergenic
1194062534 X:89222194-89222216 GAGGCAGGTGAATCACCTGAGGG + Intergenic
1194917046 X:99719779-99719801 AGAGCAGGTGGACAACATGAAGG - Intergenic
1195385130 X:104306851-104306873 GAGGCAGGCGAATCACTTGAGGG - Intergenic
1196680297 X:118463416-118463438 GAGGCGGGTGGATCACCTGAGGG - Intergenic
1197435250 X:126420098-126420120 GAGGCAGGAGGATCACCTGGAGG - Intergenic
1198254345 X:134912408-134912430 GAGGCAGGTGGATCACCTGAGGG - Intronic
1198341568 X:135719551-135719573 GAGGTGGGTGGATCACCTGAGGG - Intronic
1198346430 X:135763810-135763832 GAGGTGGGTGGATCACCTGAGGG + Intronic
1198348336 X:135781095-135781117 GAGGTGGGTGGATCACCTGAGGG + Intergenic
1198350240 X:135798357-135798379 GAGGTGGGTGGATCACCTGAGGG + Intronic
1198352148 X:135815631-135815653 GAGGTGGGTGGATCACCTGAGGG + Intronic
1198354056 X:135832899-135832921 GAGGTGGGTGGATCACCTGAGGG + Intronic
1198355966 X:135850148-135850170 GAGGTGGGTGGATCACCTGAGGG + Intronic
1198357879 X:135867428-135867450 GAGGTGGGTGGATCACCTGAGGG + Intergenic
1198359793 X:135884710-135884732 GAGGTGGGTGGATCACCTGAGGG + Intronic
1199030140 X:142987970-142987992 GAGGTGGGTGGATCACTTGAGGG - Intergenic
1200406098 Y:2813047-2813069 AAGACAGGTGGATCACTTGAGGG + Intergenic
1200716401 Y:6551171-6551193 GAGGCAGGTGAATCACTTGAGGG + Intergenic
1201428592 Y:13882376-13882398 GAGGCAGGAGGACTATTTGAGGG - Intergenic
1201452054 Y:14127690-14127712 GAGGAAGGAGGATCAGATGAAGG - Intergenic
1201509497 Y:14743260-14743282 AAGGCAGGTGGATCACTTGAGGG + Intronic
1202196566 Y:22304416-22304438 GAGGCAGGGGAATCACTTGAAGG + Intergenic