ID: 970886368

View in Genome Browser
Species Human (GRCh38)
Location 4:20991788-20991810
Sequence TTGTAGCCATGGCTGGGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 340}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970886368 Original CRISPR TTGTAGCCATGGCTGGGGCT TGG Intronic
900622070 1:3592109-3592131 TTGTTGGGCTGGCTGGGGCTGGG - Intronic
900628110 1:3618756-3618778 ATGGAGCCAGGGCTGGGGCTTGG - Intergenic
900963231 1:5939374-5939396 TTGGAGCCATGGCCTGGGTTGGG + Intronic
901403920 1:9033400-9033422 TTGTAGACATGGTGGGGGGTGGG + Intergenic
901444748 1:9301318-9301340 TTGTAGAGATGGCGGGGGCGGGG - Intronic
901872695 1:12147365-12147387 TTGTAGCTATGGGTAGGGTTAGG + Intergenic
902085789 1:13860999-13861021 TTGTCGCCCAGGCTGGAGCTCGG + Intergenic
902547322 1:17198277-17198299 TTGTAGTCCAGGCTGGAGCTCGG - Intergenic
902798656 1:18815880-18815902 TGGGAGCCAGGGCTGGGGGTGGG - Intergenic
902836675 1:19051876-19051898 TTGGAGCCATGGCTGATTCTAGG - Intergenic
902886442 1:19408139-19408161 TGGGAGCCAAGGCTGGGACTTGG + Intronic
903244045 1:22002915-22002937 TTGAAGGCATGGCTTGGACTGGG + Intronic
905694293 1:39963377-39963399 TTGTAGCCACAGCTGGAGCCTGG - Intronic
906117554 1:43366593-43366615 TTTGGGCCAGGGCTGGGGCTGGG - Intronic
906325700 1:44843926-44843948 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
906950036 1:50326986-50327008 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
907039948 1:51250603-51250625 TTGTAGCCACAGCTGGAGCCTGG + Intronic
907315397 1:53567705-53567727 TTTTAGCCACAGCTGGGGCTAGG - Intronic
909114875 1:71520767-71520789 TCATAGGCATGGCTGGGGCAGGG + Intronic
912712884 1:111962072-111962094 TCTTAGCCATCACTGGGGCTTGG - Intronic
912793301 1:112674527-112674549 GGGTAGCCCTGGCTGAGGCTCGG + Exonic
913069443 1:115285773-115285795 TTGCAGCACTGGCTGGGGGTGGG + Intergenic
913533395 1:119749021-119749043 CTGGAGCCAAGGCTGGGGGTAGG + Intronic
915316787 1:155033296-155033318 TTGCTGCCATGTTTGGGGCTGGG - Intronic
915585682 1:156842614-156842636 TTATAGTCATGGTTGGGGTTAGG - Intronic
916102801 1:161407060-161407082 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
916560560 1:165931127-165931149 GTGGATCCATGGCTGGGGCTGGG + Intergenic
918931919 1:190865076-190865098 TTGTGGCCTTGGCTCGGGCCTGG + Intergenic
919548214 1:198949778-198949800 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
919810580 1:201406688-201406710 TTGTAGCCAAGAATGGGGCCTGG - Exonic
920163764 1:204020352-204020374 TTGAAGGCTTGACTGGGGCTGGG - Intergenic
920297997 1:204971093-204971115 TTTGAGTGATGGCTGGGGCTGGG + Intronic
920455726 1:206099699-206099721 TGGTGGCCAGGGCTGGGCCTGGG - Exonic
922930082 1:229382128-229382150 TTGTACCCATCCCTGGGGGTGGG - Intergenic
923537346 1:234863356-234863378 CTGCAGCCCAGGCTGGGGCTGGG - Intergenic
1064730679 10:18327722-18327744 TTGAAAACATGACTGGGGCTGGG - Intronic
1065968628 10:30788320-30788342 TTGCAGCTCTGGCTGGGCCTAGG + Intergenic
1068160216 10:53253563-53253585 CTTTAGCCATGGCTGGTGTTAGG - Intergenic
1068548910 10:58384999-58385021 TTCAAGCCAGGGCTGGAGCTCGG - Intergenic
1069805010 10:71116736-71116758 TTTGAGCTATGGCTGGAGCTGGG - Intergenic
1070056770 10:72942710-72942732 TTGTAGCCAGGTCTGGGCATTGG + Exonic
1070544228 10:77440008-77440030 TTGGGGCCAGGGCGGGGGCTGGG + Intronic
1071142578 10:82527935-82527957 TTGTAGTGAGGGCTGGGGGTGGG + Intronic
1071514393 10:86287583-86287605 TTGTGGTCAGGGCTGGGGCTAGG - Intronic
1073147322 10:101289410-101289432 TGCTAGCCATGGCTGAGGCAAGG - Intergenic
1073528283 10:104206792-104206814 CTGTGGCCATGGTTGGGCCTGGG - Intronic
1073807244 10:107110725-107110747 TTTAAGCCATGGCTGGGGTCAGG + Intronic
1074922089 10:118024915-118024937 CTGCAGAGATGGCTGGGGCTAGG - Intronic
1074943900 10:118262300-118262322 GAGTAGCCATGTCTGGGTCTGGG - Intergenic
1076056641 10:127379642-127379664 TTGTAGCTCTTGCTGAGGCTGGG + Intronic
1076232729 10:128835176-128835198 GTGTATCCAAGACTGGGGCTTGG + Intergenic
1076395831 10:130136748-130136770 TCGGAGCCAGGGCTGGGGCCGGG - Intronic
1076658782 10:132041560-132041582 TGGGAGACTTGGCTGGGGCTGGG + Intergenic
1077323979 11:1955659-1955681 CTGTGGCCTGGGCTGGGGCTTGG + Intronic
1077488624 11:2850402-2850424 TTAAAGCCATGGCGGAGGCTGGG + Intergenic
1078758111 11:14230577-14230599 TTGAAGCCAAGGCAGCGGCTGGG - Intronic
1081989842 11:47331965-47331987 TTGCAGCCAGGGCAGGTGCTTGG + Intronic
1083348617 11:62011756-62011778 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1083625798 11:64071443-64071465 GTATGGCCAGGGCTGGGGCTGGG + Intronic
1084572915 11:69970300-69970322 TTGAGGCCAAGGCTGGGGCTGGG - Intergenic
1084608832 11:70187966-70187988 TGGTAGGCATGGCTGGGGGCTGG - Exonic
1084884713 11:72196092-72196114 CTGCAGCCATGAGTGGGGCTGGG + Exonic
1085215546 11:74827276-74827298 TTTTAGCCACGGCTGGGGTGTGG + Intronic
1085981743 11:81733869-81733891 ATGTAGCCACTGCTGGGGGTTGG + Intergenic
1086643338 11:89187198-89187220 TTGAGGCCTTGGCTGGGGGTAGG - Intronic
1086954836 11:92925332-92925354 TTTTAGCCATAACTGGAGCTAGG - Intergenic
1088711094 11:112509480-112509502 TGGCTGCCATGGCTGGGGCCTGG + Intergenic
1089524130 11:119085570-119085592 TTGGAGCGTTGGCTGTGGCTGGG - Intronic
1089698663 11:120231042-120231064 CTGGAGCAATGGCTGGGGCTTGG - Intergenic
1202806965 11_KI270721v1_random:10854-10876 CTGTGGCCTGGGCTGGGGCTTGG + Intergenic
1091455275 12:602309-602331 TAGTTGCCTAGGCTGGGGCTGGG - Intronic
1093493112 12:19726546-19726568 CTGCAGCCATGCCTGGGGCGGGG + Intergenic
1094053251 12:26243309-26243331 TTGGAGCAATGACTGTGGCTTGG - Intronic
1095975998 12:47941655-47941677 GTGAAGCAGTGGCTGGGGCTGGG + Intronic
1096244184 12:49975220-49975242 CTGCAGCCGTGGCTGGGGCCTGG - Intronic
1096664542 12:53154506-53154528 ATAGAGCCCTGGCTGGGGCTGGG - Intergenic
1097058708 12:56266872-56266894 CTGTTGCCATGGCTCGGGCCTGG - Exonic
1097843731 12:64345377-64345399 ATGTTGCCATTACTGGGGCTAGG + Intronic
1098614636 12:72507910-72507932 TTTTAGCCACTGCTGGAGCTAGG - Intronic
1099533662 12:83819046-83819068 TTAGAGGCTTGGCTGGGGCTGGG + Intergenic
1101766047 12:107700352-107700374 TGGTTGCCAGGGCTGGGGGTGGG - Intronic
1102219927 12:111187556-111187578 TTGGAGACCTGGCTGGGGATTGG + Intronic
1102770634 12:115473070-115473092 TTGTGGGCATGGGTGGGGTTAGG - Intergenic
1104717932 12:131028957-131028979 ATCCAGCCATGGGTGGGGCTCGG + Intronic
1106169304 13:27275305-27275327 TTGTAGGCATGGCAGGGACTAGG - Intergenic
1106187930 13:27425120-27425142 TGATATCCATGGCAGGGGCTCGG + Intronic
1108512581 13:51169665-51169687 TTTTAGCCATGGCTGGAGCTGGG - Intergenic
1108770950 13:53699947-53699969 TTTTAGCCATGGCTGGAGCTGGG - Intergenic
1109297542 13:60552861-60552883 TTTTAGCCATGGCTGGAGCTGGG + Intronic
1109406336 13:61904776-61904798 TTATAGCCATGGCAAGGCCTGGG - Intergenic
1110626437 13:77660445-77660467 TCGTAGACATGGCTGCGGCTGGG + Intergenic
1110626462 13:77660565-77660587 TCGTAGACATGGCTGCGGCTGGG + Intergenic
1110626486 13:77660685-77660707 TCGTAGACATGGCTGCGGCTGGG + Intergenic
1112790307 13:102995510-102995532 TTTTAGCCACGGCTGGAGCTGGG + Intergenic
1113467811 13:110524509-110524531 CTCCAGCCATGGCTGGGGCCAGG - Intronic
1113549016 13:111177234-111177256 TTGTGGCCGGGGCTGAGGCTGGG + Intronic
1114333059 14:21657625-21657647 TTGTTGCCCAGGCTGGAGCTCGG + Intergenic
1114777321 14:25498641-25498663 GAGTAGCCAGGGCAGGGGCTGGG + Intergenic
1115289277 14:31751984-31752006 TTTTAGCCATGGCTGGAGCCTGG + Intronic
1115480832 14:33859605-33859627 TTGTAGCCATGGTTCTGTCTTGG - Intergenic
1115563793 14:34607071-34607093 TTAAAACCATGGTTGGGGCTGGG - Intronic
1116146809 14:41083690-41083712 TTCTGGCCATGCCAGGGGCTCGG + Intergenic
1116296679 14:43119808-43119830 TTTTAGCCATGGCTGGGGAGTGG + Intergenic
1116696379 14:48183230-48183252 TTTTAGCCATAGCTGGAGCTGGG - Intergenic
1119403082 14:74377728-74377750 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1121310197 14:92931660-92931682 TTGTAGCCAAGGCTCGGGTGGGG - Exonic
1122588955 14:102831650-102831672 CGGGACCCATGGCTGGGGCTGGG - Intronic
1122696201 14:103553832-103553854 TTGAAGAAATGGCTGGTGCTTGG - Intergenic
1123506240 15:20942757-20942779 CTGTGGCCATGGCAGGGGCAGGG + Intergenic
1124209645 15:27752683-27752705 TGGTAGCCAGGGCCGGGGGTGGG - Intergenic
1124438233 15:29668622-29668644 TTGAAAACATTGCTGGGGCTCGG + Intergenic
1124799402 15:32815673-32815695 TTGTAGCTATGGCTGGTGAAGGG - Intronic
1125803645 15:42473340-42473362 TTGTAGCCATGGCAAAGACTAGG - Intronic
1125921586 15:43528586-43528608 TTTCAGCCTTGGCTGGGGCAGGG - Exonic
1125933717 15:43617544-43617566 GTGTGGCCAGGGCTGGGACTGGG - Intronic
1125946815 15:43717006-43717028 GTGTGGCCAGGGCTGGGACTGGG - Intergenic
1126972617 15:54134220-54134242 TAGTTGCCAGGGCTGGGGGTGGG - Intronic
1127832072 15:62759753-62759775 ATGTAGCCACTGGTGGGGCTGGG + Intronic
1128727748 15:70000417-70000439 TGGGAGGCCTGGCTGGGGCTGGG - Intergenic
1129843618 15:78758349-78758371 TTGGATCCAGGGCTGGGCCTGGG + Intergenic
1130059480 15:80559334-80559356 CTGTGGCCGGGGCTGGGGCTGGG - Intronic
1130859639 15:87874981-87875003 TTGTAGCCATGGTTGGGATTTGG - Intronic
1131721022 15:95169261-95169283 TTGTTCCCATTTCTGGGGCTGGG + Intergenic
1132133938 15:99313890-99313912 TTGTAGACTGGGCTGGGGGTAGG + Intronic
1202971824 15_KI270727v1_random:243598-243620 CTGTGGCCATGGCAGGGGCAGGG + Intergenic
1132922081 16:2401418-2401440 TTGAAGGCTTGACTGGGGCTGGG - Intergenic
1135155616 16:20050391-20050413 TTGCAGGGATGGGTGGGGCTAGG + Intronic
1136140081 16:28282726-28282748 TTGGAGCCATGTGAGGGGCTTGG - Intergenic
1136591214 16:31218927-31218949 GAGTAGCACTGGCTGGGGCTGGG + Intronic
1137424463 16:48365914-48365936 TTGGAGCCTCGGCCGGGGCTGGG + Intronic
1138490289 16:57372556-57372578 TCGGAGCCATGGCTGAGGGTGGG - Exonic
1139503963 16:67389897-67389919 GGTTAGCCATGCCTGGGGCTGGG + Exonic
1140262765 16:73395059-73395081 CAGTGGCCATGCCTGGGGCTAGG + Intergenic
1141061814 16:80880257-80880279 TTGTAGAGATGGTGGGGGCTGGG + Intergenic
1141502707 16:84454840-84454862 TCGTGGCCATGACTGGGGATGGG + Exonic
1142542757 17:673469-673491 TTGTTGGCATTGCTGAGGCTGGG - Intronic
1143322243 17:6075757-6075779 TTCTATCCCTGCCTGGGGCTTGG - Intronic
1143542580 17:7578502-7578524 ATTGAGCCCTGGCTGGGGCTGGG - Exonic
1145734271 17:27215700-27215722 TTGTAGCCAGGCATCGGGCTAGG - Intergenic
1145984015 17:29032182-29032204 TTGCAGGCATGGGTGGGGGTGGG + Intronic
1146852407 17:36234015-36234037 TTGTAGCCCAGGCTGGGTGTAGG - Intronic
1146868317 17:36357887-36357909 TTGTAGCCCAGGCTGGGTGTAGG - Intronic
1146899567 17:36574464-36574486 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1147071190 17:37958508-37958530 TTGTAGCCCAGGCTGGGTGTAGG - Intergenic
1147082716 17:38038034-38038056 TTGTAGCCCAGGCTGGGTGTAGG - Intronic
1147098660 17:38162003-38162025 TTGTAGCCCAGGCTGGGTGTAGG - Intergenic
1147155965 17:38544643-38544665 TTCTTGCCAAGGCTGGGGATTGG + Intronic
1147715782 17:42507315-42507337 TTGTAGGTTGGGCTGGGGCTGGG + Intronic
1148377168 17:47159196-47159218 TTGTAGCCACAGCTGGAGCCCGG + Intronic
1149166236 17:53756994-53757016 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1149200728 17:54183108-54183130 TGGTACCTAGGGCTGGGGCTGGG - Intergenic
1149563455 17:57625852-57625874 TTGTCCCCTTGGCTAGGGCTGGG - Intronic
1151647352 17:75442298-75442320 TGGAAGGCTTGGCTGGGGCTAGG - Intronic
1151698956 17:75732330-75732352 TTGTACACCTGGCTGGGGGTGGG + Intronic
1155184257 18:23373388-23373410 TTGCCTCCATGGCTGAGGCTGGG + Intronic
1156506581 18:37599642-37599664 TTGGAGCCCTGGCTGGGGCGGGG + Intergenic
1157204571 18:45687545-45687567 GTGGGGCCAGGGCTGGGGCTGGG + Intergenic
1158508359 18:58067467-58067489 TTAAAGCAATGGTTGGGGCTGGG + Intronic
1159601345 18:70431098-70431120 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1160849658 19:1184199-1184221 ATGATGCCAGGGCTGGGGCTGGG - Intronic
1161502150 19:4622226-4622248 AGGAAGCCAAGGCTGGGGCTGGG + Intergenic
1162322139 19:9976799-9976821 TTGTGGCCAGGGCTGGGCTTAGG - Intronic
1162366059 19:10250436-10250458 TTGTAGAGATGGCGGGGGGTGGG - Intergenic
1162674093 19:12285158-12285180 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1163296061 19:16413549-16413571 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1163677624 19:18663191-18663213 TCGCAGGCAGGGCTGGGGCTTGG + Intronic
1164672085 19:30077991-30078013 TAGGAGCCCAGGCTGGGGCTGGG - Intergenic
1164697900 19:30260704-30260726 TGGTGGCCATGGCTGGTGCCTGG - Intronic
1164830588 19:31317209-31317231 CTGTGGCTCTGGCTGGGGCTGGG - Intronic
1165422628 19:35729919-35729941 GAGAAGCCAGGGCTGGGGCTGGG - Intronic
1165804440 19:38572093-38572115 TGGCAGCTCTGGCTGGGGCTTGG + Exonic
1165804498 19:38572333-38572355 CTGGAGCACTGGCTGGGGCTGGG + Intronic
1165920718 19:39296414-39296436 ATTTAGCCATGGCTGCAGCTTGG + Exonic
1166348039 19:42179081-42179103 TGGTAGACAAGGCTGGGGATGGG + Intronic
1166357573 19:42236217-42236239 TTAGAGCCTTGGCTGGGGGTAGG - Intronic
1167849539 19:52190888-52190910 GTGTCGCCCAGGCTGGGGCTGGG + Intronic
1168156173 19:54473955-54473977 TTTTACCCCTAGCTGGGGCTGGG + Intergenic
1168316921 19:55488565-55488587 TTGCAGCCAGGGCAGGGGATGGG - Exonic
1168720455 19:58551849-58551871 TTGGAGCTGTGGCTGGGCCTTGG + Intronic
925799213 2:7581286-7581308 TGGTAGGCATGGCTGGGGGCAGG - Intergenic
925959712 2:9003605-9003627 TGGTGGCCATGGCCGGGCCTCGG + Exonic
926249869 2:11148615-11148637 TTGTGGCACTGGCTGGGGGTGGG - Intergenic
927616057 2:24597492-24597514 TTGTGGCAGGGGCTGGGGCTGGG + Intronic
927844624 2:26465018-26465040 TTGTAGCCATGTCTGTGGGAGGG + Exonic
929044930 2:37780062-37780084 TTGAAACAATGCCTGGGGCTAGG - Intergenic
929225710 2:39510137-39510159 CTGAACCCAAGGCTGGGGCTGGG + Intergenic
929548856 2:42876197-42876219 TGGGAGCCAAGGATGGGGCTGGG - Intergenic
929946757 2:46377772-46377794 TGGAAGGCATGCCTGGGGCTAGG - Intronic
931721502 2:65070511-65070533 TTGTAGCCTTGGCTGCTGCAGGG + Intronic
932321761 2:70827532-70827554 TTGTTGCCCTGGTTGGGGCTGGG - Intergenic
934571853 2:95377534-95377556 CTGTCCCCATGGCAGGGGCTAGG - Intronic
935208954 2:100922118-100922140 CTGTGGCTATGGCTGGGGGTGGG + Intronic
935588152 2:104820517-104820539 TTGGAGACCTGACTGGGGCTTGG + Intergenic
935712914 2:105914952-105914974 TAGTAGACACTGCTGGGGCTGGG - Intergenic
937124586 2:119465372-119465394 CTGTAGGCATGGCTGGATCTAGG - Intronic
937322025 2:120966655-120966677 TTGCAGCCAAGCTTGGGGCTGGG + Intronic
937883138 2:126883193-126883215 TTGTTGCCATGGCAGGGCCGGGG - Intergenic
938280125 2:130057874-130057896 ATTCAGCCATGGCTGGAGCTGGG + Intergenic
938331082 2:130448589-130448611 ATTCAGCCATGGCTGGAGCTGGG + Intergenic
938358866 2:130672914-130672936 ATTCAGCCATGGCTGGAGCTGGG - Intergenic
938435259 2:131279567-131279589 ATTCAGCCATGGCTGGAGCTGGG - Intronic
941319680 2:164039435-164039457 TTTTAGCCATGGCTGGATCCAGG - Intergenic
941869871 2:170372921-170372943 TAGTTGACATGGCTGGAGCTTGG + Intronic
944480349 2:200151643-200151665 TTGTTGCCTTGGCTGGAGATGGG + Intergenic
946168290 2:217878545-217878567 TTGGTGCCATGGCTGGTGCATGG + Intronic
946188293 2:217994124-217994146 TAGGAGCTTTGGCTGGGGCTGGG + Intronic
948275465 2:236704897-236704919 TAGAAGCCAGGGCTGGGGCTGGG - Intergenic
948760788 2:240189826-240189848 TGGTAGGGATGGCTGGGGCCTGG + Intergenic
949052396 2:241904115-241904137 CTGGAGCCATATCTGGGGCTGGG + Intergenic
1168855361 20:1003944-1003966 TTGAAGGCATGGCAGGGGCAGGG + Intergenic
1169777175 20:9268255-9268277 TTGAACCCATGGCTGGGTCTAGG + Intronic
1169822486 20:9727906-9727928 TTGAGTCCATGGCTGGGGCAGGG - Intronic
1170557159 20:17524018-17524040 TTGTAGGCATGGAAGGGGCGGGG + Intronic
1170899364 20:20445606-20445628 TTTTCTCCATGGCTGGGGATGGG + Intronic
1171532651 20:25862546-25862568 CTGTGGCTGTGGCTGGGGCTGGG - Intronic
1173739009 20:45382818-45382840 TTGTTGCCAGGGCTGGGAGTGGG - Intronic
1174237145 20:49103247-49103269 GTGTTCCCATGGCTGGGGTTTGG - Intergenic
1174401384 20:50277891-50277913 TTGTAGGCAGGGCTGTGGCCAGG + Intergenic
1174406933 20:50308885-50308907 TTGTGGGCAAGGCTGGGCCTGGG - Intergenic
1174427750 20:50444806-50444828 CTGTAGCCCAGGCTGGAGCTCGG - Intergenic
1174789246 20:53462511-53462533 CTGAAGCCAGGGCTGGGGCAGGG - Intronic
1175147102 20:56905162-56905184 GTGTAGCCAGGGCTGGGGAAGGG - Intergenic
1175304415 20:57966070-57966092 TTGCAGGCATGGCTGGATCTAGG - Intergenic
1175518993 20:59587746-59587768 CTGGAGCCGGGGCTGGGGCTGGG + Intronic
1176196343 20:63837816-63837838 TTGGGGACATGGCTGGTGCTGGG + Intergenic
1176239553 20:64069609-64069631 CTGTGGCCCTGGCAGGGGCTAGG + Intronic
1177182502 21:17758341-17758363 TTGTTGCTATTGCTGGGGCTTGG + Intergenic
1181037454 22:20176726-20176748 TTGTGACCAGGGATGGGGCTGGG + Intergenic
1181769465 22:25114854-25114876 CAGTATCCGTGGCTGGGGCTGGG + Intronic
1182712615 22:32332106-32332128 CTGCAGCCATGTCTGCGGCTTGG - Intergenic
1183624830 22:38995476-38995498 TGTTGGCCATGGCTGTGGCTGGG - Intergenic
1184363096 22:44030507-44030529 TTGGAACCCTTGCTGGGGCTTGG + Intronic
1184390842 22:44202252-44202274 TTGAAGCCAAGGCTGAGACTGGG + Intronic
1184399856 22:44267488-44267510 CTGCAGCCATGTCTGTGGCTTGG - Intronic
1184596552 22:45517456-45517478 CTGTAGCCTGGGCTGGGGCATGG + Intronic
1184768013 22:46582054-46582076 CTGGGGCCTTGGCTGGGGCTGGG + Intronic
1185388630 22:50547680-50547702 ATGAAGCCAGGGCTGGGGCTAGG - Intergenic
949625667 3:5863950-5863972 TTTTAGGCCTGGCTGGGACTTGG - Intergenic
952897528 3:38087844-38087866 TTGTAGCCAGGGGTGGGTCAGGG + Intronic
953368410 3:42366673-42366695 CAGCAGCCATGGCTTGGGCTGGG + Intergenic
953801917 3:46031147-46031169 CTGAAGCCATGGCTGTGACTTGG + Intergenic
953881376 3:46693115-46693137 TTGTAGCCATGGTGGGGCCGAGG - Intronic
954301336 3:49702232-49702254 TGGTTCCCATGGCAGGGGCTGGG + Intronic
954816580 3:53286849-53286871 TTGAAGGAAAGGCTGGGGCTGGG - Exonic
961590708 3:127978672-127978694 TGGTAGCAATAGCAGGGGCTGGG + Intronic
961831699 3:129626479-129626501 TAGTTGCCAGGGCTAGGGCTGGG + Intergenic
962242782 3:133765375-133765397 TTCTAGCCAGGGCTGGGTCCAGG + Intronic
964612165 3:158626767-158626789 TTGGAGCCATGGCTGAGGCCTGG + Intergenic
966631093 3:182075874-182075896 TTGTCGTGATGGCTGGGCCTTGG - Intergenic
968459780 4:718774-718796 TTGTGGCCACGGTAGGGGCTGGG + Intronic
968726739 4:2251355-2251377 CTGTAGCCTTGGCTAGGTCTTGG - Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969712513 4:8852080-8852102 TTGGAGCCAGAGCCGGGGCTTGG - Intronic
969865164 4:10071156-10071178 ATGGAGTCATGGCTGGGCCTGGG + Intergenic
970631007 4:17944626-17944648 TTGTTTGCATGGCTGGGGCTAGG - Intronic
970886368 4:20991788-20991810 TTGTAGCCATGGCTGGGGCTTGG + Intronic
971166596 4:24190173-24190195 TTGTATCCATGGGTGGAGTTGGG - Intergenic
971369256 4:26002642-26002664 TTTTGGCCAAGTCTGGGGCTAGG - Intergenic
971451453 4:26805360-26805382 TGGTACCCATGGCAGGGGCTGGG - Intergenic
972879850 4:43410046-43410068 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
976680787 4:87753660-87753682 TTTTAGCCATGGCTGGGACGTGG + Intergenic
977744880 4:100535067-100535089 TTGTTGCCTTGGCTGGGGAAGGG - Intronic
977988744 4:103416273-103416295 GGGTACCCATGGCTGGGGGTTGG + Intergenic
979106318 4:116692942-116692964 TTGTAGCCACTGCTGAGGCATGG + Intergenic
981018738 4:140003270-140003292 TTGTAAACATGGTTGGGTCTGGG + Intronic
982526858 4:156489813-156489835 ATGTAGCCATTACTGGGGATGGG - Intergenic
983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
983736671 4:171070471-171070493 TTTTAGCTACAGCTGGGGCTGGG + Intergenic
983979589 4:173977822-173977844 CTGAAGGCTTGGCTGGGGCTGGG - Intergenic
985792361 5:1936812-1936834 TGGTACCCATGGCATGGGCTAGG + Intergenic
986016858 5:3765028-3765050 TTGTAGCCAAGGCTGGGAGTGGG - Intergenic
986582313 5:9278698-9278720 CTTTAGCCATAGCTGGAGCTGGG - Intronic
987675025 5:21063399-21063421 TTTTAGCCATAGCCGGAGCTGGG - Intergenic
988516797 5:31912053-31912075 GTAGAGCCAAGGCTGGGGCTGGG - Intronic
989434657 5:41397297-41397319 TTGTAACCATGGCTAGAGCTGGG - Intronic
991551416 5:67840930-67840952 TTGAAGAAATGGCTGGGGCAGGG - Intergenic
992257158 5:74932656-74932678 TTGAAGGCTTGGCTGGGACTAGG + Intergenic
992520592 5:77546239-77546261 TTGTAGCCACAGCTGGAGCCTGG - Intronic
993599441 5:89902612-89902634 CTGTAGCCCAGGCTGGAGCTAGG + Intergenic
994073761 5:95629007-95629029 TTTTAGCCATGACTAGAGCTGGG + Intergenic
995591615 5:113705792-113705814 TGTGAGCCATGGCTGGGGCTGGG + Intergenic
995732846 5:115264653-115264675 TTGTAGCCACCGCTGGAGCCTGG + Intergenic
995978216 5:118068752-118068774 TTGGGGCCATGCCTGAGGCTTGG + Intergenic
996677247 5:126190672-126190694 TTGTAACAATGGCTGAGTCTTGG - Intergenic
996858992 5:128043472-128043494 TTATAGTCATTACTGGGGCTTGG + Intergenic
997459341 5:134041689-134041711 TTGGAGCCATGCCTGGGACTTGG + Intergenic
999817602 5:155193041-155193063 TTGTAACCAGGGCTGAGACTAGG - Intergenic
1000667520 5:164016760-164016782 TGGTAGACAGGGCAGGGGCTAGG + Intergenic
1001118831 5:168962129-168962151 CTGTACCCATGGGTGGGGGTGGG + Intronic
1002329207 5:178429892-178429914 TTCTAGCCATGCCTGGGGAGTGG - Intronic
1002373662 5:178773723-178773745 TTGTGGCCTGGGCTGGGCCTGGG + Intergenic
1002444357 5:179280026-179280048 TTGGAGCTATGGCTGGAGCTGGG + Intronic
1002931316 6:1637055-1637077 CTGGAGCCATGCCTGGCGCTGGG - Intronic
1003070043 6:2938679-2938701 AAGTGGCCATGGCTGGCGCTGGG + Intergenic
1005212132 6:23478639-23478661 TTGAAGCCAGGACTGGGGCAGGG + Intergenic
1006782704 6:36643042-36643064 TGGAATCCCTGGCTGGGGCTAGG + Intergenic
1007269444 6:40624899-40624921 TGGTCCCCAGGGCTGGGGCTGGG + Intergenic
1007650467 6:43417267-43417289 GTGTAGCTAGAGCTGGGGCTGGG - Intergenic
1007669327 6:43538827-43538849 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
1009769163 6:68122173-68122195 TTTTAGCCATGGCTGGGATGAGG + Intergenic
1010678069 6:78767717-78767739 CTTTAGCCATGGCGGGAGCTGGG - Intergenic
1011242109 6:85283437-85283459 TTGTTGCCATGGATTGGGATGGG - Intergenic
1012252401 6:96993320-96993342 TTGTTGACATGGCTGGTGATTGG + Intronic
1014365555 6:120536876-120536898 TTGTACTCATGGCTGTGGATTGG + Intergenic
1014725492 6:124966936-124966958 TTATTGCCATGACTGTGGCTAGG + Intronic
1015865347 6:137721671-137721693 TTGGAGTCATTGTTGGGGCTCGG + Intergenic
1016126291 6:140408337-140408359 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016785868 6:148010506-148010528 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1018003619 6:159600968-159600990 TTATGGCCATGGGTGGGGCTGGG - Intergenic
1018372899 6:163185116-163185138 TTGTAGCCAGGGATGGGGAAAGG + Intronic
1018433646 6:163742735-163742757 TTGTCTCCATTGCTGGGGATTGG + Intergenic
1018582622 6:165320317-165320339 TGGTTCCCAGGGCTGGGGCTGGG - Intergenic
1019372802 7:671821-671843 TTCCAGGCATGGCTGGGGCAGGG - Intronic
1019709465 7:2511681-2511703 CTGAAGACAAGGCTGGGGCTGGG - Intergenic
1022447602 7:30482721-30482743 TTGTAGAAGTGGCTGGGGTTTGG - Intergenic
1022467775 7:30662904-30662926 TTGTTGCCCTGCCTGGGGATGGG - Intronic
1024191811 7:47019778-47019800 CTGTGGCCAGGGCTGGGGCTGGG - Intergenic
1024229152 7:47350756-47350778 ATGCAGCAAAGGCTGGGGCTTGG + Intronic
1025284704 7:57652088-57652110 TTGGTGCTGTGGCTGGGGCTGGG - Intergenic
1028216236 7:88137026-88137048 TGGTTACCTTGGCTGGGGCTGGG - Intronic
1029713803 7:102314730-102314752 GGGTGGCCATGGCTGGGGGTGGG - Intronic
1031033465 7:116760854-116760876 TTGTGGCCATGTGTGGGGATTGG - Intronic
1031315864 7:120257013-120257035 TTTTAGCTATGGCTGGAGCTGGG - Intergenic
1031665876 7:124481368-124481390 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1031882713 7:127215308-127215330 TTCTGGCCTTGGCTGGGGGTGGG - Intronic
1034257023 7:149730248-149730270 CTGGAGCCGGGGCTGGGGCTGGG - Exonic
1039778998 8:40765157-40765179 TTGAAGCCATTGCTGGGTCCGGG - Intronic
1042247206 8:66720059-66720081 TGTTAGCCAGGGCTGGGGCATGG - Intronic
1042878261 8:73459928-73459950 GTGTATTCACGGCTGGGGCTGGG - Intronic
1043075821 8:75698229-75698251 CTGGAGACTTGGCTGGGGCTGGG + Intergenic
1043949499 8:86292003-86292025 TAGTGGCCATGGCTGTGGATAGG - Intronic
1044971409 8:97624208-97624230 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1048720186 8:137314790-137314812 TTGGAGTCAGGGCAGGGGCTAGG - Intergenic
1049541772 8:143211908-143211930 TTGCAGCCTTGGCTGGGGAAGGG + Intergenic
1049572273 8:143374872-143374894 CTTTCGCCATGGCTGGTGCTGGG + Intronic
1050987547 9:12102232-12102254 TTTTAGACAGGGCTGGAGCTGGG + Intergenic
1051335462 9:16062140-16062162 TTGTATCACAGGCTGGGGCTGGG + Intergenic
1052128798 9:24814700-24814722 TTATTGCAATGGCTGGGGATGGG + Intergenic
1052285935 9:26785877-26785899 TGGGAGCCATGGCTGGAGCAGGG - Intergenic
1052997227 9:34557681-34557703 TTGGAGCCATGCCTGGGGAGAGG + Exonic
1054968496 9:71057295-71057317 TTGTAGCCCTAGCTTGGGCTTGG + Intronic
1055215831 9:73860967-73860989 CTGTAGCCAAGTCTGAGGCTAGG - Intergenic
1055993294 9:82130861-82130883 TTGTGGCCATGGTCAGGGCTGGG + Intergenic
1055993433 9:82131605-82131627 TTGTAGCCATAGCTGGAGCCTGG - Intergenic
1058610970 9:106774977-106774999 GTGTAGCCTTGGCTGAGACTGGG + Intergenic
1059039651 9:110798510-110798532 TTAAAGACATGGCTTGGGCTAGG + Intronic
1059341821 9:113601559-113601581 GTGGAGGCATGGCTGGGGGTGGG + Intergenic
1061003632 9:127916452-127916474 CTGTCTCCAGGGCTGGGGCTGGG + Exonic
1061949229 9:133926908-133926930 TTGTGGCCAGGGCTGGTGCTGGG - Intronic
1061963591 9:134000393-134000415 TGGTTGCCATGGCTGAGGATGGG - Intergenic
1062234305 9:135500698-135500720 ATGTCGCCATGGCTGGGACGCGG - Exonic
1062315974 9:135967134-135967156 CTGTAGCTGTGGTTGGGGCTGGG - Intergenic
1062385512 9:136309471-136309493 TGGCACCCAGGGCTGGGGCTGGG - Intergenic
1186331392 X:8538137-8538159 TGGTGGCCTTGGCTTGGGCTTGG - Intronic
1187484506 X:19689569-19689591 ATGTAGTCTGGGCTGGGGCTGGG + Intronic
1188106823 X:26156442-26156464 TTTTAGCCATGACTGGAGCAGGG + Intergenic
1189321128 X:40088229-40088251 GTGTAGCCTGGGCTGGGGCTTGG - Intronic
1190339481 X:49285811-49285833 CTGGAGCCATGGCCGGGGCAAGG - Intronic
1190904391 X:54711320-54711342 TTATAGCCATGGCTTGGGAAAGG + Intergenic
1191979382 X:66909237-66909259 TAGTAGCAATGGCTGGAGCTGGG + Intergenic
1191992013 X:67048431-67048453 TTATACCCAGGCCTGGGGCTAGG - Intergenic
1192369903 X:70504570-70504592 TTGAAGCAGTGTCTGGGGCTGGG - Exonic
1192510936 X:71719972-71719994 ATGGAGCCCTGGCTGGGGCAGGG + Intergenic
1192515761 X:71761581-71761603 ATGGAGCCCTGGCTGGGGCAGGG - Intergenic
1192523531 X:71822870-71822892 ATGGAACCATGGCTGGGGCAGGG + Intergenic
1193720764 X:84984496-84984518 TTGTAGAGATGGCAGGGGGTGGG - Intergenic
1194294635 X:92113204-92113226 ATTGAGCCCTGGCTGGGGCTGGG + Intronic
1195411430 X:104570687-104570709 TTGGAACCATGTCTGTGGCTGGG - Intronic
1197117170 X:122847379-122847401 TTGTAGTCTTGGCTGGGAATGGG + Intergenic
1197726884 X:129782311-129782333 CTGTAGGCATGGGTGGGGATAGG + Intronic
1197862857 X:130988562-130988584 TGGTGGCAGTGGCTGGGGCTAGG - Intergenic
1198138557 X:133779833-133779855 TTGTAGCAATGGCTTGGGGGTGG - Intronic
1199076881 X:143535132-143535154 TTGTTCCTATGGCTGGGGGTAGG + Intergenic
1199154148 X:144526151-144526173 TTGTAGCCTTGGGTAGGGGTAGG + Intergenic
1199329570 X:146543088-146543110 TTTGAGCCATGGCTGGAGCTGGG + Intergenic
1199357155 X:146875689-146875711 TTTTAGCCATGGCTTGAGCCTGG - Intergenic
1199617288 X:149667325-149667347 TTGTTGCCATGGAGTGGGCTGGG + Intergenic
1199625355 X:149735924-149735946 TTGTTGCCATGGAGTGGGCTGGG - Intergenic
1200182076 X:154156687-154156709 CTGGAGCTCTGGCTGGGGCTGGG - Intronic
1200219246 X:154382954-154382976 GTGGAGGCAGGGCTGGGGCTGGG + Intergenic
1200612132 Y:5337707-5337729 ATTGAGCCCTGGCTGGGGCTGGG + Intronic
1201911282 Y:19135776-19135798 TTGTAGGCAGAGCTGGGCCTTGG - Intergenic