ID: 970889497

View in Genome Browser
Species Human (GRCh38)
Location 4:21026847-21026869
Sequence CACACTCACGTGACTATGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970889497_970889503 25 Left 970889497 4:21026847-21026869 CCAGTCATAGTCACGTGAGTGTG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 970889503 4:21026895-21026917 TTGCATGAGGCAGGAGACCTAGG 0: 1
1: 0
2: 2
3: 29
4: 246
970889497_970889500 12 Left 970889497 4:21026847-21026869 CCAGTCATAGTCACGTGAGTGTG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 970889500 4:21026882-21026904 AACACAACCAGTCTTGCATGAGG No data
970889497_970889501 16 Left 970889497 4:21026847-21026869 CCAGTCATAGTCACGTGAGTGTG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 970889501 4:21026886-21026908 CAACCAGTCTTGCATGAGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970889497 Original CRISPR CACACTCACGTGACTATGAC TGG (reversed) Intronic
904738134 1:32650965-32650987 CTCTCTCACGTGACCCTGACCGG + Intergenic
911100136 1:94088965-94088987 CACACTCAAGTGAGGAAGACAGG - Intronic
913566492 1:120077970-120077992 CAGGCGCACGTGACTATGCCTGG + Intergenic
913631639 1:120715574-120715596 CAGGCGCACGTGACTATGCCTGG - Intergenic
914287250 1:146238682-146238704 CAGGCGCACGTGACTATGCCTGG + Intergenic
914548282 1:148689424-148689446 CAGGCGCACGTGACTATGCCTGG + Intergenic
917927250 1:179799523-179799545 CACAGTCACATGACTATTTCCGG - Intronic
918961944 1:191290585-191290607 CGCATTCACGTGGCTATGACTGG - Intergenic
921571940 1:216790168-216790190 CAGACTGAAGTGACTATGGCAGG - Intronic
922380221 1:225015854-225015876 CACACTCACCAGACTATGGAGGG + Intronic
1063979374 10:11441388-11441410 CACACTCACACGACAATTACAGG + Intergenic
1068932097 10:62601946-62601968 CACACTGTCTTGACTATCACAGG + Intronic
1070239692 10:74666667-74666689 AACACTCACATGACTCTCACTGG - Intronic
1072675499 10:97462705-97462727 CACAATCACAAGACCATGACGGG + Intronic
1077992186 11:7422136-7422158 CAGACTCACCTGACTATCAATGG - Intronic
1078820937 11:14881241-14881263 GACAATCAAGTAACTATGACAGG + Intronic
1079179076 11:18172855-18172877 GACACACTCGTGACTAGGACTGG - Exonic
1079268342 11:18957393-18957415 GACACACTCGTGACTAGGACTGG + Intergenic
1083966007 11:66044147-66044169 CTCACTCACGTGGTTTTGACAGG - Intronic
1089492078 11:118890074-118890096 CACACCCACTTGACTAATACTGG - Intronic
1091956601 12:4649162-4649184 AACACTTACGTGACATTGACAGG - Exonic
1092747545 12:11688135-11688157 CACCCTGACGTGGCTAAGACTGG - Intronic
1096335001 12:50748023-50748045 CAGACTCATGTGACCAAGACAGG - Exonic
1101090243 12:101277899-101277921 CACACTGACTTGACTCTGACTGG - Intergenic
1103742087 12:123097766-123097788 GACATTCACGTGAAGATGACGGG + Intronic
1108243363 13:48490514-48490536 CACACTCACATGCCTATCTCTGG - Intronic
1108491852 13:50990105-50990127 CACACTCACGGGACTATAAGAGG + Intergenic
1109468753 13:62776428-62776450 TACTTACACGTGACTATGACAGG + Intergenic
1114703227 14:24699899-24699921 CAAACACATGTGACTATAACTGG - Intergenic
1118737933 14:68715760-68715782 CACATTCATGGGACTGTGACTGG - Intronic
1132342392 15:101086723-101086745 CACACTCACATGAGTGAGACCGG - Intergenic
1140878003 16:79171093-79171115 CACTCTCACGTGCCTAGCACTGG - Intronic
1141449260 16:84086477-84086499 CACACTCACGTGCCTCTTCCTGG - Intronic
1142282398 16:89155346-89155368 CAGGCTCACGTGCCTCTGACAGG + Exonic
1144313416 17:14035916-14035938 CACACACACGTAACTATGGGTGG - Intergenic
1144795519 17:17888739-17888761 CACACTGAGGTGACTCTGCCAGG + Intronic
1152307703 17:79530926-79530948 CACAGCCACGTGGCTCTGACTGG - Intergenic
1152367898 17:79867389-79867411 CAGACACACGTCACTATGCCTGG + Intergenic
1156090959 18:33468504-33468526 CACCCTCAAGTTACTATCACTGG + Intergenic
1160150013 18:76391618-76391640 CCCAGACACGTGACTAGGACAGG + Intronic
936378622 2:111964355-111964377 CACACACACGAGACAATGATGGG - Intronic
937627922 2:124064719-124064741 CACCCTCCCGTGACTACCACTGG + Intronic
938919401 2:135980940-135980962 CATACTCACATCACTATGACTGG + Intronic
940490512 2:154353400-154353422 CACACACACGTAACTATGTGAGG - Intronic
948403348 2:237700390-237700412 TTCACTCACGTGAATGTGACAGG - Intronic
1169444817 20:5662627-5662649 CACGCACACGTGACCATGCCAGG - Intergenic
1179555715 21:42174353-42174375 CCCACTCACGTGACTCAGGCTGG - Intergenic
953297979 3:41740468-41740490 CATACTCATATTACTATGACAGG - Intronic
954957879 3:54538029-54538051 GACACTCACGTGACTGTGCAGGG - Intronic
957041013 3:75335569-75335591 CTCACTCCCGTGACTGTGGCAGG - Intergenic
957200256 3:77125243-77125265 GACACTCATGTGACTGTGATTGG - Intronic
961045819 3:123707224-123707246 CTCACTCCCGTGACTGTGGCAGG - Intronic
964646916 3:158968558-158968580 CACACTCAGGGTACTGTGACAGG - Intronic
966781921 3:183591454-183591476 CACACTATTGTGACTATAACTGG + Intergenic
968715456 4:2155469-2155491 CACACTCAGGTGACTGTGTGAGG - Intronic
969468935 4:7375033-7375055 CACACCCTCGTCACTATGCCAGG - Intronic
969978934 4:11134196-11134218 CACACTCACCAGACTCAGACTGG - Intergenic
970889497 4:21026847-21026869 CACACTCACGTGACTATGACTGG - Intronic
972811499 4:42592610-42592632 TACAGTCACGTGACAATGACAGG + Intronic
980603059 4:135051170-135051192 AACAATCACATGACTAAGACAGG + Intergenic
982569685 4:157033071-157033093 CACACACACTTGATTATGACAGG + Intergenic
994457168 5:100025669-100025691 CACACACACATGCCTATGAGGGG - Intergenic
995947132 5:117661787-117661809 CACAATGACATGACTACGACAGG + Intergenic
1000505559 5:162113080-162113102 CACACGCACGCCACTATGCCTGG + Intronic
1006823666 6:36918098-36918120 CACAGACACGTGACTTTAACAGG - Intronic
1033835008 7:145299966-145299988 CACTGTCACGTGAATAGGACAGG + Intergenic
1035415022 7:158675927-158675949 CACACTCAGCTGACCATGGCAGG + Intronic
1036272964 8:7324283-7324305 CACTCTCACGTGAGTAAGAGGGG - Intergenic
1036348384 8:7986065-7986087 CACTCTCACGTGAGTAAGAGGGG + Intergenic
1049257794 8:141623170-141623192 CCCACTCACCTGACTCTGCCTGG + Intergenic
1055520096 9:77071937-77071959 TACACTCATGTGACAATGTCAGG + Intergenic
1056946743 9:91004079-91004101 ATCACTCAACTGACTATGACAGG + Intergenic
1186068255 X:5789695-5789717 CACACACACATCACCATGACTGG - Intergenic
1189157650 X:38774919-38774941 CACACACACTTGCCTGTGACAGG - Intergenic
1194732563 X:97473226-97473248 CACACTTAAGTCACTATGAAGGG - Intronic
1195601122 X:106750160-106750182 CACATTCACGTGGCTATGGTGGG + Intronic
1196421224 X:115523728-115523750 CACAGGCACGTGACCATGGCAGG - Intergenic