ID: 970898438

View in Genome Browser
Species Human (GRCh38)
Location 4:21130598-21130620
Sequence ATTTTTAAATAGCTCCTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 352}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970898438_970898440 8 Left 970898438 4:21130598-21130620 CCATGTAGGAGCTATTTAAAAAT 0: 1
1: 0
2: 1
3: 31
4: 352
Right 970898440 4:21130629-21130651 AATGAATGAGTGGTTGAGAAAGG 0: 1
1: 0
2: 7
3: 450
4: 728
970898438_970898439 -2 Left 970898438 4:21130598-21130620 CCATGTAGGAGCTATTTAAAAAT 0: 1
1: 0
2: 1
3: 31
4: 352
Right 970898439 4:21130619-21130641 ATATGTTAAAAATGAATGAGTGG 0: 1
1: 0
2: 2
3: 61
4: 672
970898438_970898441 24 Left 970898438 4:21130598-21130620 CCATGTAGGAGCTATTTAAAAAT 0: 1
1: 0
2: 1
3: 31
4: 352
Right 970898441 4:21130645-21130667 AGAAAGGAATTCTTAAAAAGAGG 0: 1
1: 0
2: 7
3: 58
4: 697

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970898438 Original CRISPR ATTTTTAAATAGCTCCTACA TGG (reversed) Intronic
900428266 1:2590274-2590296 ATTTTTAAATGGCCACTGCAAGG - Exonic
901149591 1:7092380-7092402 ATTTTAAAATACCTTCTAGAAGG - Intronic
901656067 1:10770460-10770482 ATTTTTAAAAAGGCCCTAAAAGG + Intronic
902199590 1:14823471-14823493 ATTTCCAAATACCTCCTACTTGG - Intronic
903087843 1:20879506-20879528 TTTTCTAAAAAGCTCCTAGAAGG + Exonic
903627119 1:24739112-24739134 ATTTTTAAAAAGCTAATAAATGG - Intergenic
904709819 1:32421696-32421718 ATTTTTAAATTGCACTGACATGG + Intergenic
906793213 1:48676792-48676814 ATTTTTACAAAGCTGCTGCATGG - Intronic
906859655 1:49346038-49346060 AATTTTAAAAAGCGCCTATATGG + Intronic
908697772 1:66864428-66864450 ATGTTTAAATAGTTGCTAAAAGG + Intronic
909100343 1:71341383-71341405 ATTTTTAGCTAACTGCTACAAGG + Intergenic
910422024 1:87075974-87075996 ATTTTAAATAAGCTCCTTCAAGG - Intronic
912156058 1:106921687-106921709 AACTTTAAATAGCTGTTACAGGG + Intergenic
912259745 1:108098558-108098580 ATTTTTAAAGCAATCCTACATGG + Intergenic
912817784 1:112843455-112843477 ACTTTGAAATGGCTTCTACACGG - Intergenic
913444438 1:118935049-118935071 CTTTTTAAAAAGCTTCTAGAAGG + Intronic
916449805 1:164909596-164909618 ATTTTGAAATGGCTGCTGCATGG - Intergenic
916704579 1:167335762-167335784 ATTTTTAAAATACTCTTACAAGG + Intronic
917728511 1:177850699-177850721 ATTTTTAACAACATCCTACATGG + Intergenic
917922366 1:179761128-179761150 ATTTTAAAACAGCACATACATGG + Intronic
918244057 1:182643571-182643593 ATTTTTAATAAGTTCCTAGATGG - Intergenic
919232792 1:194797000-194797022 AATTTTAAATAGCTCCTGGTGGG + Intergenic
920838307 1:209532641-209532663 GTTTTTAAATAGTTCATAAAAGG - Intergenic
922957607 1:229617089-229617111 TTTTTTAAATTGCTAATACAGGG + Intronic
923262668 1:232282330-232282352 ATTTTATAATATCTCCTGCATGG - Intergenic
1063135109 10:3209257-3209279 ATCTTTAAATAGGTCATAAAGGG + Intergenic
1063826726 10:9906989-9907011 TTTTTTAAAAAGCTCCTTGATGG + Intergenic
1064479398 10:15724276-15724298 ATTTTTAAGTACTTCGTACATGG - Intergenic
1068612579 10:59076530-59076552 ATTTTTTAATACCTACTATATGG - Intergenic
1069645083 10:69990027-69990049 CTTTTTAAATAGTTCCTCTAGGG - Intergenic
1071004649 10:80868567-80868589 ATTTTTAAATAGCTAGAAGAAGG + Intergenic
1071668720 10:87587100-87587122 ACTTTTAATTAGCACCTCCAGGG - Intergenic
1072756437 10:98024335-98024357 ATTCTTAAAGAGCTCTTCCAAGG - Intronic
1073919784 10:108445470-108445492 TTTATTAAATATCTCCTATACGG + Intergenic
1074064755 10:110004222-110004244 TTTTTTTAATGCCTCCTACAGGG - Intronic
1074210923 10:111334256-111334278 TTTTCTAAATATCTCCAACAGGG + Intergenic
1074380752 10:112978254-112978276 ATTTTTTAATAGCTACTAAGTGG + Intronic
1075197111 10:120369400-120369422 ATTTTTAAAAAGCTCCTAAGTGG + Intergenic
1075227132 10:120639808-120639830 ATTTTTAAAAAGCAACTCCAGGG + Intergenic
1075961923 10:126574720-126574742 ATTTTTAAAAAGTTCATAAATGG - Intronic
1076933716 10:133553249-133553271 ATGTTTAAATAGTTCCCACCTGG + Intronic
1078402590 11:11041212-11041234 ATAATTAAATAGCTCATAAAGGG - Intergenic
1079091478 11:17483377-17483399 ATTTTTAAATAACTCAAAGAGGG - Intergenic
1079780895 11:24603056-24603078 ATTTTTGTATAGCTTCTATACGG + Intronic
1080335775 11:31194346-31194368 TGTTTTAAATAGCTGTTACATGG + Intronic
1081368115 11:42261501-42261523 ATTTATAAATATCTCCTGAAAGG - Intergenic
1081391835 11:42538876-42538898 ATTTTTAAATAGCAAGAACAAGG + Intergenic
1081845080 11:46234786-46234808 ATTTAAACATAGCTCCTCCAAGG - Intergenic
1082742659 11:56927775-56927797 ATGTTAAGAAAGCTCCTACATGG - Intergenic
1083914377 11:65730620-65730642 ATTTTAAAATAGCTCAAAAATGG - Intergenic
1085272064 11:75276083-75276105 ATTTTTAAAATGTTACTACATGG - Intronic
1085935945 11:81143094-81143116 GATTTTAAATAATTCCTACAAGG + Intergenic
1086510056 11:87546972-87546994 ATTTTTAAGTAGATTCTGCAAGG - Intergenic
1086599450 11:88614907-88614929 ATTTTTAAAAAGGTGATACAGGG - Intronic
1086798745 11:91144149-91144171 ATTTTGAAATTGCTGCCACAGGG + Intergenic
1086839064 11:91662021-91662043 ATTTTTAAATTGCTCACAGATGG + Intergenic
1089168261 11:116494419-116494441 AATTTTTAAAAGCGCCTACAAGG + Intergenic
1090488386 11:127135582-127135604 ATAAGCAAATAGCTCCTACAGGG + Intergenic
1090679598 11:129039814-129039836 TTTTTTAAAAAGCTCCTAAGTGG - Intronic
1093442461 12:19214714-19214736 ATTTTAGAATAGCTGCTAAAGGG + Intronic
1093445884 12:19258070-19258092 CTTTTTAATTTGCTCATACAGGG + Intronic
1094336319 12:29359136-29359158 ATTATTAAATAGCTCTTGAATGG - Intronic
1095657756 12:44690463-44690485 ATTTTTAACAAGCTCCTAGATGG + Intronic
1095737370 12:45572458-45572480 ATTTTTACAGAGCACCTTCAAGG + Intergenic
1095821321 12:46481828-46481850 AAGTTTAAATATCTCATACAAGG + Intergenic
1097728459 12:63100773-63100795 ATTTTGAAATGGCTGCTGCAGGG + Intergenic
1098012208 12:66065467-66065489 ATTTTTCAATAACTCAGACAAGG - Intergenic
1098313212 12:69168040-69168062 ATTTTGAAGTGGCTGCTACAGGG - Intergenic
1098486738 12:71030234-71030256 AATTTTAAATAGATCCTTCAAGG - Intergenic
1098827852 12:75320570-75320592 AATTCTAGATAGTTCCTACATGG + Intronic
1099372306 12:81850449-81850471 ATTTCTAAATATTTCATACATGG + Intergenic
1099448982 12:82785850-82785872 TTTGTTAAATAGCTGCTAAATGG + Intronic
1099504423 12:83455148-83455170 GTTTTGCAATAGCTTCTACATGG + Intergenic
1099653000 12:85453156-85453178 AATTTGAAAGAACTCCTACATGG - Intergenic
1100363880 12:93901488-93901510 ATTTTGAAATGGCTGCCACAGGG + Intergenic
1100639290 12:96466505-96466527 AATATTAAATAGCTTCTAAAAGG + Intergenic
1101244386 12:102871607-102871629 ATTTTTGAACAGCTTCTACTTGG - Intronic
1102070293 12:110013460-110013482 ATTTTTAAATAGTACTTAAAAGG - Intronic
1102416150 12:112764570-112764592 ATTTTGAAATGGCTGCCACAGGG - Intronic
1103995596 12:124827983-124828005 ATATTTACAGAGCTCCTGCAAGG - Intronic
1105266759 13:18825923-18825945 ATTTTGAAATGGCTGCTGCAGGG + Intergenic
1106323491 13:28664704-28664726 ATTTTTAAGTCTATCCTACAAGG - Intronic
1106944690 13:34813967-34813989 ATTTTAAAAAAGAACCTACAAGG - Intergenic
1107917081 13:45163666-45163688 ATTTTTAAAAACCTCATTCAAGG + Intronic
1109064716 13:57672519-57672541 TTTCTTAAATAGTTCCTTCATGG - Intronic
1109493591 13:63137603-63137625 ATTTTTATATATCTCCAACTTGG - Intergenic
1109549436 13:63874232-63874254 ATTTTAAAAATGCTTCTACAAGG + Intergenic
1109681009 13:65752602-65752624 ATTTTTAGATAGCTCTTTGAGGG - Intergenic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1110355474 13:74562001-74562023 ATTTGGAGATAGGTCCTACATGG + Intergenic
1110497415 13:76185202-76185224 ATTTTTAAATTTCTTCTTCATGG - Intergenic
1111538418 13:89635412-89635434 ATTTTTAAATATCTGCTTCCTGG + Intergenic
1111691013 13:91563360-91563382 TTTTTTTAATTGCTACTACACGG - Intronic
1112959349 13:105103705-105103727 ATTTTTAACAAGCTCCCAGATGG - Intergenic
1113355410 13:109575040-109575062 ATTTTTAAATAGCTAGAAAAAGG + Intergenic
1115155129 14:30330104-30330126 ATTTTGATATGGTTCCTACATGG - Intergenic
1115410715 14:33071295-33071317 ATTTCTAAATAACACTTACATGG + Intronic
1115592890 14:34881380-34881402 ATTTTTAAAAAAATCTTACATGG - Intergenic
1115931645 14:38503460-38503482 ATTTCTAAATAAGTCCTAGAAGG - Intergenic
1116093720 14:40340682-40340704 ATTTTGAGATGGCTGCTACAGGG + Intergenic
1116361171 14:44000048-44000070 ATATTTTAATAGCTATTACAAGG - Intergenic
1116871187 14:50070417-50070439 ATTTCTAACAAGCTCCCACATGG - Intergenic
1117556744 14:56893988-56894010 CTTTTTAAATAGCTCCTCGGAGG + Intergenic
1121270486 14:92634551-92634573 ATTTTTAAACAGCTCCTGAGGGG - Intronic
1121366869 14:93320908-93320930 ATTTTTAATTAGTTTCTAAAGGG - Intronic
1123205387 14:106707694-106707716 CTTTTTCAAAAGCTTCTACATGG - Intergenic
1123210432 14:106754961-106754983 CTTTTTCAAAAGCTTCTACATGG - Intergenic
1202831764 14_GL000009v2_random:42171-42193 ATTTTGAAATGGCTGCTGCAGGG - Intergenic
1124096339 15:26651846-26651868 ATTTTGAAATGGCTGCCACAGGG + Intronic
1125443230 15:39725632-39725654 AGTTTTACAAAGCTGCTACAGGG + Intronic
1127382512 15:58442237-58442259 ATATTTAAATAGCTGATACCAGG - Intronic
1128401106 15:67281736-67281758 ATTTTGAAATAGTTGCCACAGGG - Intronic
1128445512 15:67756132-67756154 ATTGTTACAGTGCTCCTACAAGG + Intronic
1128790602 15:70430873-70430895 ATTTATAAAAAACACCTACATGG + Intergenic
1129021193 15:72520447-72520469 TTTTTTAAACGGCACCTACATGG - Intronic
1129653182 15:77505888-77505910 ATTTTGAAATAGCAGCTACCTGG - Intergenic
1130034855 15:80349549-80349571 ATTTTTAAAAAGCTGCCACGAGG - Intronic
1130046312 15:80448122-80448144 ATTTTTAAAATGCCCCTTCAAGG + Intronic
1130821465 15:87500621-87500643 CTTTTTAAAAAGCTCTTAAATGG + Intergenic
1131608667 15:93937540-93937562 ATTTTTAAATTGCTGCTAATGGG - Intergenic
1132943909 16:2521640-2521662 ATTTTTACTTAGGTTCTACAGGG + Intronic
1133797603 16:9058887-9058909 AATTTTAAATTCCTCCTCCAGGG + Intergenic
1138482348 16:57311896-57311918 ATTAATAAATACTTCCTACAAGG - Intergenic
1140633556 16:76883449-76883471 TTATTTAAATAGCTGCTCCAAGG - Intergenic
1142970809 17:3610315-3610337 ATTTGTAAATAGCTCCCAGGTGG + Exonic
1143692112 17:8577500-8577522 ATTATTTAATACCTCTTACAAGG - Intronic
1146082321 17:29791762-29791784 ATTTTTTAATAGTTGCTACTAGG + Intronic
1149357967 17:55863286-55863308 ATTTTTAAATAGCCACGAAATGG - Intergenic
1150310934 17:64129484-64129506 ATTTTTAAAAAGTTCAAACAAGG + Intronic
1152419270 17:80183274-80183296 ATCTTTCAACAGCTCCTCCAGGG - Intronic
1153236707 18:2995248-2995270 ATTATTAAATAGCTCCTTGATGG - Intronic
1153744292 18:8161656-8161678 ATTTTTAAATGTCTCCTGCTTGG - Intronic
1153938071 18:9949344-9949366 ATTTTTAAATAGATTTTACATGG + Intronic
1154421649 18:14235543-14235565 ATTTTGAAATGGCTGCTGCAGGG - Intergenic
1155684385 18:28530741-28530763 ATTCTTAATTACCTCCTAAAAGG + Intergenic
1155720735 18:29008636-29008658 ATTTTGAAATGGCTACAACAAGG - Intergenic
1155725800 18:29081463-29081485 ATTTTTAAACAGGTGTTACATGG - Intergenic
1155730834 18:29155965-29155987 ATCTTTAAATATTACCTACATGG - Intergenic
1155841446 18:30649106-30649128 ATTTTTAAAGACATCCTACCAGG - Intergenic
1156039076 18:32799059-32799081 TTTTTTAAAAAGCTTCTAAATGG - Intergenic
1156555077 18:38058347-38058369 AGTTTTAAAAAGCTCCTATCAGG + Intergenic
1156891624 18:42196901-42196923 ATTTTTAAATATCTTCAATAAGG + Intergenic
1158289617 18:55924615-55924637 ATTTTTAAATAACTCGTAGAAGG - Intergenic
1158727859 18:59991035-59991057 ATTTTAAAATAACTACCACAAGG - Intergenic
1159527194 18:69607574-69607596 ATTTTAATATAGTTCCTACTTGG + Intronic
1160438508 18:78869667-78869689 ATTTTTCAATAGCACAGACAAGG + Intergenic
1163089088 19:15006075-15006097 GTTTTGAAATAGCTCATTCATGG + Intronic
1163336175 19:16673378-16673400 ACTTTTAAATAGCTACTCTATGG + Intronic
1163363270 19:16861470-16861492 ATTTTTAAATTGGCCCTGCATGG + Intronic
1164666843 19:30045197-30045219 ATTTTTGCATAGTTCCAACATGG - Intergenic
1165505175 19:36222721-36222743 ATTTATAAACAGCTCCTCTAAGG - Intronic
1166434203 19:42753594-42753616 ATTTTAAAAGAGAGCCTACACGG - Intronic
1166437345 19:42778921-42778943 ATTTTAAAAGAGACCCTACATGG - Intronic
1166472395 19:43089657-43089679 ATTTTAAAAGAGACCCTACATGG - Intronic
1166483525 19:43193606-43193628 ATTCTAAAAGAGCGCCTACATGG - Intronic
1166485995 19:43212693-43212715 ATTTTAAAAGAGATCCTACATGG - Intronic
1166493152 19:43276644-43276666 ATTTTAAAAGAGAGCCTACATGG - Intergenic
1202640930 1_KI270706v1_random:85580-85602 ATTTTGAAATGGCTGCTGCAGGG + Intergenic
925190762 2:1881605-1881627 ATTTTCAACTTGCTCCTCCAGGG - Intronic
925242760 2:2346923-2346945 ATGATTAAATACCTCCTACCGGG + Intergenic
925766495 2:7241348-7241370 ATTTTGAAATAGCTTCTCCAAGG - Intergenic
927042178 2:19240744-19240766 ATTTTTAATAAGCTCCTAGGTGG - Intergenic
927162466 2:20280052-20280074 ATATATAAATAGGTCATACAGGG + Intronic
927782046 2:25947278-25947300 CTTTTTAAAAAGTTACTACAGGG + Intronic
929012084 2:37455037-37455059 TTTTTCAAATGGCTCCTAAAAGG - Intergenic
930134208 2:47884715-47884737 ATTTTTTAAAAGCTTTTACATGG + Intronic
932376519 2:71240912-71240934 CTTTGTAAAGAGCTCCTACCAGG - Intergenic
934496492 2:94805581-94805603 ATTTTGAAATGGCTGCTGCAGGG + Intergenic
934658229 2:96128492-96128514 ATTTTTAAATAGATGCTAAATGG + Intronic
935046258 2:99486205-99486227 AATTTCAAATAGTTCCTAGAAGG + Intronic
936031082 2:109071042-109071064 ATTTATTTATAGCTACTACAAGG + Intergenic
937255410 2:120552051-120552073 ATGGTTAAGTAGCTCCTCCAAGG + Intergenic
937925715 2:127166034-127166056 ATTTTCAAATTCCTCCTGCATGG - Intergenic
938098190 2:128476739-128476761 ATTTTTTAAAAACTCTTACATGG - Intergenic
939171134 2:138697339-138697361 ATTTTTAATAAGCTTCTAAAAGG - Intronic
939253023 2:139707572-139707594 ATTTTTAAATAACTACTACAAGG - Intergenic
939976785 2:148727098-148727120 ATTTTTAAATATATGCTATAAGG + Intronic
940559276 2:155273716-155273738 ATTTTTAAAGAACTTCTGCACGG - Intergenic
941584022 2:167334345-167334367 ACTTTTAAATAGTCCCTGCAAGG + Intergenic
942233530 2:173882090-173882112 ACTTATAAATAGCACCTACTCGG + Intergenic
945073959 2:206018457-206018479 TTTTTTAAACAGCTCTTAAAAGG + Intronic
945358658 2:208869065-208869087 ATTTTGAAATAACTACTTCAGGG - Intergenic
945469159 2:210207268-210207290 ATTTTTGAATAGCTCCTAATAGG + Intronic
945604584 2:211912667-211912689 AATTTGAAATGGCTGCTACAGGG + Intronic
945604782 2:211915391-211915413 GTTTTTAAATAGCACATAGAAGG + Intronic
945651706 2:212569257-212569279 AATTTTAACTAGATCCTTCAGGG + Intergenic
948902139 2:240962159-240962181 TCTTTTAAAAATCTCCTACAGGG - Intronic
1169290856 20:4350752-4350774 ATTTTCAAATTCATCCTACAAGG - Intergenic
1169389667 20:5179420-5179442 CTCTTAAAAGAGCTCCTACAAGG - Intronic
1169522345 20:6387305-6387327 ATTTTGAAATGGCTGCTGCAGGG - Intergenic
1169797134 20:9475088-9475110 ATTTTTAAAAACCTTCTCCAAGG - Intronic
1170974228 20:21147191-21147213 AATTTTAAATATGTCCTAAAAGG - Intronic
1171210369 20:23311653-23311675 ATTTATAAATAGATCATGCAGGG + Intergenic
1171887798 20:30672312-30672334 ATTTTGAAATAGCTGCTGCAGGG + Intergenic
1174526008 20:51172075-51172097 ATTTTCCATTAGCTCCAACAAGG - Intergenic
1175057304 20:56210069-56210091 ATTTTGAAATGGCTCTCACAGGG - Intergenic
1177171406 21:17659972-17659994 ATTCTTACATAGATCCTTCAAGG + Intergenic
1177421276 21:20861028-20861050 ATTTTGAAATAGGGCCTATAAGG + Intergenic
1179051466 21:37892102-37892124 ATGTTTCAAAAGCTCCCACATGG - Intronic
1179682416 21:43032847-43032869 GCTTTTAACTAGCTTCTACATGG + Exonic
1180361025 22:11896282-11896304 ATTTTGAAATAGCTGCTGCAGGG - Intergenic
1180643088 22:17315199-17315221 ATCCTTAAACAGCTCCTAGAGGG - Intergenic
1182387434 22:29956899-29956921 ATTTTTAAATTGGTGCAACATGG - Intronic
952094707 3:29936042-29936064 ATTTGAAAATATATCCTACAAGG - Intronic
952617282 3:35289734-35289756 AATTTGAAATTGCTCCTCCAAGG + Intergenic
953506014 3:43485994-43486016 ATTTTGAAATGGCTGCCACAGGG + Intronic
954075660 3:48177607-48177629 ATTGTTAGTTAGCTCCTTCAGGG + Intronic
955071028 3:55572548-55572570 ATTTTACACAAGCTCCTACATGG + Intronic
955674203 3:61433563-61433585 ATTTATAATCAGTTCCTACAAGG - Intergenic
956107685 3:65837783-65837805 ATTTTTAGCTAGTTCCTAAAAGG + Intronic
957614680 3:82511462-82511484 ATTTCTAAATATCCCCTATATGG - Intergenic
959594381 3:108113847-108113869 ATTTTAAAATTGTTCCTAAATGG + Intergenic
960155499 3:114293842-114293864 ATTTTTAAATGTTTCCTTCATGG + Intronic
960975145 3:123166185-123166207 ATGTATAAATAACTCCTACAAGG - Intronic
961050042 3:123738086-123738108 ATTTATAAATCCCTTCTACATGG + Intronic
961254601 3:125537517-125537539 ATTTTTAAAGAATTCTTACAGGG - Intronic
962421027 3:135229422-135229444 ATTTTTAAATAGCTGTTGGAGGG + Intronic
962517932 3:136170810-136170832 ATTTTTAAATAACTCCAATCAGG + Intronic
963359566 3:144253364-144253386 ATGTTTGAATGGCTCCTCCAGGG - Intergenic
964591693 3:158370038-158370060 ATTTTTTAAAAGCTCCTGAATGG + Intronic
965143141 3:164864850-164864872 ATTTTGAAATAGCTATCACAGGG - Intergenic
965221974 3:165937668-165937690 ATTTTAAATTAGGTCATACAGGG - Intergenic
967140814 3:186557824-186557846 ATTTTTAAAGAGCTTGTACATGG + Intronic
968326069 3:197817695-197817717 ATTTTTGATTAGCTCCTGTAGGG + Intronic
1202737632 3_GL000221v1_random:21807-21829 ATTTTGAAATGGCTGCTGCAGGG - Intergenic
970853061 4:20624772-20624794 TTTTTTAAATATCTCCCACTGGG + Intergenic
970898438 4:21130598-21130620 ATTTTTAAATAGCTCCTACATGG - Intronic
972043521 4:34635703-34635725 TTTTTTAAATATTTCCTATAGGG + Intergenic
973384446 4:49496111-49496133 ATTTTGAAATGGCTGCTGCAGGG + Intergenic
974628678 4:64455802-64455824 AGTTTGAAATAGCTTCTAAATGG - Intergenic
975447464 4:74482629-74482651 ATTTTTAAATAGCTATTAAAAGG - Intergenic
976201399 4:82582643-82582665 ATTTTTAAATTTCTGTTACAAGG + Intergenic
978474693 4:109112876-109112898 AATTTTATATAACTACTACAGGG - Intronic
978820841 4:112963678-112963700 ATTCTTACATAGTTCCTTCAGGG + Intronic
979030840 4:115644033-115644055 ATTTTTAAAAAGATCATACTTGG + Intergenic
980833998 4:138167440-138167462 ATTTTTAAATAGGTCCGGCACGG - Exonic
981525625 4:145704409-145704431 ATTTTTAAATGGCTGCTACTTGG - Intronic
982476314 4:155855798-155855820 ATTTTGAAATGGCTGCTGCAGGG + Intronic
982752777 4:159182139-159182161 ATCTTTAAATAGCTTTTAAAAGG + Intronic
983076877 4:163337355-163337377 ATTTCAAAATAGCTTCTAAAAGG - Intronic
983118945 4:163856707-163856729 ATTTTTAAATAGCCTCCAAAGGG + Intronic
983227595 4:165099648-165099670 ATTTTTAAAAAGTTCCCACCAGG + Intronic
984156468 4:176201197-176201219 ATTCTTAAAAAGCGACTACAAGG + Intergenic
1202768295 4_GL000008v2_random:171435-171457 ATTTTGAAATGGCTGCTGCAGGG + Intergenic
985798398 5:1983433-1983455 ATTTTAAAAGAGCTCTTACGAGG - Intergenic
986912635 5:12575485-12575507 CTTTCTAATTAGGTCCTACATGG - Intergenic
987182556 5:15383612-15383634 ATTTTTTGATAGTTCCTATAAGG + Intergenic
987517389 5:18930392-18930414 ATATCTAAATAGCTTTTACATGG + Intergenic
987680330 5:21128302-21128324 ATTTTGAAATGGCTGCTGCAAGG + Intergenic
988574860 5:32411763-32411785 ATTTATATATAGCACTTACATGG + Intronic
988865961 5:35335333-35335355 ATTTTTAAATTGCTCAGTCAAGG - Intergenic
989288986 5:39739635-39739657 ATTTTTAGTTAATTCCTACATGG - Intergenic
989467207 5:41770390-41770412 TTTTTTAAATATCTTCTTCAGGG + Intronic
989490981 5:42053115-42053137 ATTTTTAAAATGCTCATACTTGG + Intergenic
989582931 5:43050386-43050408 GTTTTTTAACAGCACCTACAAGG - Intergenic
991131546 5:63127974-63127996 AATTTTCAATGGCTCCTAGATGG - Intergenic
991273761 5:64818946-64818968 ATCTTTAAATAGCTACTAAAAGG - Intronic
991321421 5:65377431-65377453 ATCTTTAAATACCTCCTAAAAGG + Intronic
991601642 5:68356758-68356780 ATTTGTAAATTGCTCCTATTTGG - Intergenic
995251682 5:110000457-110000479 AGTTTTGAATAACTGCTACAAGG + Intergenic
999592116 5:153159545-153159567 ATTTCTAAATAGCTTCTGGATGG - Intergenic
999839571 5:155410927-155410949 ATTTTTAAATTGCTTAAACATGG - Intergenic
1000460809 5:161515704-161515726 ATTTGTAAATTGCTACTCCATGG + Intronic
1000563225 5:162816219-162816241 AATTTTAGATGGCTCCTAAATGG - Intergenic
1000576784 5:162984650-162984672 ATTTTTAAATGACACCTACATGG + Intergenic
1000583210 5:163060491-163060513 ACTTTTGAATAGCTCATAAAGGG - Intergenic
1000739286 5:164946252-164946274 ATATTGACATAGCTCCTTCATGG + Intergenic
1000826648 5:166053553-166053575 ATCTTGAAATAGCTACTAAAAGG + Intergenic
1003202759 6:3977398-3977420 ATTTGCAAATGGCTCCTGCAGGG - Intergenic
1004420596 6:15466114-15466136 ATTTTTATATTGCTCTCACATGG + Intronic
1004574764 6:16884939-16884961 ATTTTTAAATAGTTGCCACAGGG - Intergenic
1005163432 6:22892204-22892226 ATTCTTTCATAGCTCCTCCAAGG - Intergenic
1005301354 6:24474268-24474290 ATTTTTATATATATCCTATAAGG - Intronic
1008720621 6:54345887-54345909 ATTTTTAATTAGCACCTTGAGGG + Intronic
1008748756 6:54706916-54706938 AATTTTAAATAGCAACTTCATGG + Intergenic
1009648793 6:66446262-66446284 ATTTTAGAATAACTGCTACATGG - Intergenic
1010111112 6:72234158-72234180 ATTTTTAAATAGTTCTAAAATGG - Intronic
1010720252 6:79275450-79275472 CTTTTTAAAGAGCTCTTTCAAGG + Intergenic
1011709706 6:90039944-90039966 ATATTTAAAGAGCTTCTCCAAGG - Intronic
1012157546 6:95838831-95838853 ACTTTTAGAAAGCTCCAACAGGG + Intergenic
1012879177 6:104764469-104764491 ATTTTTAAATGTTTCCTCCAGGG + Intronic
1014987067 6:128024204-128024226 ATGTTTACAGAGCTCTTACAAGG - Intronic
1015585088 6:134768383-134768405 TTTTTTAAATAACTACTATATGG + Intergenic
1015679413 6:135787968-135787990 ATTTTTAAAAATCTCAAACATGG - Intergenic
1016284131 6:142453493-142453515 ATTTTTAAATGCCTTCTTCAAGG - Intergenic
1016674988 6:146754201-146754223 ATTTTTAAATATCTTCTCAATGG + Intronic
1018093412 6:160364108-160364130 CATTTGAAATAGCTACTACAGGG + Intronic
1018145387 6:160882096-160882118 ATTTTTAGATAGCTCACAAAAGG - Intergenic
1021263326 7:18486408-18486430 AGCTTTAAAGAGATCCTACATGG - Intronic
1021297982 7:18932995-18933017 AATTTAAAATAGGTCCTAGAAGG + Intronic
1023233849 7:38063901-38063923 CATTATAAATAGGTCCTACATGG + Intergenic
1023250100 7:38249867-38249889 ATTTTTAACTGCCTCCTACCAGG + Intergenic
1023251405 7:38265973-38265995 ATTTTTAACTGCCTCCTACCAGG + Intergenic
1024147599 7:46533197-46533219 ATTTTGAAATGGCTGCTACAGGG + Intergenic
1024256853 7:47545855-47545877 GTTTTTAACCAGCTCCTGCAGGG - Intronic
1024377430 7:48655648-48655670 ATTTTGGAATAGATTCTACAAGG - Intergenic
1024385380 7:48745554-48745576 ATTTTTAACAAGCTCCAAGATGG + Intergenic
1024873774 7:53996603-53996625 ATATTTAAATAGCTTTTAAATGG + Intergenic
1027616469 7:80430592-80430614 ATTTTGAAATGGCTGCCACAGGG - Intronic
1027805603 7:82817750-82817772 ATTATTAAATAGGTCATGCAAGG - Intronic
1028649191 7:93131591-93131613 ATCCTTAAATAGATCCTTCAGGG - Exonic
1029353988 7:100037020-100037042 ATCTTCAAATAGCTGCTTCAAGG - Exonic
1029872323 7:103707922-103707944 ATTTTTAAATAACAAGTACAGGG - Intronic
1030611582 7:111695475-111695497 ATTTTGAATTTGCTCCCACATGG + Intergenic
1030835672 7:114281453-114281475 ATTTTTAAACAGTTCCATCAGGG + Intronic
1031431696 7:121678515-121678537 ATTTTAAAATAGCTACTGCATGG - Intergenic
1031858417 7:126949404-126949426 ATTTTTTATTAGCTACTCCAAGG - Intronic
1032243997 7:130191706-130191728 ACTTCTAAATAGCTCCTACTGGG + Intronic
1032478640 7:132229090-132229112 TTTTTTGAAAAGCTCCTACTTGG - Intronic
1032713339 7:134482333-134482355 AATTTTAAAAAGCTGCCACAAGG + Intergenic
1033854514 7:145542665-145542687 ATTTTGTAATAGCTCATGCAAGG + Intergenic
1034380155 7:150685175-150685197 ATTTTTACATAACTCATTCATGG - Intergenic
1034593118 7:152160828-152160850 TTATTTAAATAGCTCCTTGAAGG - Intronic
1034745009 7:153516496-153516518 ATTTTTAACAAGCTCCCAGAAGG - Intergenic
1037279486 8:17221372-17221394 TTTTTTAAATAGTGCATACAAGG - Exonic
1037354667 8:18005148-18005170 ATTTTTAAAAAGCACCCACTAGG - Intronic
1038271948 8:26082378-26082400 ATTTTAAAATAGCTACTAAATGG + Intergenic
1041121941 8:54594847-54594869 ATTTTTTAAAATCTCATACATGG - Intergenic
1041320437 8:56606857-56606879 ATTTTGAAATAGCTGCCCCAAGG - Intergenic
1041620174 8:59957797-59957819 ATTTTGAAATAGCTGCTATGAGG + Intergenic
1041732619 8:61077723-61077745 ATTTTTAAATAGGTGCTTGAAGG + Intronic
1042183032 8:66111081-66111103 GATTTTAAATAACTTCTACAAGG - Intergenic
1042349853 8:67766133-67766155 ATATTTACTAAGCTCCTACAAGG - Intergenic
1042388622 8:68206436-68206458 GATTTTTAATAGCTCTTACAGGG - Intronic
1042451411 8:68951496-68951518 ATTTTTAAATAGCTACTCTAAGG - Intergenic
1042763903 8:72300000-72300022 ATATTTAAATAGATCTTAGATGG + Intergenic
1043056719 8:75448692-75448714 ATTTTTAAAAAACACCTAAAAGG + Intronic
1044555822 8:93560998-93561020 CTTTTTTAAAAGCTCCTAAAAGG + Intergenic
1044754040 8:95443518-95443540 ATTGTTTGATAGCTCCTAAATGG - Intergenic
1045831184 8:106462500-106462522 ACTTTTAAATAGCTTATCCAAGG - Intronic
1046390459 8:113565755-113565777 ATTTTTAAACAGCTCAATCAAGG - Intergenic
1046672925 8:117077218-117077240 ATTTTTAACAAGCTCCTCCGGGG - Intronic
1048914761 8:139171585-139171607 AAATTTACATAGCTCCTACATGG - Intergenic
1050646217 9:7722496-7722518 ATTTTTAAAAAGCTTGAACAGGG - Intergenic
1051097203 9:13480213-13480235 GTTTTTAAATAGCTCCAAAAAGG + Intergenic
1051196252 9:14565424-14565446 ATTTTCAACAAGCTCCTAGAGGG + Intergenic
1052170933 9:25395528-25395550 ATTTTGAAATGGCTGCTACTTGG - Intergenic
1052830949 9:33215051-33215073 ATTTTTAAAAAGATCCCAGAGGG - Intergenic
1053328519 9:37180268-37180290 ACTTTTAATAAGCTCCTAAAAGG - Intronic
1053660653 9:40274867-40274889 ATTTTGAAATGGCTGCTGCAGGG - Intronic
1053911029 9:42904211-42904233 ATTTTGAAATGGCTGCTGCAGGG - Intergenic
1054361666 9:64127773-64127795 ATTTTGAAATGGCTGCTGCAGGG - Intergenic
1054372776 9:64421084-64421106 ATTTTGAAATGGCTGCTGCAGGG - Intergenic
1054523957 9:66101417-66101439 ATTTTGAAATGGCTGCTGCAGGG + Intergenic
1054680402 9:67910860-67910882 ATTTTGAAATGGCTGCTGCAGGG - Intergenic
1055314381 9:75019350-75019372 ATTTTGAAATGGCTGCCACATGG + Intronic
1055348405 9:75360252-75360274 ATTTTTAAATGGCTGCCACTTGG + Intergenic
1055908190 9:81317650-81317672 ATTTTTAAATAGCAAATAAATGG - Intergenic
1056171749 9:83992193-83992215 ATTTTATAATAGCACCTAAAAGG - Intronic
1056721509 9:89076034-89076056 GTTTTTAAATATCTCCTTCAGGG - Intronic
1057314527 9:93959913-93959935 ATTTGTAAATTGCTCCAAGAGGG - Intergenic
1057747622 9:97764377-97764399 GTTTTTCAACAGCTCCTTCATGG - Intergenic
1058414098 9:104767131-104767153 ATTTTTATAAAGCTCCCAAATGG - Intronic
1059241816 9:112812641-112812663 ATTTTTTAAAAGCTCCTTTAAGG - Intronic
1060448418 9:123713978-123714000 ATTTTTAGATGGCTCTTATAAGG - Intronic
1061393500 9:130330711-130330733 ATTTTAGAACAGCCCCTACAAGG - Intronic
1203706358 Un_KI270742v1:52250-52272 ATTTTGAAATGGCTGCTGCAGGG - Intergenic
1185958575 X:4520412-4520434 ATTTTTAAAAAGATGCTATAAGG + Intergenic
1186131495 X:6470862-6470884 ATTTCTAACAAGCTCCTGCAAGG - Intergenic
1186649838 X:11547390-11547412 ATTTCTAATTATCTCCTAGATGG + Intronic
1188345346 X:29057759-29057781 TTTATTAAATAGCTCCTAGCTGG + Intronic
1188879237 X:35471561-35471583 ATTTTCAAATACCACCTAAAGGG + Intergenic
1188889627 X:35594466-35594488 ATTTTTAAAAAGCTGTGACATGG + Intergenic
1188970539 X:36610141-36610163 ATTCTAAAATAGCTGTTACATGG + Intergenic
1189072922 X:37883930-37883952 ATTTTTAAAAAGAGCCTACATGG - Intronic
1189985749 X:46551956-46551978 ATTTTAAAATGGCTGCCACAGGG - Intergenic
1191029126 X:55948956-55948978 ATTTTTAAATAGATCATCAATGG + Intergenic
1192116950 X:68420637-68420659 ATTTTTATCAAGCTCCTACTAGG + Intronic
1193449541 X:81648824-81648846 ATTTTTAAATAGGTTCTAATAGG - Intergenic
1193536565 X:82723641-82723663 ATTTTTGAATAGTTCATTCATGG + Intergenic
1193732151 X:85114958-85114980 TTTTTTAAATAACTGCCACAAGG + Intergenic
1193838272 X:86373979-86374001 ATTTTTAAATTTATCCTAAAAGG + Intronic
1194843794 X:98777333-98777355 ATAGTTTAATAGCTTCTACATGG + Intergenic
1195604002 X:106781688-106781710 TATTTTCAATAGCTCCTACTGGG - Intronic
1195606119 X:106807595-106807617 ATTTCTCAAAATCTCCTACAAGG + Intronic
1195606455 X:106810858-106810880 ATTTTTCAAAACCTCCTACAAGG - Intronic
1196002678 X:110803530-110803552 TTGTGTAAATATCTCCTACATGG + Intergenic
1197135379 X:123053914-123053936 ATTTTCAAAGAGCTCCTATTGGG - Intergenic
1197693336 X:129524882-129524904 ATCTTTCAATAGCTGCAACATGG - Intergenic
1199769022 X:150962044-150962066 TTTTTCAAATAGATCCTAGAAGG - Intergenic
1200574759 Y:4874560-4874582 ATTGTTAAATAGTGGCTACAGGG - Intergenic
1200804975 Y:7423974-7423996 ATTTATAAGTAGTTCCAACATGG + Intergenic
1201337646 Y:12897562-12897584 ATTTTTAAACTCCTCCAACATGG + Intergenic
1201379733 Y:13361650-13361672 ATTTTTAAAAACCTTCTTCATGG - Intronic
1201485315 Y:14487728-14487750 ATTTTTAAATTGATTCTTCATGG + Intergenic