ID: 970882776

View in Genome Browser
Species Human (GRCh38)
Location 4:20951135-20951157
Sequence ATGCATGTATAGGTGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 295}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970882776_970882787 11 Left 970882776 4:20951135-20951157 CCCTGCCCCACCTATACATGCAT 0: 1
1: 0
2: 2
3: 40
4: 295
Right 970882787 4:20951169-20951191 CATGTGAGGACACAGTGGGAAGG 0: 10
1: 226
2: 692
3: 1617
4: 2712
970882776_970882785 6 Left 970882776 4:20951135-20951157 CCCTGCCCCACCTATACATGCAT 0: 1
1: 0
2: 2
3: 40
4: 295
Right 970882785 4:20951164-20951186 GAGATCATGTGAGGACACAGTGG 0: 1
1: 2
2: 11
3: 73
4: 372
970882776_970882784 -3 Left 970882776 4:20951135-20951157 CCCTGCCCCACCTATACATGCAT 0: 1
1: 0
2: 2
3: 40
4: 295
Right 970882784 4:20951155-20951177 CATAGAAGGGAGATCATGTGAGG 0: 1
1: 0
2: 3
3: 38
4: 372
970882776_970882786 7 Left 970882776 4:20951135-20951157 CCCTGCCCCACCTATACATGCAT 0: 1
1: 0
2: 2
3: 40
4: 295
Right 970882786 4:20951165-20951187 AGATCATGTGAGGACACAGTGGG 0: 2
1: 6
2: 20
3: 101
4: 362
970882776_970882788 30 Left 970882776 4:20951135-20951157 CCCTGCCCCACCTATACATGCAT 0: 1
1: 0
2: 2
3: 40
4: 295
Right 970882788 4:20951188-20951210 AAGGCAGCCATCAGCCATCCAGG 0: 1
1: 0
2: 8
3: 158
4: 550

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970882776 Original CRISPR ATGCATGTATAGGTGGGGCA GGG (reversed) Intronic
901548011 1:9973732-9973754 ATGCATGAATAGGCTGGGCGTGG + Intronic
904464546 1:30700086-30700108 ATGGATGGATAGGTGGTGGAGGG - Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905512958 1:38537681-38537703 ATGCATACAGGGGTGGGGCATGG + Intergenic
906629501 1:47354032-47354054 AAAGATGTATAGGTTGGGCATGG + Intronic
906845410 1:49186173-49186195 ATGTATGCATAGGGGAGGCAGGG - Intronic
907225216 1:52939958-52939980 AAACATGTACAGGTTGGGCATGG - Intronic
909186184 1:72489264-72489286 ATGCATTTTTAGGTGGGGCCAGG - Intergenic
910353132 1:86322833-86322855 ATGCATTTATAAGTTGAGCAAGG - Intergenic
911371945 1:97004367-97004389 CTGCATGAATAGCTGGGGCTGGG + Intergenic
911484572 1:98489290-98489312 GTGAATGTATTGGTGGGGGAGGG - Intergenic
911650611 1:100383717-100383739 TTGCATGTTTAGGAGGTGCATGG + Intronic
911956123 1:104237274-104237296 ATGCATTTATAGGCTGGGCACGG + Intergenic
913673790 1:121122560-121122582 ATGCATATATAGGCCGGGCGTGG - Intergenic
914025568 1:143909912-143909934 ATGCATATATAGGCCGGGCGTGG - Intergenic
914664005 1:149817637-149817659 ATGCATATATAGGCCGGGCGTGG - Intergenic
914671760 1:149876206-149876228 ATGCATATATAGGCGGGGCGTGG + Intronic
915299409 1:154943562-154943584 ATTCATGTGTGGGTGGGGCAGGG - Intergenic
915299776 1:154945316-154945338 ATGCAGGTAGAGGTAGGGCAGGG + Intronic
915442053 1:155951411-155951433 ATGCCTGTTTAGGTGGGGCATGG - Intronic
915585158 1:156840432-156840454 ATGCATGTATGGGAGGGGGGTGG - Exonic
915640995 1:157226129-157226151 ATGCATGTTTAGTGGGGTCAAGG - Intergenic
917106439 1:171497079-171497101 ACAAATGTATTGGTGGGGCATGG - Intronic
918628967 1:186692719-186692741 ATAAATGTATAGGTTGGGCAAGG - Intergenic
919305076 1:195822064-195822086 ATGCTTTTTTAGGTCGGGCACGG + Intergenic
919569462 1:199228420-199228442 TTGCATTTATATGTTGGGCATGG + Intergenic
920184348 1:204151192-204151214 ATGCATGTATGGCTGGGTCGGGG + Intronic
920563231 1:206954150-206954172 ATGCCTGTAGAGGTGCAGCATGG + Intergenic
921242258 1:213197125-213197147 AGGCATGTAGAGGCCGGGCACGG - Intronic
922178490 1:223215462-223215484 ATGCATGGAGAGGTGGGGGAAGG - Intergenic
924463820 1:244282844-244282866 ATGCTTGTGAAGGTGGGGCCTGG - Intergenic
1062813375 10:481865-481887 ATGGATGTGTGGGTGCGGCACGG - Intronic
1063454466 10:6173516-6173538 GAGCATATATAGGTGGGGGAAGG - Intronic
1063976613 10:11422893-11422915 ATACATGTACACGTGGGGTACGG - Intergenic
1064166858 10:12994105-12994127 CAGCATCTAGAGGTGGGGCATGG + Intronic
1064326595 10:14356994-14357016 ATACGTGTAAGGGTGGGGCATGG + Intronic
1064723735 10:18256648-18256670 ATCCATGTTTAGGCCGGGCATGG + Intronic
1065728482 10:28689566-28689588 AAGAATGTATATGTTGGGCAGGG + Intergenic
1066285850 10:33965433-33965455 ATTCATGTGCAGCTGGGGCAGGG - Intergenic
1067337821 10:45378973-45378995 CTGCAGGTGTAGGTAGGGCAGGG + Intronic
1067730620 10:48808596-48808618 ATGCATATACAGGTTGAGCAAGG - Intronic
1072933330 10:99687553-99687575 ATGAATGAATAGGCTGGGCACGG - Intronic
1075883607 10:125877033-125877055 ATGAATGTATGGAGGGGGCAGGG + Intronic
1078464696 11:11541597-11541619 ATGCATTTGTGGGTGGGGCTGGG - Intronic
1079385377 11:19974293-19974315 AAGGATGAATAGGTGGAGCATGG + Intronic
1080883942 11:36348416-36348438 ATGCATAGAAAGGTGAGGCAGGG - Intronic
1082991027 11:59207252-59207274 AAGAAGGTATAGGTGGGGAAGGG + Exonic
1083000143 11:59283850-59283872 AAGAAAGTATAGGTGGGGAAAGG + Intergenic
1083402403 11:62432955-62432977 ATACATGTATTGGCCGGGCATGG + Intergenic
1083866994 11:65460651-65460673 ATGCATGAATAGGCCAGGCATGG - Intergenic
1087471845 11:98585251-98585273 ATGCAAGTTAAGGTCGGGCACGG + Intergenic
1089408261 11:118216897-118216919 ATCCATGTATGTATGGGGCAAGG - Intronic
1090001788 11:122967524-122967546 ATGAATGGAGACGTGGGGCAGGG + Intergenic
1090698815 11:129276594-129276616 ATGCATATAAAGGCTGGGCAGGG - Intronic
1091167627 11:133493432-133493454 ATGCATGTACACATGGGGGAAGG - Intronic
1091386839 12:101292-101314 ATGTAGGTAGATGTGGGGCAGGG + Intronic
1092382991 12:8013199-8013221 ATGCAAGTATAGGACGGGCGTGG + Intergenic
1092484710 12:8892576-8892598 ATACATGTATAGGCTGGGCACGG - Intergenic
1092836397 12:12493114-12493136 ATGGATGTATGAATGGGGCAGGG - Intronic
1095450685 12:42327389-42327411 CTGCATTTAAAGGTTGGGCATGG + Intronic
1095496122 12:42785880-42785902 ATGCATCTAAAACTGGGGCAGGG + Intergenic
1099050683 12:77778320-77778342 ATGCATTTATAGGCCGGGCGCGG + Intergenic
1100501911 12:95182489-95182511 ATGTATGTATAGGCTGGGCAAGG - Intronic
1100543600 12:95580642-95580664 ATGTATATGTAGGTGGGGAAAGG + Intergenic
1102554317 12:113716816-113716838 ATGCATGTACAGGCTGGGCGTGG - Intergenic
1103219085 12:119228566-119228588 ACGCATAAATAGGTTGGGCACGG + Intergenic
1103342740 12:120229811-120229833 AAGCAGGTAAATGTGGGGCATGG + Intronic
1103528839 12:121585722-121585744 AAGAATGTATGGGTCGGGCACGG - Intergenic
1106586324 13:31059267-31059289 ATGCATGAATAAATGGGGGAAGG + Intergenic
1107179985 13:37447639-37447661 GTGCATGAGGAGGTGGGGCAAGG + Intergenic
1108368729 13:49745771-49745793 ATATATGTATAGGCCGGGCACGG + Intronic
1109686221 13:65823188-65823210 ATACCTGTTTAGGTAGGGCAGGG + Intergenic
1109726832 13:66352124-66352146 ATGAATGTGTAGGCCGGGCACGG - Intronic
1111728088 13:92038400-92038422 ATCCCTGTTTGGGTGGGGCATGG + Intronic
1113273338 13:108700040-108700062 AAGCATTTATAGGCTGGGCATGG + Intronic
1114288123 14:21265050-21265072 ATTCATGTATAGTTGGCTCAAGG - Intronic
1114719218 14:24862286-24862308 ATCCAGGTTTAGGTCGGGCATGG - Intronic
1114769223 14:25409835-25409857 ATACATGTTTAGGCCGGGCACGG + Intergenic
1115529977 14:34318126-34318148 ATGCAGGTATATGTTGGGCTTGG - Intronic
1115855452 14:37625255-37625277 ATGCAAGTATAGGCCGGGCGCGG + Intronic
1116164612 14:41318647-41318669 ATGCATGTATGTGTGGAGTATGG - Intergenic
1116486621 14:45457223-45457245 ATATATGTATATGTGGGGGAAGG - Intergenic
1117125738 14:52623170-52623192 ATGAATGTACAGATGTGGCAGGG - Intronic
1117363317 14:54999336-54999358 ATGCATGTGAAGATGGGGGAGGG + Intronic
1117571152 14:57050340-57050362 ATGCATGAATAGCTGTGGGAAGG - Intergenic
1119809318 14:77503057-77503079 AAGCATGAATCGGCGGGGCATGG - Intergenic
1120769842 14:88367011-88367033 ATGAATGGATAGGCCGGGCATGG - Intergenic
1121077410 14:91080911-91080933 AAGCATGTATTGGCCGGGCACGG + Intronic
1122037195 14:98957466-98957488 ATGCATGTGAAGGGGAGGCAAGG + Intergenic
1122625217 14:103082025-103082047 ATGGATGGATAGGTGGTGGATGG + Intergenic
1123126066 14:105947088-105947110 ATGCATGGATAAGTGGTGGACGG - Intergenic
1124395692 15:29299862-29299884 ATGGATGAGTAGGTGGGGGATGG + Intronic
1124547047 15:30638547-30638569 ATGGAAGTATAAGTGGGGAATGG + Intronic
1124780647 15:32628529-32628551 ATGGAAGTATAAGTGGGGAATGG + Intronic
1124974274 15:34518620-34518642 ATGTATATATAGGCCGGGCATGG + Intergenic
1125664690 15:41421028-41421050 GTACATGTATAGGCTGGGCATGG + Intronic
1125843125 15:42824304-42824326 ATGCACGTTTTGGTGGGGGAGGG - Intronic
1128012525 15:64311334-64311356 ATGCGTGTGTAGGCTGGGCATGG - Intronic
1128045198 15:64612023-64612045 ATGCAAGTACAGGCTGGGCACGG - Intronic
1130041543 15:80409216-80409238 AGGAATGAATAGGTGGAGCATGG - Intronic
1131219783 15:90572864-90572886 ATGGATATATTGGCGGGGCATGG - Intronic
1135462095 16:22653572-22653594 ATAAATGTACTGGTGGGGCATGG + Intergenic
1137005472 16:35271453-35271475 AGTCATGGATAGGTGGGGTAAGG + Intergenic
1137494997 16:48962720-48962742 ATGCAGGTATAAGTGAAGCATGG + Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1139812606 16:69635440-69635462 ATGTATATATATGTGGGCCATGG + Intronic
1140859509 16:79006675-79006697 ATCCAGGTGTAGGTGGGGCTGGG + Intronic
1141067771 16:80927707-80927729 ATGCATGTGGAGGTGAGGAAGGG + Intergenic
1141330689 16:83108290-83108312 AAACATTTACAGGTGGGGCATGG - Intronic
1141395753 16:83702920-83702942 ATGCATGTGGAGGTGGGGCAGGG + Intronic
1141710866 16:85698280-85698302 GTACATGAATAGGTGTGGCAGGG - Intronic
1143284935 17:5781868-5781890 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143284952 17:5781958-5781980 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143451043 17:7036832-7036854 ACTCAGGTATAGGTGGGTCAAGG - Exonic
1144270173 17:13607733-13607755 ATGCATCCAGAGGTGGGGCAGGG + Intergenic
1144502357 17:15799669-15799691 ATACATGTCTAGGCCGGGCACGG + Intergenic
1145236461 17:21211972-21211994 ATGACTGTTCAGGTGGGGCAGGG - Intronic
1145982372 17:29020539-29020561 GTGCGTGTGTTGGTGGGGCAGGG + Intronic
1146733720 17:35218403-35218425 ATGCAAGTATAGGCCGGGCATGG - Intergenic
1146993608 17:37297842-37297864 ATGTATATATAGGCTGGGCACGG - Intronic
1150127823 17:62649814-62649836 ATGTATGTATCGGTGGGGCGGGG - Intronic
1151150647 17:72083197-72083219 AGGCATGGATAGGTGAAGCAAGG + Intergenic
1151339655 17:73462654-73462676 ACGCATGTATATGTGGTGGAAGG + Intronic
1152556451 17:81055464-81055486 AGGGATGTAGAGGAGGGGCAGGG - Intronic
1155521077 18:26669719-26669741 ATGCTGGTCTAGGTTGGGCATGG + Intergenic
1157331099 18:46704519-46704541 GAGCATGTGGAGGTGGGGCAGGG - Intronic
1157584947 18:48794924-48794946 TTGCATGGATAGATGGGTCAGGG + Intronic
1158240158 18:55368460-55368482 ATGAATGTCTAGGTGAGGCTGGG - Intronic
1159013053 18:63076717-63076739 ATGCATAGATGGGTGGCGCACGG - Intergenic
1160681819 19:415181-415203 ATGGATGTGTAGATGGGGGATGG + Intergenic
1160681860 19:415434-415456 ATGGATGTGTAGATGGGGGATGG + Intergenic
1161347699 19:3776422-3776444 ATGCATGGATGGGTGGGGACAGG + Intergenic
1161423662 19:4190143-4190165 ATCCATGTATAGGCTGGGCGTGG + Intronic
1162186256 19:8907277-8907299 TTGCATGTTGAGTTGGGGCATGG + Intronic
1162904261 19:13814337-13814359 ATGCATGTGTAGGCTGGGCATGG - Intronic
1163407998 19:17135681-17135703 ATGCATGGATAATTGGTGCACGG + Intronic
1163483564 19:17573101-17573123 CTGCATGTATAGGCCAGGCATGG + Intronic
1163793845 19:19324252-19324274 AGGCCTGAATGGGTGGGGCAGGG + Intronic
1165321517 19:35088342-35088364 ACCCTTGTAGAGGTGGGGCAGGG - Intergenic
1167583643 19:50360980-50361002 ATGGATGTACTGGTGGAGCAGGG - Exonic
1168033534 19:53700717-53700739 ACACAAGTACAGGTGGGGCACGG - Intergenic
1168038087 19:53736355-53736377 ACACAAGTACAGGTGGGGCACGG - Intergenic
1168189891 19:54730261-54730283 ATACATTTATAGGCTGGGCACGG + Intronic
1168414295 19:56158981-56159003 ATGGATGGATGGGTGGGTCATGG - Intronic
925310908 2:2880975-2880997 AGACAAGTCTAGGTGGGGCAGGG - Intergenic
926146127 2:10398092-10398114 ATGCAGGAGCAGGTGGGGCAGGG - Intronic
928160377 2:28918657-28918679 ATACATATATAGGCTGGGCATGG - Intronic
929259370 2:39847605-39847627 ATTGATGCATAAGTGGGGCATGG + Intergenic
930805792 2:55488648-55488670 TTTCAAATATAGGTGGGGCAGGG - Intergenic
934913838 2:98282012-98282034 GTGCATGTATAGGCGAGGTATGG + Intronic
935402820 2:102678356-102678378 ATGCATGAAAAGGGGGGGGAAGG + Intronic
937661097 2:124430444-124430466 ATGCATGTATGTGTGGGGCTAGG - Intronic
937814532 2:126236815-126236837 ATGCATATGTAGGTGTGGGAAGG + Intergenic
939613978 2:144341910-144341932 ATGCATGTAAAGAAAGGGCAGGG + Intergenic
939825709 2:147013171-147013193 ATACATTAATAGGTCGGGCATGG + Intergenic
940933966 2:159469729-159469751 ATGTAGGTATAGGCCGGGCATGG - Intronic
943356449 2:186862017-186862039 ACGGATGTATAGGTTGGGCATGG + Intergenic
944124402 2:196277003-196277025 AGGCATGTAAAGGTGGGTAAAGG + Intronic
944802138 2:203246968-203246990 ATGAATGTTTAGGCTGGGCACGG + Intronic
946239598 2:218345514-218345536 TTGCAGGGATGGGTGGGGCAGGG - Exonic
947685813 2:232083287-232083309 ATGTATGTATATGTGGGGGGGGG - Intronic
948859310 2:240745225-240745247 ATGGATTTACAGCTGGGGCATGG - Intronic
1168980579 20:2000151-2000173 ATGCTGGTATAGGCTGGGCATGG - Intergenic
1169203167 20:3725023-3725045 AAGGATGAATAGGTGGAGCACGG + Intergenic
1169270802 20:4198072-4198094 ATGCATATATAGGCCGGGCACGG - Intergenic
1172060850 20:32186406-32186428 ATGTATCTATAGGCCGGGCATGG - Intergenic
1172674190 20:36655843-36655865 AAGAATATATAGGTTGGGCACGG + Intronic
1173503715 20:43571272-43571294 ATGCATGTACATAGGGGGCAGGG + Intronic
1173532131 20:43778012-43778034 AGGGATGAATAGGTGGAGCAGGG + Intergenic
1174306880 20:49619573-49619595 ATGGATGTGTGGGTGGGGGATGG + Intergenic
1174554446 20:51383745-51383767 GTGCATGTGTGGGTGGGGCATGG + Intergenic
1175226685 20:57448635-57448657 ATGCATGTAGAAGTGTGGCTGGG - Intergenic
1175288061 20:57851062-57851084 ATGCTGGTAGAGTTGGGGCATGG + Intergenic
1176253448 20:64138138-64138160 ATGCTGGGATAGATGGGGCAGGG + Intergenic
1177838282 21:26209766-26209788 ATGTATATTCAGGTGGGGCATGG - Intergenic
1178320299 21:31600187-31600209 ACTATTGTATAGGTGGGGCACGG + Intergenic
1178409354 21:32350770-32350792 CTGCATGGACAGGTGTGGCATGG + Exonic
1178539625 21:33438505-33438527 ATCCATTTATAGGCTGGGCACGG + Intronic
1179839355 21:44060889-44060911 ATGTATGTATAGGCTGGGCATGG - Intronic
1180862553 22:19094135-19094157 AAGCATGAAAAGGTGGGGCACGG + Intronic
1181149119 22:20870138-20870160 AAGCAAGTAGAGGTAGGGCAGGG + Intronic
1183425706 22:37738291-37738313 ATGAATGGATAGATGTGGCATGG + Intronic
1183723282 22:39574480-39574502 GTGCGTGTGTGGGTGGGGCAGGG + Intronic
1184293024 22:43508418-43508440 ATGAATGGATAGATGGGGCATGG - Intergenic
1184293071 22:43508583-43508605 ATGGATGGATAGATGGGGGATGG - Intergenic
1184293145 22:43508832-43508854 ATGGATGGATAGATGGGGGATGG - Intergenic
1184293156 22:43508867-43508889 ATGGATGGATAGATGGGGGATGG - Intergenic
1184293207 22:43509037-43509059 ATGGATGGATAGGTGGGGGACGG - Intergenic
1184293339 22:43509463-43509485 ATGGATGGATAGCTGGGGTATGG - Intergenic
1184293378 22:43509631-43509653 ATGGATGGATAGATGGGGGATGG - Intergenic
1184403269 22:44286136-44286158 ATGTAGGCAAAGGTGGGGCAGGG - Intronic
1184728337 22:46358741-46358763 CTTCATGGATAGGTGTGGCAAGG - Intergenic
949205288 3:1430865-1430887 ATGTATGTGTAGGGAGGGCATGG + Intergenic
949251720 3:1993009-1993031 ATGCATGGATAGTTGGTGGAAGG + Intergenic
950174224 3:10861223-10861245 ATGCATGAAGAGGCCGGGCATGG + Intronic
952207830 3:31198198-31198220 ATACAGTGATAGGTGGGGCATGG - Intergenic
952860800 3:37810813-37810835 GTGCATGCGTAGGTGGGGCCAGG - Intronic
954440594 3:50519787-50519809 GGACATGGATAGGTGGGGCAAGG - Intergenic
955114670 3:55985794-55985816 AAGGATGTATAGGTGGGAAAAGG - Intronic
956548348 3:70432796-70432818 AGGGATGAATAGGTGGAGCACGG - Intergenic
958475727 3:94578837-94578859 AGGGATGAATAGGTGGAGCAAGG + Intergenic
958822330 3:98989510-98989532 ATCCATGTATAGTAGGGGCTTGG + Intergenic
959548016 3:107620760-107620782 ATGGATGTAGAGGTGGGAAAGGG + Intronic
960203382 3:114865526-114865548 ATCCATGTATAGGAGGTGGAAGG - Intronic
960383323 3:116991084-116991106 ATGCATGTATGTGTTGGGCATGG + Intronic
964615567 3:158660536-158660558 AGGCATGTACTGGCGGGGCATGG - Intronic
964864022 3:161234171-161234193 AAACATGTATAGGCTGGGCATGG + Intronic
965545377 3:169910147-169910169 ATGCATGTCTAGGCTGGGCATGG + Intergenic
968039857 3:195579747-195579769 ATGCATAATTAGGTGGGACAGGG - Intronic
968893193 4:3383314-3383336 AAGCATGTTTGGGTGGGGCATGG + Intronic
968914509 4:3491536-3491558 ATGAATGAATAGGTGGGAGAAGG - Intronic
969822233 4:9729584-9729606 CTGGTTGGATAGGTGGGGCATGG + Intergenic
970780244 4:19729272-19729294 ATACAAGTATAGGCCGGGCATGG + Intergenic
970882776 4:20951135-20951157 ATGCATGTATAGGTGGGGCAGGG - Intronic
971198687 4:24492539-24492561 ATGGATGGATAGGTGGGGACTGG + Intergenic
971491707 4:27219136-27219158 ATGCATATATAGGCCTGGCATGG - Intergenic
972827156 4:42772418-42772440 AGGCATATAGAGGTTGGGCATGG + Intergenic
973865921 4:55112818-55112840 ATCCATGTATAGGCCGGGCGCGG - Intronic
974599063 4:64053004-64053026 ATGTATGTATAGGCCGGGCGTGG - Intergenic
977681170 4:99800296-99800318 ATGCATGTATCCATGAGGCAGGG + Intergenic
980992206 4:139747761-139747783 ATGCATATATAGGCTGGGCGTGG + Intronic
981586087 4:146303668-146303690 ATGTATGTATAGGCTGGGCTCGG - Intronic
981610461 4:146588758-146588780 CTGCATGTATAGGTAAGGCTTGG - Intergenic
981830026 4:148988544-148988566 ATACCTGCAGAGGTGGGGCAGGG + Intergenic
983567688 4:169171866-169171888 CTGGATCTAGAGGTGGGGCAGGG + Intronic
984067750 4:175070100-175070122 ATGCAAGCAGAGATGGGGCAAGG + Intergenic
984405508 4:179324651-179324673 ATGCTTGTAAGGCTGGGGCAAGG - Intergenic
985205230 4:187528633-187528655 ATGCATGGACAGGCTGGGCATGG - Intergenic
987136918 5:14908456-14908478 ATTAATGTATGGGTGTGGCAAGG - Intergenic
992190647 5:74288158-74288180 CTCCTTGTAGAGGTGGGGCAGGG - Intergenic
992411937 5:76513713-76513735 AGGGATGAATAGGTGGAGCATGG + Intronic
992450862 5:76874600-76874622 AAGCATTTATACGTGGGGGAGGG - Intronic
993151916 5:84173120-84173142 ATGCATGTCTGTGTGGGGCCTGG + Intronic
997338441 5:133123904-133123926 CTGCATGTATGGGTGGGGACAGG + Intergenic
999324622 5:150636184-150636206 AAATATGTATAGGTGGTGCATGG - Intronic
1000434806 5:161195283-161195305 TAGCATATATAGGTCGGGCATGG - Intergenic
1000440469 5:161257109-161257131 GTGTATGTATAGGTGGGGAGGGG - Intergenic
1000872866 5:166599153-166599175 ATGCATGTATGTCTAGGGCAAGG - Intergenic
1003261296 6:4518602-4518624 AGGCATGGTGAGGTGGGGCAGGG - Intergenic
1003411186 6:5864177-5864199 AAGCATCTACAGGTGTGGCAAGG - Intergenic
1003978976 6:11371412-11371434 AGGGATGAATAGGTGAGGCATGG - Intronic
1004472463 6:15941476-15941498 ATGCCTGGGTAGGTGAGGCAAGG - Intergenic
1006483538 6:34318851-34318873 AAGCATGTACAGGCTGGGCATGG - Intronic
1006578585 6:35063599-35063621 ATGTATGCATAGGAGGTGCAAGG + Intronic
1008053950 6:46927473-46927495 ATGCATGTGTTGGTGGGGGCTGG - Intronic
1008888768 6:56460628-56460650 CTGCATGCATAGAGGGGGCATGG + Intronic
1010466506 6:76173128-76173150 AGGAATGTATAGGTGGAGCATGG + Intergenic
1011951471 6:92971257-92971279 ATGTGTGTATAGGAGAGGCATGG + Intergenic
1012891350 6:104901218-104901240 ATGAAGGTATAGGCTGGGCACGG + Intergenic
1013013339 6:106139522-106139544 ATGCATATATAGGCTGGGCACGG - Intergenic
1013037176 6:106396968-106396990 ATCCATGTATTGGCTGGGCATGG - Intergenic
1014177435 6:118345989-118346011 ATGCATGCATGTGTGTGGCAGGG - Intergenic
1014707039 6:124760352-124760374 AAGCTTGTGTAGGTGGGGCGGGG - Intronic
1017712195 6:157180932-157180954 CAGCATGTGGAGGTGGGGCATGG - Intronic
1019896362 7:3986568-3986590 ATGTATGTGTAGGCCGGGCATGG + Intronic
1020316613 7:6909919-6909941 CTGGTTGGATAGGTGGGGCATGG - Intergenic
1020544749 7:9512955-9512977 AAGCATGAATAAGTGGAGCATGG - Intergenic
1020759121 7:12246168-12246190 ATGCCTGTAAGGGTGGGGCTGGG + Intergenic
1020849548 7:13333819-13333841 GTGTGTGTGTAGGTGGGGCAAGG - Intergenic
1021506207 7:21388373-21388395 AGGAATGAATAGGTGGAGCATGG - Intergenic
1024099055 7:46010518-46010540 ATACATGTAGAGGTCAGGCACGG - Intergenic
1028502688 7:91536409-91536431 ATGCATGTTTAAGTGGGGAGAGG - Intergenic
1029291836 7:99508007-99508029 ATACATGTGTAGGCCGGGCACGG + Intronic
1029331338 7:99858627-99858649 ATGCATGTATAGATGGGCATTGG - Intronic
1029932217 7:104384494-104384516 ATGAATGTATAGGCCGGGCATGG + Intronic
1031918762 7:127586435-127586457 AGGCCTGTCTAGGTGAGGCATGG + Intronic
1033080378 7:138290993-138291015 AAGCATTTTTAGGTTGGGCATGG - Intergenic
1034030896 7:147762710-147762732 ATGGATGTATAAGTGGGGGGAGG + Intronic
1035342344 7:158171639-158171661 ATGAAGGTATAGGCTGGGCATGG - Intronic
1036083074 8:5579683-5579705 ATTCATGTTCAGGTTGGGCACGG + Intergenic
1036477923 8:9110543-9110565 AAGCAAGTATAGGCTGGGCACGG + Intronic
1036634210 8:10537882-10537904 ATTTATGTAGACGTGGGGCATGG + Intronic
1037935197 8:22910807-22910829 AGGCATGAATAGGTGAAGCACGG + Intronic
1037995214 8:23347365-23347387 ATAAATAAATAGGTGGGGCACGG + Intronic
1038289763 8:26238508-26238530 ATATATGTATAGGCTGGGCATGG + Intergenic
1038797450 8:30722433-30722455 ATGCATGTTCAGGCTGGGCACGG + Intronic
1038927026 8:32151954-32151976 AGGCATGTCTAGATGGGGCTAGG - Intronic
1039172752 8:34766876-34766898 ATGCATACATCGGCGGGGCATGG - Intergenic
1040512543 8:48107680-48107702 AAGCCTGTATAGGCTGGGCACGG - Intergenic
1040710417 8:50181458-50181480 CTCCATGAATAGGTGGGGAAGGG + Intronic
1041243418 8:55868937-55868959 ATGAATGTAAAGGTGGGCAAGGG + Intergenic
1042027691 8:64441437-64441459 ATAAATGTATAGGAGAGGCATGG - Intergenic
1043969992 8:86518226-86518248 ATGCATTTAGAGTCGGGGCATGG + Intronic
1045359868 8:101423089-101423111 ATTCATGAATGGGTGGTGCATGG + Intergenic
1046485716 8:114885107-114885129 ATCTATTTATAAGTGGGGCATGG + Intergenic
1047681534 8:127258742-127258764 AGGGATGTATAGGTGGTGGAAGG - Intergenic
1048507043 8:135031138-135031160 ATGCGTGGATGGGTGGGGGAGGG + Intergenic
1049001734 8:139829976-139829998 ATGCATGGGTAGGGGTGGCAAGG + Intronic
1049194956 8:141309979-141310001 ATGCATGTGCCTGTGGGGCACGG + Intergenic
1049359831 8:142207190-142207212 ATGGATGCATAGATGGGGGATGG + Intergenic
1049359964 8:142207692-142207714 ATGGATGAATAGATGGGGGATGG + Intergenic
1049359990 8:142207796-142207818 ATGCATGGATGGATGGGGAATGG + Intergenic
1049656626 8:143801869-143801891 ATGTCGGTATAGGAGGGGCAGGG - Intronic
1051707219 9:19893294-19893316 ATGCATGGATTGATGGGGAATGG - Intergenic
1052852169 9:33385028-33385050 ATTCATGTAAGGGTGGGGCAGGG + Exonic
1053617154 9:39780432-39780454 ATGTCTGTCTAGGTTGGGCATGG + Intergenic
1053680273 9:40481579-40481601 ATTCATGTAAGGGTGGGGCAGGG + Intergenic
1053897304 9:42754833-42754855 ATGTCTGTCTAGGTTGGGCATGG - Intergenic
1053930264 9:43109889-43109911 ATTCATGTAAGGGTGGGGCAGGG + Intergenic
1054267014 9:62927005-62927027 ATGTCTGTCTAGGTTGGGCATGG - Intergenic
1054283439 9:63143356-63143378 ATTCATGTAAGGGTGGGGCAGGG - Intergenic
1054293353 9:63317089-63317111 ATTCATGTAAGGGTGGGGCAGGG + Intergenic
1054391380 9:64621582-64621604 ATTCATGTAAGGGTGGGGCAGGG + Intergenic
1054504348 9:65894745-65894767 ATTCATGTAAGGGTGGGGCAGGG - Exonic
1054550505 9:66596456-66596478 ATGTCTGTCTAGGTTGGGCATGG - Intergenic
1054849771 9:69835836-69835858 TTGTATGTTTATGTGGGGCAAGG - Intronic
1055420306 9:76133615-76133637 ATGCATATATATGTGGGATATGG - Intronic
1055986006 9:82056865-82056887 GTGCATGTGTAGGTGGGGGGTGG - Intergenic
1056024147 9:82475210-82475232 ATCCATGTATAGGCTGGGCATGG + Intergenic
1056585330 9:87924266-87924288 GTGCATGTGTAGGTGGGGGGCGG + Intergenic
1056611551 9:88128674-88128696 GTGCATGTGTAGGTGGGGGGCGG - Intergenic
1057579308 9:96272076-96272098 ATACATATATAGGTCAGGCACGG + Intronic
1057630803 9:96717582-96717604 ATGCTTATGTAGGTGGGGCACGG - Intergenic
1057793661 9:98140732-98140754 ATGCATGCATAGGCCAGGCACGG - Intronic
1061745266 9:132734737-132734759 ATACATAAATAGGTTGGGCACGG + Intronic
1062099186 9:134719259-134719281 ATGCATGTGTATGTGTGACATGG - Intronic
1062217119 9:135395196-135395218 ATGCATGGATGGGTGGTGGATGG + Intergenic
1185531980 X:829219-829241 ATGAATGAATGGGTCGGGCATGG - Intergenic
1185573116 X:1149708-1149730 ATGGATGCATAGGCCGGGCACGG + Intergenic
1185593244 X:1292259-1292281 GTCCAGGTAGAGGTGGGGCAGGG - Intronic
1185593566 X:1294083-1294105 GTCCAGGTAGAGGTGGGGCAGGG - Intronic
1185789035 X:2914528-2914550 CTGCATTTTCAGGTGGGGCAAGG - Intronic
1186484108 X:9919719-9919741 AGGCATGCATAGGTAGGGCAGGG + Intronic
1186760078 X:12713952-12713974 ATGCATACATATGTGGGGCCAGG - Intronic
1187009954 X:15268706-15268728 CTGTATATATAGGCGGGGCACGG - Intronic
1187068727 X:15866641-15866663 ATGTATATACAGGTCGGGCATGG + Intergenic
1187213462 X:17252527-17252549 ATGCGTATATAGGTGTGGCTGGG - Intergenic
1187701906 X:21970904-21970926 ATACATGCATAGGCCGGGCATGG + Intronic
1189488413 X:41450559-41450581 ATGCAAATCTTGGTGGGGCACGG - Intronic
1190312631 X:49127860-49127882 ATGTATTTAAAGGTGAGGCACGG + Intergenic
1190365072 X:49685076-49685098 AGGGATGAATAGGTGGAGCATGG - Intergenic
1191866276 X:65706395-65706417 AGGCAAGTATAAGTGGGGCAGGG - Intronic
1192086229 X:68100236-68100258 ATGTATGTATAGGGTGGGAAAGG - Intronic
1193640217 X:84003226-84003248 GTGCAAGTATAGGTGGAGGAGGG - Intergenic
1194693706 X:97018889-97018911 AGGCATGAATAGGTAGGGCACGG - Intronic
1196075386 X:111569848-111569870 ATGTCTGTATAGGAAGGGCATGG + Intergenic
1198608997 X:138376261-138376283 ATACATTTATTGGTTGGGCATGG + Intergenic
1200178457 X:154135178-154135200 ATGCTTGTATAGGCTGGGCGAGG + Intergenic