ID: 970898676

View in Genome Browser
Species Human (GRCh38)
Location 4:21133227-21133249
Sequence CATTGTGTATGTGAGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 321}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970898676_970898678 5 Left 970898676 4:21133227-21133249 CCTACTTCCTCACATACACAATG 0: 1
1: 0
2: 2
3: 29
4: 321
Right 970898678 4:21133255-21133277 GCTTTATTTTCAAAACCTCCTGG 0: 1
1: 0
2: 0
3: 24
4: 224
970898676_970898679 6 Left 970898676 4:21133227-21133249 CCTACTTCCTCACATACACAATG 0: 1
1: 0
2: 2
3: 29
4: 321
Right 970898679 4:21133256-21133278 CTTTATTTTCAAAACCTCCTGGG 0: 1
1: 0
2: 3
3: 38
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970898676 Original CRISPR CATTGTGTATGTGAGGAAGT AGG (reversed) Intronic
900887350 1:5424325-5424347 CATTTTACAAGTGAGGAAGTTGG + Intergenic
900953018 1:5868937-5868959 CATTGTGTGTGTGTGCATGTGGG - Intronic
903171821 1:21559020-21559042 CAGTGCGTGTGTGAGGAAGGAGG + Intronic
904683147 1:32242554-32242576 TCTTATGTATGGGAGGAAGTAGG - Intergenic
905255528 1:36679774-36679796 CAAGGAGTGTGTGAGGAAGTAGG - Intergenic
905612393 1:39365618-39365640 AATTGTGTATATGATGAAGATGG - Intronic
906471445 1:46133917-46133939 GAATGAGTATGTGAGGAAGAGGG - Intronic
906487997 1:46246633-46246655 CATTTTGTAAGTGAGGAAACAGG - Intergenic
906686839 1:47768311-47768333 GAGTGTGTGTGTGTGGAAGTGGG + Intronic
906867461 1:49438100-49438122 CATTTTACATGTGAGGAAATGGG + Intronic
907203357 1:52747052-52747074 CATTTTGTATATGAGGATGCTGG - Intronic
907561773 1:55397531-55397553 CTATGTGTATGTGAGGGTGTTGG - Intergenic
907698446 1:56758224-56758246 CATTTTGCAGGTGAGGAAATGGG + Intronic
907943870 1:59114606-59114628 CATTGTGTCTGTGAGTAAATTGG - Intergenic
912551155 1:110486155-110486177 CATTGGGCATCTGAAGAAGTGGG + Intergenic
913152825 1:116062388-116062410 CATTGATTATGTGAGTAAGAGGG + Intronic
915008291 1:152661179-152661201 AATGTTGTAAGTGAGGAAGTAGG - Intergenic
915350232 1:155219957-155219979 CATTTTCTAGGTGAGGAAATAGG - Intergenic
915676617 1:157538057-157538079 CATTTAGTAGGTGAAGAAGTGGG + Intronic
917645465 1:177024886-177024908 CATGGTGTCTGTGAGGAAGAAGG - Intronic
921703049 1:218288998-218289020 CATTTTGTAGATGAGGAAATTGG - Intronic
924032207 1:239897045-239897067 CATTTTGTAGATGAGGATGTAGG + Intronic
1063566207 10:7173935-7173957 CATTTTGTAAGTAAGGAAATTGG - Intronic
1063765055 10:9129912-9129934 CATTTTTTATTTGAGGAAATTGG + Intergenic
1063835221 10:10004422-10004444 CTTTGTGTATGTTAATAAGTTGG - Intergenic
1064927916 10:20590454-20590476 CTTTGAGTAGATGAGGAAGTGGG - Intergenic
1065961146 10:30735228-30735250 CAGTGGGTATGAGAGGAAGACGG + Intergenic
1066304605 10:34128574-34128596 GATTGTGTGTGTGAGGAGGAAGG + Intronic
1067099036 10:43321501-43321523 CATGATGTGTGTGAGGCAGTTGG + Intergenic
1067171445 10:43910223-43910245 GATTGTGTATGTATGGAACTAGG - Intergenic
1067214431 10:44289966-44289988 AATTTTGTGTGTGAGCAAGTTGG + Intergenic
1069149261 10:64935122-64935144 CTTTGTTTATGTGAGGAGGTGGG + Intergenic
1069694569 10:70377077-70377099 CCTTGTGCATGGCAGGAAGTGGG + Intronic
1071369553 10:84937467-84937489 TTTTGTTGATGTGAGGAAGTTGG - Intergenic
1071511231 10:86263781-86263803 AATTGTTTATGTTTGGAAGTAGG + Intronic
1072114431 10:92356226-92356248 CAGTGTGAATGTCAGGAATTTGG + Intergenic
1072181555 10:92986525-92986547 CATTGTGTATTTGGTGAAGAGGG + Intronic
1073204483 10:101761680-101761702 TGTTGTGCAGGTGAGGAAGTGGG + Intergenic
1074034478 10:109724563-109724585 CATTGTACAGGTGAGGAAGGAGG - Intergenic
1074100724 10:110353091-110353113 CATTTTAGAGGTGAGGAAGTAGG + Intergenic
1074128749 10:110553914-110553936 CATTGTGTTGGTTAGGATGTGGG + Intergenic
1074346308 10:112689521-112689543 CATTTTGTATGTGATGAAGGAGG + Intronic
1077646578 11:3930701-3930723 CAATTTGTATGATAGGAAGTAGG - Intronic
1078286312 11:9959110-9959132 CATCGTGTATGTGAAGACTTCGG - Intronic
1078313275 11:10267742-10267764 GATTGTGTGTTTGAGGAATTTGG - Intronic
1079465491 11:20725600-20725622 CACTTTATATGTGAGGAAATAGG + Intronic
1079483689 11:20911372-20911394 CATTGTGTAGGTCAGGCAATTGG + Intronic
1079525830 11:21386447-21386469 CTTTGTCTATGGAAGGAAGTGGG - Intronic
1079926519 11:26500060-26500082 AATTGTGTATGTGTGTGAGTGGG + Intronic
1079962908 11:26945908-26945930 CATTCTGTAGGTGAGAAAATGGG + Intergenic
1080336823 11:31207123-31207145 CATTGTGCAAATGAGGAAATAGG - Intronic
1080654469 11:34247856-34247878 CATTTTGTACATGAGGAAATCGG + Intronic
1081263543 11:40990394-40990416 CATTTTATATATGAGGAAATAGG + Intronic
1081620516 11:44616625-44616647 CATTGTATAGATGAGGAAGCAGG - Intronic
1082645785 11:55723026-55723048 TATTTTGCATGTGAGGAAGAGGG - Intergenic
1082725625 11:56732212-56732234 AATTTTGTATGTGATCAAGTTGG - Intergenic
1083007327 11:59359168-59359190 GAATGTGGAAGTGAGGAAGTGGG - Intergenic
1084904927 11:72338256-72338278 CATTGTGTAGCTGAGGAGGTGGG + Intronic
1085193691 11:74651972-74651994 CATTTTGTAGCTGAGGAAATAGG + Intronic
1085370092 11:75994349-75994371 CATTGTATATGTGAGGTACTGGG + Intronic
1086062760 11:82717366-82717388 AGGTGTGCATGTGAGGAAGTGGG - Intergenic
1087809621 11:102596331-102596353 CATTGTGTTTGAGAAGATGTGGG + Intronic
1087837300 11:102887711-102887733 CATTTTGTATGGCAAGAAGTAGG + Intergenic
1088493462 11:110409051-110409073 CATTGTGTTGGTGAGGCTGTTGG - Intergenic
1088580383 11:111310118-111310140 CTTTGTGTATATGAGGAAGTTGG - Intergenic
1089863323 11:121609881-121609903 CATTGTGTAGCTGAGGAAATGGG + Intronic
1090490131 11:127153315-127153337 CATTGTGTAGGAGAAGGAGTGGG + Intergenic
1090942137 11:131396213-131396235 CGTTTTGTAGGTGAGGAAGGAGG - Intronic
1091660620 12:2380609-2380631 CCTTGTGTATGTGATGAAAGAGG - Intronic
1091875315 12:3928933-3928955 CATTCTGTATATGGGGAGGTGGG - Intergenic
1093209679 12:16293133-16293155 CATTGCTTATGTGGGAAAGTAGG + Intergenic
1093530955 12:20162930-20162952 CATTGTGTAGCTAAGGAAATAGG + Intergenic
1094048864 12:26197025-26197047 CCTTTTGGATGTGAGGAAATAGG + Intronic
1096145153 12:49273729-49273751 CATTTTGTAAGTGAGGAAACGGG + Exonic
1097644663 12:62222069-62222091 CAATGTTTATTTTAGGAAGTCGG + Intronic
1098188025 12:67919303-67919325 CATTGTGATTGTGAGAAAATAGG + Intergenic
1100176731 12:92039058-92039080 TATTGTGTATCTGTAGAAGTTGG - Intronic
1100364177 12:93904168-93904190 CAGTATGTATGTTGGGAAGTGGG - Intergenic
1100733338 12:97498390-97498412 CATTTTGTAGGTGAAGAAGCGGG - Intergenic
1101047453 12:100823844-100823866 CAATGTGTATTTGATGAAATGGG + Intronic
1101279219 12:103234397-103234419 TTTTGTGAATCTGAGGAAGTGGG + Intergenic
1102298639 12:111755931-111755953 CATTTTGAATGTGAGGAAACAGG + Intronic
1102623330 12:114214439-114214461 CATTTTATATATGAGGAAGCTGG - Intergenic
1103047098 12:117745243-117745265 CATTTTGTAGGTGAGAAAATAGG - Intronic
1103142596 12:118562715-118562737 CTTTGTTCTTGTGAGGAAGTCGG + Intergenic
1103714038 12:122932775-122932797 TGTTGTGCATGGGAGGAAGTCGG - Intronic
1105267229 13:18831564-18831586 AATTGTGTATGTTAGGCAGGTGG + Intergenic
1106693983 13:32150748-32150770 CATTCTGTCAGTGAGGAAGGGGG + Intronic
1107411307 13:40161027-40161049 CATGGTGTATGTGTGCATGTGGG + Intergenic
1108266639 13:48716112-48716134 AATTTTGTATGTGATTAAGTTGG - Intergenic
1108680313 13:52774446-52774468 CTGTGTGTATATGAAGAAGTGGG + Intergenic
1109036692 13:57271705-57271727 CATTGTGAATGGGATGAAATTGG + Intergenic
1109632445 13:65068398-65068420 CACAGTGTCTGTGAAGAAGTAGG + Intergenic
1110160273 13:72368801-72368823 CATTGTGCAGGTGAGGACATGGG - Intergenic
1110966672 13:81708356-81708378 TTTTGTGTATGTGAATAAGTAGG + Intergenic
1111484959 13:88885613-88885635 CATTGTGACTGTCAGGCAGTTGG + Intergenic
1112063838 13:95769897-95769919 TAATATGTAGGTGAGGAAGTAGG + Intronic
1112234973 13:97627487-97627509 CATTGAGTAGGTGAAGAAATAGG - Intergenic
1112487737 13:99834998-99835020 CACTGTGTGTGTTAGGAAGAGGG - Intronic
1115342217 14:32304730-32304752 CATTGTGTATGTGAAAATGTGGG + Intergenic
1116072419 14:40065366-40065388 CATTGGTTATATTAGGAAGTAGG - Intergenic
1118970181 14:70629629-70629651 CATTGTGTGTGTGGGCAAGTAGG - Intergenic
1120085925 14:80272654-80272676 CATTGTCTATGTGAGGCAAGGGG + Intronic
1121713758 14:96058243-96058265 AGTTGTGTTTGTGAGTAAGTTGG - Intronic
1122017188 14:98806056-98806078 CATTCTTTCTGTGAGTAAGTGGG - Intergenic
1122104964 14:99446137-99446159 CATTTTATAAGTGAGGAAGCAGG - Intronic
1124012137 15:25847342-25847364 CATTGTTCCTGTGAGGAAATGGG - Intronic
1124836991 15:33204875-33204897 CATTGGGGAGGTGTGGAAGTGGG + Intergenic
1125102181 15:35926852-35926874 TAGTGTGTATGTGAGGGAGTAGG + Intergenic
1126882209 15:53111243-53111265 CTGAGTGTATGTGAGGCAGTGGG - Intergenic
1127626518 15:60785663-60785685 GATTATGTATTTGAGGAACTGGG - Intronic
1128411235 15:67400441-67400463 CATTGTGTATATAAGGAAAAAGG - Intronic
1128546112 15:68569048-68569070 GATTGTGTGTGTGTGGAAGCAGG - Intergenic
1128649320 15:69398954-69398976 CATTTTGCAGGTGAGGAAGGTGG - Intronic
1129777281 15:78245024-78245046 CATGGACTATATGAGGAAGTTGG - Intronic
1130292776 15:82618925-82618947 CTTTGTGTATGTGGGGCAGGGGG + Intronic
1131107789 15:89746546-89746568 CTGTGTGTATGTGTGGAGGTTGG - Intergenic
1131898667 15:97063214-97063236 CATTGTGAATGTGAAGAAAACGG + Intergenic
1132062244 15:98701936-98701958 CATTTTGCAGGTGAGGAAGATGG + Intronic
1132106735 15:99068248-99068270 CATTTTATAAGTGAGGAACTGGG + Intergenic
1133542893 16:6773405-6773427 CTATGTGTATGTGTGGGAGTTGG + Intronic
1133973248 16:10581507-10581529 CATCGTGTGTGTGTGGAAGGAGG + Intergenic
1134003129 16:10798363-10798385 CATTTTGCAGGTGAGGAAATAGG - Intronic
1134476369 16:14577575-14577597 CTTTGTGAAGGTGAGGAAGGAGG - Intronic
1135145321 16:19956831-19956853 AATTCTGTGTGTGAGCAAGTTGG + Intergenic
1135173714 16:20209652-20209674 CATTGTGAATGTGAGGTGGCAGG - Intergenic
1135665075 16:24328899-24328921 ATGTGTGTATGTGATGAAGTCGG - Intronic
1136008557 16:27347669-27347691 CAATGGGAATGTGAGGAAGGTGG - Intronic
1137378923 16:47979749-47979771 CATTGTATAGGAGAGCAAGTTGG - Intergenic
1138597464 16:58036609-58036631 CATTCTATAGGTGAGGAAGCTGG + Intronic
1139611188 16:68060103-68060125 CATTGAGTATGATAGGAAGAAGG + Intronic
1140555717 16:75918841-75918863 CACTCTGTATATGAGGAACTGGG - Intergenic
1140961487 16:79917296-79917318 CAATGTGTAACTGAGGTAGTAGG + Intergenic
1141689295 16:85587441-85587463 CAGTGTGCATGTGAGGCTGTGGG + Intergenic
1141689839 16:85590399-85590421 CATTGTGTGTGTGAACATGTGGG + Intergenic
1142906522 17:3046486-3046508 GACTGTGTATATGAGGAAGAAGG - Intergenic
1143339826 17:6202110-6202132 CACAATGTATGTGAAGAAGTTGG - Intergenic
1143556205 17:7662376-7662398 CATTGTGTGTGTGTGTGAGTTGG - Intronic
1144797600 17:17902897-17902919 CATTTTATAAGTGAGGAAATGGG + Intronic
1145020891 17:19429818-19429840 CTTTGTGTGTGTGAGAAAGCTGG - Intergenic
1145758843 17:27413694-27413716 CATTGAGTATGTGAGGAGCTAGG - Intergenic
1146219530 17:31006180-31006202 CATTGAGTATGTGAGGAGCTAGG - Intergenic
1148070500 17:44906015-44906037 CATTTTGTGTGTGAGTAAGAAGG + Intronic
1149009707 17:51843014-51843036 CATTGTGAATGTGTTGAAGTTGG + Intronic
1149033126 17:52105594-52105616 CATTTTGTAGGTGAAGAAGCGGG - Intronic
1150042319 17:61877067-61877089 CAATGTGTATTAGAAGAAGTGGG + Intronic
1150163861 17:62922950-62922972 CATTGTGTTTGTGATCAAATTGG - Intergenic
1150901981 17:69289587-69289609 CTTAATGTATGTGTGGAAGTGGG + Intronic
1151321174 17:73353366-73353388 CATTGTGTATGTTTTGAATTAGG - Intronic
1154421181 18:14229859-14229881 AATTGTGTATGTTAGGCAGGTGG - Intergenic
1155317414 18:24586343-24586365 TATTCTGTATGTGAGTCAGTTGG + Intergenic
1155783135 18:29864501-29864523 CATTCTGTAAATGAGAAAGTTGG - Intergenic
1156528387 18:37790885-37790907 AATTGGGTCTGTGAGGATGTGGG + Intergenic
1157279372 18:46335586-46335608 CATTCTGTGTATGAGGGAGTGGG - Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1159021431 18:63146221-63146243 CTTTATGTATCTGAGGGAGTGGG - Intronic
1159494752 18:69188411-69188433 CATTGTGTATGTGCGTGTGTAGG - Intergenic
1163831956 19:19551240-19551262 CCTTTTGTCTGTGAGGATGTTGG + Intergenic
1164623317 19:29710619-29710641 CATGGAGTATGAGAGGCAGTGGG + Intronic
1164893536 19:31846979-31847001 CATTGTGTTTGGGAGCAAGTAGG + Intergenic
1164999071 19:32745609-32745631 TATTGTGTATGTGTGAAAGAGGG + Intronic
1166222472 19:41374614-41374636 CATTTTGTAGGTGAAGAAATAGG + Intronic
1167538544 19:50070929-50070951 CATTGTGGATGTGTGGAAAAGGG + Intergenic
925566814 2:5263995-5264017 CATTGTGTACCTGAGCAAGATGG + Intergenic
925876419 2:8314899-8314921 TCTTGTGCATGTGAGGATGTTGG + Intergenic
927084570 2:19661752-19661774 CATTTTATAGGTGAGAAAGTGGG - Intergenic
928404945 2:31007568-31007590 CACTGTGGATGTAAAGAAGTTGG - Intronic
929335448 2:40738542-40738564 CATTGAGTAGCTGAGGAAGAAGG - Intergenic
929337540 2:40768187-40768209 AATTTTGTATGTGATGAAGTGGG - Intergenic
929652072 2:43690104-43690126 CATTCTGTAGCTGAGGAAGCAGG - Intronic
930089941 2:47524820-47524842 CACTGTATAGGTGAGGGAGTAGG + Intronic
930146583 2:48013254-48013276 CATTGTATAGGTGAGGATATTGG + Intergenic
930287614 2:49451508-49451530 CATTGTGTATTTCATGAATTGGG - Intergenic
930972815 2:57418114-57418136 CATTGTTCATGGGAGGAAGAAGG + Intergenic
931122980 2:59241206-59241228 CATTTTGTATGTGGGGAGGCGGG + Intergenic
931426065 2:62172540-62172562 TATTGAGGATGTGAGGAAATTGG - Intergenic
931848934 2:66233840-66233862 CTATGTGTATTTGAGGAAGGAGG + Intergenic
933103546 2:78290959-78290981 TGTAGTGTATGTGGGGAAGTGGG + Intergenic
936756020 2:115713514-115713536 TATTGTCTGTGTGAGGAAGGGGG + Intronic
937720936 2:125095485-125095507 CATTTTATAAGTGGGGAAGTGGG - Intergenic
938046856 2:128129320-128129342 CTTTGTGTATGTAATAAAGTAGG + Intronic
939114616 2:138046259-138046281 CATTTTATAGGTGAGGAAATTGG - Intergenic
940558650 2:155265097-155265119 CATTTTGTAATTGAGGAAGCTGG - Intergenic
940770749 2:157837061-157837083 CTTTATGTATATTAGGAAGTAGG - Intronic
941836125 2:170022586-170022608 CATTGTGGAAGTGAGGATGATGG + Intronic
942286774 2:174426264-174426286 TTTTGTGTATTTGATGAAGTAGG + Intronic
942743089 2:179202057-179202079 AATTTTGTATGTGATTAAGTTGG + Intronic
943189956 2:184663404-184663426 CACTGTGCATGGGAGGGAGTTGG + Intronic
944934755 2:204556225-204556247 GATTGTGTAGGTCAGGAATTTGG + Intronic
944970725 2:204989885-204989907 CATTGACTATGTGAAGAAGGTGG - Intronic
945590344 2:211721297-211721319 CTTTGTGTATGTGATACAGTAGG - Intronic
946353362 2:219169766-219169788 GATGGTGTGTGTGGGGAAGTAGG - Intronic
946436862 2:219662834-219662856 CAGTTTGTGTGAGAGGAAGTGGG + Intergenic
948610866 2:239166067-239166089 CATTTGGTATGTGATGAAGGTGG - Intronic
1170437053 20:16341058-16341080 CATTGTGTGTGTGTGGAGCTGGG + Intronic
1172606148 20:36215460-36215482 CTATGTGTATGTCAGGAGGTTGG - Intronic
1174765830 20:53253423-53253445 CTTAGTCTATGTGAGGAAATTGG + Intronic
1175800469 20:61798353-61798375 CATTCTGTATGTGAGGAGTGTGG - Intronic
1176345948 21:5746718-5746740 CTTTGTGTATTTGAGCAAGATGG - Intergenic
1176352762 21:5867302-5867324 CTTTGTGTATTTGAGCAAGATGG - Intergenic
1176498879 21:7577737-7577759 CTTTGTGTATTTGAGCAAGATGG + Intergenic
1176540269 21:8144788-8144810 CTTTGTGTATTTGAGCAAGATGG - Intergenic
1176559220 21:8327833-8327855 CTTTGTGTATTTGAGCAAGATGG - Intergenic
1176852294 21:13930101-13930123 AATTGTGTATGTTAGGCAGGTGG + Intergenic
1177507119 21:22033635-22033657 CATTGTGAATGACAGTAAGTGGG + Intergenic
1177682851 21:24396128-24396150 CATTGTGTATTTCAGTCAGTGGG - Intergenic
1178339504 21:31774065-31774087 CATTGTGTATGTGTGGTTTTTGG - Intergenic
1178830496 21:36052792-36052814 CATTTTGTAGGTGAGGAAACAGG + Intronic
1179915566 21:44475898-44475920 CCTTGGCTATGGGAGGAAGTGGG - Intergenic
1182299440 22:29329533-29329555 CACTGTGAATGTGTGGAAGTGGG + Intronic
1183111150 22:35649511-35649533 GATTGTGTATCTGCAGAAGTTGG + Intronic
1183711093 22:39503909-39503931 CATTTTATAAGTGAGGAAGCTGG + Intronic
1184482350 22:44755243-44755265 CAGTGTGTGTGGGAGGAAGGTGG - Intronic
1184617758 22:45649629-45649651 CATTTTGCAGGTGAGGAACTTGG + Intergenic
1203245214 22_KI270733v1_random:61156-61178 CTTTGTGTATTTGAGCAAGATGG - Intergenic
949404790 3:3702873-3702895 CATTTTCTATGTGAGGAAATGGG + Intronic
950563624 3:13750747-13750769 CATTGTGCAGATGGGGAAGTTGG - Intergenic
952277333 3:31890053-31890075 CTTTGTGAAGGTCAGGAAGTCGG + Intronic
952610192 3:35199387-35199409 GAGTGTGTGTGTGTGGAAGTTGG + Intergenic
953039655 3:39244260-39244282 CACTGTGTGTGTGATGGAGTAGG - Intergenic
954543039 3:51408593-51408615 CACTGTGCATGAGAGGCAGTAGG + Intronic
954569098 3:51625613-51625635 CATTGGGAATGTGAGGCAGAAGG + Intronic
955873055 3:63460279-63460301 CCTGGTGTATTTGAGGAACTGGG - Intronic
956024456 3:64967827-64967849 CACTGTGTAGGTGACAAAGTAGG - Intergenic
956025515 3:64978807-64978829 CATGGTCTATGGGAGGAAGAGGG - Intergenic
957069999 3:75560197-75560219 AAATGTGTATGTGAGGAAACTGG - Intergenic
957173153 3:76765823-76765845 CATTTTGTAGGTCAGGAATTGGG - Intronic
959365274 3:105450424-105450446 GTGTGTGTATGTGAGGTAGTGGG - Intronic
960747553 3:120907461-120907483 CTTTGTATATGTGAGGATGATGG + Intergenic
962184615 3:133244830-133244852 GATTGTATTTGTGAGGAAGGTGG + Intronic
963273818 3:143310957-143310979 CATTTTGGAGGTCAGGAAGTAGG + Intronic
963438197 3:145299819-145299841 AATTGAGTATGTGGGTAAGTAGG + Intergenic
965036246 3:163442146-163442168 TATTGTGTATATGCTGAAGTTGG + Intergenic
965660928 3:171041084-171041106 CATTTTGTAGGTGAGGAAACTGG + Intergenic
965744005 3:171905963-171905985 CATTGTCGTGGTGAGGAAGTTGG - Intronic
966118465 3:176494220-176494242 CATTGTATATCTTAGGGAGTTGG - Intergenic
966891909 3:184413350-184413372 GAGTGTGTATGTGAGGATGAAGG + Intronic
968233072 3:197015650-197015672 CCTTTTCTGTGTGAGGAAGTGGG - Intronic
968562492 4:1291703-1291725 CATTGTGTATTGAAGGAACTAGG + Intronic
968709220 4:2100870-2100892 TTTTGTGTATGATAGGAAGTAGG - Intronic
968858286 4:3145878-3145900 CAGTCTGTATGTGAGGAAGGTGG - Intronic
969147347 4:5135787-5135809 TTTTGTGTATGTGAGGAAAGGGG - Intronic
969175437 4:5395357-5395379 CATTTTGCAGATGAGGAAGTAGG - Intronic
969995866 4:11312569-11312591 GATTGTGTTGGTGAGGAATTTGG + Intergenic
970029633 4:11660261-11660283 GATCGTTTATGTGAGCAAGTTGG - Intergenic
970810676 4:20089784-20089806 CATTTTGTATGTGCTGAATTTGG - Intergenic
970898676 4:21133227-21133249 CATTGTGTATGTGAGGAAGTAGG - Intronic
971646946 4:29218800-29218822 CATTTTGTAAATGAGGAAATTGG + Intergenic
976087318 4:81419692-81419714 CATAGAGCATGTTAGGAAGTAGG + Intergenic
976452161 4:85202876-85202898 CATTCTACATGCGAGGAAGTGGG - Intergenic
977622302 4:99151154-99151176 AATTTTGTATGTGATTAAGTTGG + Intronic
978097277 4:104793368-104793390 CATTGTGTCTGGCAGGAAGGTGG + Intergenic
978378510 4:108101471-108101493 CATTGTGAATCTCAGGAAGAGGG + Intronic
979351788 4:119651781-119651803 CATTTTATAAATGAGGAAGTAGG + Intergenic
980974177 4:139595290-139595312 TAGTGTGTATCTGAGGGAGTTGG + Intronic
981904136 4:149901266-149901288 CATTTTATAGATGAGGAAGTTGG - Intergenic
982435319 4:155378360-155378382 CACTGAGTATGTGAGGACCTAGG - Intergenic
983378157 4:166956723-166956745 CGTTGGGTATGAGAGGGAGTGGG - Intronic
983792069 4:171811963-171811985 CATAGTGTATGTGTGGGGGTGGG + Intergenic
985234019 4:187852862-187852884 TGTTGTGTATGTGTGGAAGGAGG - Intergenic
986051166 5:4091693-4091715 CATTGTGGAAGTGAAGAAGTGGG + Intergenic
988001512 5:25355484-25355506 GTTTGTGTATGTTAGGAAGTGGG + Intergenic
988700733 5:33672036-33672058 GAGTGTGTATGTGAGTATGTGGG - Intronic
988808531 5:34762705-34762727 CATGGTGGATGTGAGGAAGTGGG + Intronic
989651250 5:43692947-43692969 CTTTGAGTATGTGAGAAAGAAGG - Intronic
992044764 5:72875707-72875729 TATTATGCATGTGAGGAAGCAGG - Exonic
992920087 5:81506288-81506310 GATAGTGGAGGTGAGGAAGTTGG - Intronic
994013878 5:94942189-94942211 CACTGGGTAAGTGAGGAAGATGG + Intronic
995046262 5:107651997-107652019 CCTCGTGTATGTGTGGGAGTAGG + Intronic
995273687 5:110253051-110253073 TATTGTGTTTGTAAGGAAGTTGG - Intergenic
996469748 5:123845756-123845778 CAGTGTGTATGTGTGTGAGTGGG - Intergenic
996600465 5:125256721-125256743 CATTCTGTTTGTGAAGATGTGGG - Intergenic
997526212 5:134554943-134554965 CATTTTATAGATGAGGAAGTCGG + Intronic
997888111 5:137649691-137649713 CATTTTGCAGATGAGGAAGTTGG - Intronic
998157210 5:139793872-139793894 CATTGGGCAGATGAGGAAGTAGG + Intergenic
998298700 5:140997106-140997128 CATTGTGTATGTGGGAGAGCAGG - Intronic
998374817 5:141683200-141683222 CTGTTTGTATGAGAGGAAGTTGG + Intergenic
998555134 5:143115765-143115787 CATTTTATATGTGAGGAAACAGG + Intronic
999137871 5:149334986-149335008 CATTTTATAGGTGAGGAAATGGG - Intronic
1000017894 5:157294563-157294585 CATTGTGTATGTGAGTCATCTGG + Intronic
1000678050 5:164146924-164146946 CATTTTGCATTTGAGGAAATTGG + Intergenic
1001937740 5:175717488-175717510 TATTGTGTATGAGAGGTAGAGGG + Intergenic
1004082795 6:12411914-12411936 CATTTTGTATATGAGGAAACTGG - Intergenic
1005219084 6:23565444-23565466 CAATGTGTATGAAAGGAATTAGG - Intergenic
1006259594 6:32856596-32856618 CATTTTGCATGTGAGGAAATTGG - Intronic
1006306929 6:33228202-33228224 CATTTTGTAGGTGAGGAAATTGG - Intergenic
1006375934 6:33671583-33671605 CATCGTGTGTGTGAGGAGGAGGG + Intronic
1007100141 6:39240424-39240446 CATTTTGCATGTGAGGAAACAGG + Intergenic
1007364993 6:41385032-41385054 CTGTGTGTATGTGGGGAAGGGGG - Intergenic
1007804426 6:44429409-44429431 TATTGTGTGTGTGAGAAACTAGG - Intronic
1010095954 6:72046276-72046298 CATTGTGTGTGTGTGGAAAGGGG + Intronic
1010498181 6:76561662-76561684 CACTTGGTATGTGAGGAAATGGG + Intergenic
1010775043 6:79875799-79875821 CAGTGTGTGTGTGGGAAAGTGGG - Intergenic
1012526380 6:100182813-100182835 CATTGTGTGTGTGTGGCAGGGGG - Intergenic
1012580343 6:100861264-100861286 CATTTTGTATGTGAAGAAACAGG - Intronic
1014965555 6:127743735-127743757 CATTGTGTACCTCAGGAATTTGG - Intronic
1016641755 6:146357717-146357739 CATGGTATCTGTGAGGAGGTTGG + Intronic
1016935216 6:149444784-149444806 CATTGTGTCTGTCAGCTAGTTGG + Intergenic
1017182795 6:151569916-151569938 AATGGTGTCTGTGAGCAAGTTGG - Intronic
1018146219 6:160891838-160891860 CATTTTGTATTATAGGAAGTTGG - Intergenic
1019347676 7:538738-538760 CATTGGGTTGGTGAGGAAGTGGG - Intergenic
1022316854 7:29253508-29253530 CATTCTGTTTGTGAGGAAGCAGG + Intronic
1023362485 7:39430903-39430925 CATTGTGCATGTGTGGAAAGGGG + Intronic
1023990363 7:45124937-45124959 CATTTTATAAATGAGGAAGTTGG + Intergenic
1024475614 7:49805664-49805686 CATTGTTTATGTGGGGAGGCAGG - Intronic
1024779924 7:52836129-52836151 CAGTTAGTATGTGAGGATGTGGG - Intergenic
1024999840 7:55306711-55306733 CATTCTGCATTTGAGCAAGTGGG + Intergenic
1027570765 7:79863821-79863843 CATTGTATATGTTAGTACGTAGG + Intergenic
1027570937 7:79865854-79865876 CATTGTATATGTTAGTAAGTAGG - Intergenic
1028283254 7:88960400-88960422 AAATGTGTATGTGCGGGAGTGGG + Intronic
1029233479 7:99091591-99091613 CATTTTGTTTGTGAGGGAGGTGG - Intronic
1032171256 7:129586466-129586488 CATGGGGTATGTGACTAAGTTGG - Intergenic
1032367353 7:131312493-131312515 AATTTTGTATGTGATAAAGTTGG - Intronic
1034859154 7:154581420-154581442 CAGGGTGTGTGGGAGGAAGTGGG - Intronic
1036078999 8:5532663-5532685 GACTGTGTGTGTGAGGTAGTTGG - Intergenic
1037238640 8:16751938-16751960 CATGGTGTATGTGGAGAAATAGG - Intergenic
1038327707 8:26585050-26585072 CATTTTGTTTTTGAGGAGGTGGG + Intronic
1038841724 8:31190518-31190540 CATTCTGTCTGTGAGGCTGTGGG - Intergenic
1040816634 8:51514910-51514932 CAATGTGTATGTTATGAAATGGG - Intronic
1042857400 8:73281513-73281535 CATGGTCTATGGGAGGTAGTGGG + Intergenic
1044434457 8:92145903-92145925 CAGTGTGTATGTGTGGGAGTGGG + Intergenic
1044755405 8:95456654-95456676 AATTGTGTCTGTCAGAAAGTTGG + Intergenic
1046478595 8:114782991-114783013 CATTTTGTAGGTGAGAATGTGGG - Intergenic
1048178812 8:132176879-132176901 CAATGTGTATGTGATGCTGTGGG - Intronic
1048305715 8:133283173-133283195 CATTTTGTAGAGGAGGAAGTTGG - Intronic
1048395200 8:134007690-134007712 CATTGTGCACATGAGGAAGCAGG - Intergenic
1048522204 8:135167056-135167078 CATTGTGTATGGGAGGGTGTGGG + Intergenic
1048846412 8:138607015-138607037 CATTATGTTTGCTAGGAAGTTGG + Intronic
1050181615 9:2928811-2928833 CATTGTGTGTGTCAGGGGGTTGG + Intergenic
1051870585 9:21733072-21733094 AACCGTGTATGTTAGGAAGTTGG - Intergenic
1052965213 9:34335375-34335397 CACTGTGTATCTTTGGAAGTTGG - Intronic
1054361170 9:64121900-64121922 AATTGTGTATGTTAGGCAGGTGG - Intergenic
1054753322 9:68930668-68930690 CAGTGTGTGTGTGTGGAAATTGG - Intronic
1057636255 9:96770734-96770756 GATTGTGTATGTCAGGATGGGGG + Intronic
1057789258 9:98112478-98112500 CATTTTGTATGTGATCAAATTGG + Intronic
1059143805 9:111878902-111878924 TATTGTGTATGTGAATCAGTTGG - Intergenic
1059506378 9:114803300-114803322 CATTGTGTATGTTAGAAATGTGG - Intronic
1059967517 9:119629942-119629964 CATTGTGTATGTGTGTATGGTGG - Intergenic
1203461548 Un_GL000220v1:44225-44247 CTTTGTGTATTTGAGCAAGATGG - Intergenic
1187384513 X:18835349-18835371 AATTTTGTATGTGATCAAGTTGG + Intergenic
1189536821 X:41943809-41943831 AATTGTATATGTGATGAAATGGG + Intergenic
1191176657 X:57509895-57509917 ACTTCTGTATGTGAGCAAGTTGG + Intergenic
1192302127 X:69916106-69916128 CATTTTGTAGATGTGGAAGTTGG - Intronic
1193809020 X:86029571-86029593 TATTATCTATGTGAGGAAATAGG + Intronic
1194102661 X:89725807-89725829 CATTGTATATGTGATAAAGAAGG - Intergenic
1194240670 X:91443478-91443500 CTTTGTGTTTGTAAGGAAATTGG + Intergenic
1194442546 X:93950614-93950636 CAATGTGTAAGTGAGAATGTGGG + Intergenic
1195419852 X:104662512-104662534 CATTCTTTATGTCAGGAAATTGG + Intronic
1196961041 X:121001777-121001799 AATTTTGTATGTGATCAAGTTGG - Intergenic
1197019052 X:121664187-121664209 CATGGTGTATGTGGGGCAGTGGG + Intergenic
1197339070 X:125243761-125243783 CTTTCTGTAGGTGTGGAAGTAGG + Intergenic
1197724196 X:129765510-129765532 TAGTGAGTATGTGAGGAAATGGG - Intronic
1199242330 X:145561895-145561917 CATTGTTTATGTGGAGAAATTGG - Intergenic