ID: 970903434

View in Genome Browser
Species Human (GRCh38)
Location 4:21186933-21186955
Sequence TTAAATAAAAAGATTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1321
Summary {0: 1, 1: 1, 2: 8, 3: 97, 4: 1214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970903434_970903436 -6 Left 970903434 4:21186933-21186955 CCCAGCTCAATCTTTTTATTTAA 0: 1
1: 1
2: 8
3: 97
4: 1214
Right 970903436 4:21186950-21186972 ATTTAATAGCCCAACTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970903434 Original CRISPR TTAAATAAAAAGATTGAGCT GGG (reversed) Intronic
900968086 1:5973424-5973446 CAAAATAAAAACATTTAGCTGGG + Intronic
901426960 1:9188174-9188196 TTAAAAAAAAAAAAAGAGCTGGG - Intergenic
901603690 1:10442511-10442533 TAAAATAAAAAGGCTGGGCTAGG + Exonic
901616710 1:10546043-10546065 TCAAAAAAAAAGATTGAGGAGGG + Intronic
901919612 1:12526754-12526776 TTAAAAAAAAAAAATGAGCTGGG + Intergenic
902154318 1:14471741-14471763 TTAAATAGGAAGAGAGAGCTAGG + Intergenic
902593601 1:17492889-17492911 TTAAATTAAAAGATTTAAATTGG - Intergenic
902982322 1:20133774-20133796 AAAAAAAAAAAGAATGAGCTGGG - Intergenic
903368909 1:22822309-22822331 TTAAATTAAAAAATAGAGATGGG - Intronic
903643644 1:24877157-24877179 AAAAATAAAAAAATTTAGCTGGG - Intergenic
903894208 1:26592418-26592440 TTAAAACAAAAACTTGAGCTGGG - Intergenic
903991687 1:27275633-27275655 ATAAAGAAAAAGATGGAGCGGGG + Intronic
903994140 1:27294801-27294823 TGAAATAAAAAGACTGAGCTAGG - Intronic
904112616 1:28138296-28138318 TTAAAAAAAAAAAATTAGCTGGG - Intergenic
904502832 1:30926190-30926212 TTTAATAAGAATATTAAGCTAGG - Intergenic
904520525 1:31091901-31091923 TAAAATAAAATGCATGAGCTGGG + Intergenic
904779836 1:32937546-32937568 TAAAATAAAAAAAATTAGCTGGG + Intronic
904979680 1:34487833-34487855 TCAAATTAAAAGATTGTGATAGG - Intergenic
905063559 1:35160298-35160320 TTAAAAAAAAAAATAGAGCCAGG + Intergenic
905606316 1:39303554-39303576 AAAAAAAAAAAGATTGGGCTGGG + Intronic
905685511 1:39904663-39904685 TTAAAAAAAAAAAATTAGCTAGG - Intergenic
905792582 1:40798077-40798099 TTCAAGAAAAAGACAGAGCTGGG - Intronic
905802150 1:40851265-40851287 TTAAATAAAAAGAACCAGGTAGG - Intergenic
906435599 1:45793779-45793801 TTAAAAAAAAAGGTTGATATGGG - Intronic
906474601 1:46160449-46160471 TTAAAAAGACAGTTTGAGCTAGG - Intronic
906998085 1:50819464-50819486 TTAAAAAAAAAAAATTAGCTAGG + Intronic
907111952 1:51934613-51934635 TTAAAAAAAAAAAATTAGCTGGG + Intronic
907181469 1:52574000-52574022 TAAAATAAAAATATTGGGCCGGG + Intergenic
907419603 1:54337956-54337978 ATAAATTAAAAGATAGAGATGGG - Intronic
907592722 1:55691110-55691132 TTAATTAAAAGGTTTGGGCTGGG + Intergenic
908228576 1:62081408-62081430 GTAAATAAAAAGATTGACTCAGG + Intronic
908271371 1:62425635-62425657 TAAAAAAAAAAAATTTAGCTGGG + Intergenic
908310079 1:62872189-62872211 TTAAAAATAAAGACTGGGCTGGG - Intergenic
908335294 1:63116494-63116516 GTAATTAAAAATATTGAGTTAGG - Intergenic
908535410 1:65072117-65072139 TTAAAAAAAAAAAATTAGCTGGG + Intergenic
908942875 1:69457236-69457258 TTAAAGAACAAAGTTGAGCTAGG - Intergenic
909050446 1:70761459-70761481 TTAAATATAAACATTTAGATTGG - Intergenic
910230515 1:84982306-84982328 TAAAATAAAAAAATAGAGATGGG + Intronic
910277180 1:85462313-85462335 TTAGATAAACCCATTGAGCTGGG - Intronic
910624477 1:89291908-89291930 TCAAATTGAAAGATGGAGCTGGG + Intergenic
910840672 1:91558254-91558276 TTAAATAAAAAGAATGAATAAGG - Intergenic
911121919 1:94304878-94304900 GGAAATGAAAAGATTGAGCCTGG + Intergenic
911192512 1:94961783-94961805 TTAAAAAAAAAAAATTAGCTGGG + Intergenic
911283902 1:95966214-95966236 TTAAATTAAAAGATTTAAATTGG - Intergenic
911991836 1:104707863-104707885 TTAAAAAAAAAAAATTAGCTGGG - Intergenic
912349570 1:108998936-108998958 TTAAACAAAAATATTGGGCCAGG + Intronic
912532533 1:110336820-110336842 TGAAATAAAAAGTTATAGCTGGG - Intergenic
912545089 1:110445065-110445087 TTAATTAAAAAAATGGAGATAGG + Intergenic
913443829 1:118928352-118928374 TTAAATAAAAATTGTGAGGTAGG - Intronic
913669622 1:121084252-121084274 AAAAATAAAAAGAATTAGCTGGG - Intergenic
914021380 1:143871651-143871673 AAAAATAAAAAGAATTAGCTGGG - Intergenic
914248020 1:145900250-145900272 ATAAATAAAAAGAAAGAGCAAGG - Intronic
914340582 1:146756417-146756439 CTATTTAAAAAGAATGAGCTAGG + Intergenic
914659870 1:149779569-149779591 AAAAATAAAAAGAATTAGCTGGG - Intergenic
914746036 1:150501827-150501849 ATAAATAAAAAGATAGAGAAAGG + Intronic
914784039 1:150812115-150812137 TAAAAGAAAAAGATTAAGTTTGG + Intronic
914826549 1:151141705-151141727 TTAAAAAAAAAAAGTCAGCTGGG - Intronic
914828026 1:151149588-151149610 TAAAATAAAAAGAATTAGCCGGG + Intergenic
914837458 1:151219531-151219553 TTAAAAAAAAAAAATTAGCTGGG + Intronic
914912154 1:151796311-151796333 TTAAGTAGGAAGATAGAGCTGGG - Intergenic
914960473 1:152201852-152201874 TTAAATAAAAAATAAGAGCTGGG - Intergenic
915186101 1:154106279-154106301 ATAAATAAAAAGATTGGGAAGGG + Intronic
915257180 1:154642802-154642824 TAAAATAAAAAGAATGAGTTTGG - Intergenic
915409582 1:155689616-155689638 TGAAATAATAAGATAGGGCTGGG + Intronic
915459851 1:156063444-156063466 TTGTAAAAAAACATTGAGCTGGG - Intronic
915548997 1:156621401-156621423 TTAAAAAAAAAAATTGGACTGGG - Intronic
915573902 1:156762405-156762427 AAAAATAAAAAAATTTAGCTGGG + Intronic
915587270 1:156850850-156850872 TAAAATAAAAAGAATGAGCCAGG - Intronic
915971117 1:160355973-160355995 GTAAATAGAAAGAAGGAGCTAGG - Intronic
916034862 1:160912828-160912850 TTTATTAAAAAAATTGAGATGGG - Intergenic
916141455 1:161702837-161702859 TAAAACAAAAAGATGGAGATAGG + Intergenic
916332731 1:163635965-163635987 TTAAATATAAAGATTCAGGTAGG - Intergenic
916338104 1:163695794-163695816 TTAGATAAAAATATTGGGCCAGG - Intergenic
916733339 1:167585499-167585521 TAAAATAAAAAAAATTAGCTGGG + Intergenic
916756966 1:167780360-167780382 TTAAATAAAAAGATCCAGGTAGG + Intronic
916797974 1:168185607-168185629 TTAAAAAAAAAAAATTAGCTGGG + Intronic
916869892 1:168902352-168902374 TTATATAAACAGATTGGGGTTGG + Intergenic
916994874 1:170285783-170285805 TTAAAAAAAAAAAATGACCTTGG + Intergenic
917769653 1:178263724-178263746 TTAAAAAAAAAAATTGAGACAGG + Intronic
917938069 1:179888825-179888847 TTAAATAAAAACATTAATGTGGG - Intronic
917953427 1:180065615-180065637 TTAAAAAAAAAAAATTAGCTGGG + Intronic
918055014 1:181013477-181013499 ATAAATAAAAAAAATTAGCTTGG - Intronic
918244738 1:182648937-182648959 CTAAATACAAAGAATTAGCTGGG + Intronic
918732483 1:188015363-188015385 TTACTTAAAATAATTGAGCTTGG + Intergenic
919053212 1:192537184-192537206 ATAAATAAATAAATTGAGGTGGG - Intergenic
919054782 1:192556362-192556384 TTAGAAAAAAAGATTGAGCATGG + Intergenic
919140387 1:193563066-193563088 TTAAAAAAATATATTAAGCTGGG - Intergenic
919545718 1:198915661-198915683 TTAAATAAAGAAATAAAGCTAGG + Intergenic
919596798 1:199574419-199574441 GTATATAAAAAGTGTGAGCTGGG + Intergenic
919816255 1:201442293-201442315 TTAAAAAAAAAAAATTAGCTAGG + Intergenic
919890989 1:201974472-201974494 TTAAAAAAAAAAAATTAGCTGGG - Intergenic
919965142 1:202515712-202515734 AAAAATAAAAAGAATTAGCTGGG - Intronic
920370404 1:205475443-205475465 TAAAATAAGAAGTATGAGCTTGG + Intergenic
920979722 1:210821995-210822017 ATAAATGAAGAGATAGAGCTGGG - Intronic
921164021 1:212493375-212493397 TTAATTAAAAAAATAGAGATGGG + Intergenic
921552871 1:216560028-216560050 TTAAATAAAAACATTCAGTTAGG - Intronic
922125279 1:222714873-222714895 TAAAATGAAAACATTGGGCTGGG - Intronic
922165646 1:223113628-223113650 TAAAATAAAAATATAGAGATGGG + Intronic
922641662 1:227238180-227238202 TTAAAAAAAAAAATAGAGATGGG - Intronic
922678103 1:227565515-227565537 TAAAATAAAAAGAATTAGCTGGG - Intronic
922788569 1:228296431-228296453 TTAAAAAAAAAGGTAGAGATGGG - Intronic
923057344 1:230436964-230436986 TGAAATATAAAGATTGAGCTGGG + Intergenic
923156951 1:231287614-231287636 TAAAATACAAAAATTTAGCTGGG + Intergenic
923814222 1:237357888-237357910 TATAATAAAAAGATTCTGCTGGG + Intronic
923944735 1:238871583-238871605 TTAAATAAAAAGTTTAGGCCGGG - Intergenic
924113653 1:240724969-240724991 TTAAAAAATAAAATTTAGCTGGG + Intergenic
924418123 1:243880625-243880647 TTAAAGGAAATGATTTAGCTGGG - Intergenic
924468816 1:244321586-244321608 TTAAATAGAAAGATTGAGGCCGG - Intergenic
924498279 1:244611432-244611454 TTAAAAAAAAAAAATGAGCTGGG + Intronic
924681240 1:246236388-246236410 TTAAATAAAAAAAGTTAGCCAGG - Intronic
924755041 1:246932664-246932686 TTGACTAAAAAGATTAGGCTAGG - Intergenic
1062767244 10:75176-75198 TTAAAAAAAAAAATTTGGCTGGG - Intergenic
1062983102 10:1742170-1742192 TAAAATAAAAAGACAGTGCTTGG + Intergenic
1063084062 10:2798936-2798958 TAAAATAAAAAGAATGAAATAGG - Intergenic
1063471025 10:6285526-6285548 TTAAGTAAAGAGATTGAGCTGGG - Intergenic
1063694695 10:8322438-8322460 TAGAATAAAAATAATGAGCTTGG - Intergenic
1064540584 10:16401397-16401419 TTAAATAAAAACATTATACTTGG - Intergenic
1064566712 10:16647131-16647153 TAAAATATAAAAAATGAGCTGGG - Intronic
1064734992 10:18372968-18372990 TAAAATAAAAAAAATAAGCTGGG - Intronic
1064877782 10:20014510-20014532 TGAAATAAACAGATTTACCTTGG - Intronic
1065129923 10:22610195-22610217 TTAAAAATAAAGATTGGGGTGGG + Intronic
1065372183 10:24998533-24998555 TAAAATAAAAAAAATTAGCTAGG - Intronic
1065586913 10:27227871-27227893 TAAAATACAAAAATTTAGCTGGG - Intronic
1065666028 10:28062209-28062231 TAAAACAAAAAGATTAGGCTGGG + Intronic
1065715088 10:28558957-28558979 TTATATTAACAAATTGAGCTGGG - Intronic
1065744418 10:28826672-28826694 ATAAATAAAAAGAGTGAATTGGG - Intergenic
1065826848 10:29580174-29580196 TAAAAAAAAAAAATTTAGCTGGG + Intronic
1066107488 10:32168483-32168505 TTAAAAAAAAAAATAGAGATGGG - Intergenic
1066312988 10:34216180-34216202 TTGCATACAAATATTGAGCTGGG - Intronic
1067117823 10:43448833-43448855 AAAAATAAAAAAAATGAGCTGGG + Intronic
1068091051 10:52432475-52432497 TTGAATAAAAACATAAAGCTTGG + Intergenic
1068590053 10:58844168-58844190 TTAAAAAAAAAAAATTAGCTAGG + Intergenic
1069011436 10:63377733-63377755 TCAAAAAAAAAAATTTAGCTAGG + Intronic
1069539465 10:69282819-69282841 TAAAACAAAATGAATGAGCTGGG + Intronic
1069967937 10:72137068-72137090 TTAAAAAAAAAAAATTAGCTGGG - Intronic
1070189109 10:74095293-74095315 TTAAATAAAAAGAACTGGCTGGG + Intronic
1070206234 10:74265374-74265396 TAAAATAAAAACAATTAGCTGGG - Intronic
1070452178 10:76571366-76571388 TTAAATATGAAGATAGGGCTGGG - Intergenic
1070467751 10:76741519-76741541 ATAAATATAAAGATTGAAGTTGG + Intergenic
1070566024 10:77604557-77604579 TTAATTAAAAAAAATTAGCTGGG + Intronic
1071032331 10:81199548-81199570 TTAATTAAAAAATTTGAGCCGGG + Intergenic
1071042151 10:81324414-81324436 TTGAATTAAAATATTAAGCTAGG + Intergenic
1071219284 10:83444936-83444958 TTGCATAAAAAGATTGGGGTGGG - Intergenic
1071302734 10:84268818-84268840 TAAAATAAAAATCTTGAGTTGGG + Intergenic
1071347112 10:84703231-84703253 TGAAATAAAAACATTGAACATGG + Intergenic
1071545483 10:86525800-86525822 TAAAATACAAAAAATGAGCTGGG - Intergenic
1071703185 10:87964734-87964756 TTAAAAAATAAAATTGAGGTTGG + Intronic
1071846729 10:89528199-89528221 TTAAATAAAAAGGGTTATCTTGG - Intronic
1072091417 10:92131500-92131522 GAAAATAAAAATATTTAGCTTGG + Intronic
1072111545 10:92325343-92325365 TTAAATAAAAAGAGAGAGAGTGG + Intronic
1072128319 10:92467227-92467249 TAAAATAAAAAAAATTAGCTGGG - Intronic
1072180728 10:92976839-92976861 TTAAAAAAAAAGATACAGCAAGG + Intronic
1072194152 10:93101295-93101317 TAAAATAAAAAGTCTGGGCTTGG - Intergenic
1072459545 10:95606558-95606580 TTAAAAAAAAAGGGTGAGCTGGG + Exonic
1072727360 10:97822667-97822689 TAAAATGAAAAGGTTGAACTAGG + Intergenic
1072912667 10:99517862-99517884 TTAAATAAAAAGCTAGAAATAGG - Intergenic
1073189661 10:101642377-101642399 TTAAAAAAAAAAATAGAGATAGG - Intronic
1073351099 10:102820536-102820558 TTAAATTAAAATATTTTGCTAGG - Intergenic
1073551234 10:104403618-104403640 TTATATAAAAAGTTGGAGTTAGG - Intronic
1074064758 10:110004236-110004258 TTAAAAAAAAAAATTGAGGCCGG + Intronic
1074084249 10:110195640-110195662 TTAAAAAAAAAAATTGAGACAGG - Intergenic
1074106187 10:110391518-110391540 TTAAGTAAAAACATGGTGCTGGG + Intergenic
1074632830 10:115277582-115277604 CAAAACAAAAAGATTGAGGTGGG + Intronic
1074694840 10:116040894-116040916 TTATGTAAAAAGATTCAGTTCGG + Intergenic
1074849841 10:117430930-117430952 TAAAATAAAAATAATTAGCTGGG - Intergenic
1075094172 10:119460367-119460389 ATAAATAAATAGAATGAGCAGGG + Intergenic
1075330776 10:121572456-121572478 TTAAATATAAAAAATTAGCTGGG + Intronic
1075434802 10:122429246-122429268 TTAAATAAAATGATACAGCTGGG + Intronic
1075565885 10:123503893-123503915 AAAAATAAAAAAAATGAGCTGGG - Intergenic
1075656366 10:124163892-124163914 ATAATTAAAGAGATAGAGCTTGG - Intergenic
1075755244 10:124806003-124806025 TTAAAGAAAAAGGTTCGGCTGGG + Intronic
1075825481 10:125354109-125354131 TGAAATAAAAGGATTGAAATAGG + Intergenic
1076095137 10:127727613-127727635 TTAAATAAAAAATTTGAGGTGGG + Intergenic
1076626045 10:131822661-131822683 CTTGATAAAAAGACTGAGCTCGG + Intergenic
1077033550 11:482001-482023 TTAAAAAAAAAAAATTAGCTGGG - Intronic
1077656403 11:4023166-4023188 TGAAATACAAAGAGTTAGCTGGG + Intronic
1078256908 11:9665879-9665901 TTTAATAAATAGATGTAGCTGGG + Intronic
1078257285 11:9669523-9669545 TTAAATAAATAAATTAGGCTGGG - Intronic
1079172379 11:18108665-18108687 ATAAATAAAAGAAATGAGCTGGG - Intergenic
1079985824 11:27199743-27199765 TCTAATCAAGAGATTGAGCTGGG - Intergenic
1080198340 11:29638060-29638082 TTAACTAAAATGATGAAGCTTGG - Intergenic
1080198376 11:29638529-29638551 TTAAATAAAGTCATTCAGCTTGG - Intergenic
1080274088 11:30484388-30484410 TTAAATATAAAAAATCAGCTTGG - Intronic
1080606190 11:33866804-33866826 TAAAATAAAAAAAATTAGCTGGG - Intronic
1080662130 11:34305185-34305207 TTAAATCAAAACATTAAGCTAGG + Intronic
1080808650 11:35680499-35680521 GCAAATAAAAAGAATGAGGTAGG - Intronic
1081472449 11:43388541-43388563 TTAAAAAAAAAATCTGAGCTGGG + Intronic
1081528046 11:43940514-43940536 TTAAAAAAAAAAAGTTAGCTAGG - Intronic
1081838154 11:46174959-46174981 AAAAATAAAAAAAATGAGCTTGG - Intergenic
1081897435 11:46598725-46598747 TTAAAAAAAAAGTTTAGGCTGGG + Intergenic
1081932809 11:46884306-46884328 TAAAATAAAAATATTCAGCCGGG + Intronic
1082048330 11:47748940-47748962 TAAAATAATATAATTGAGCTTGG - Intronic
1082214589 11:49553263-49553285 TTAAGTAAGAATGTTGAGCTGGG - Intergenic
1082632072 11:55555304-55555326 GTAAATCAAAGGATTGAGCAAGG - Exonic
1082932339 11:58621706-58621728 TTAAAATAAGAGAATGAGCTGGG - Intronic
1082948924 11:58789565-58789587 TTAAAATAAAAGTTTCAGCTGGG + Intergenic
1083030046 11:59584104-59584126 AAAAATAAAAAAATTTAGCTGGG - Intronic
1083116703 11:60467169-60467191 TTAAAAAAAAAAATTGGTCTTGG + Intronic
1084132597 11:67148258-67148280 TTAAAAAAAAAAATTTAGCTGGG + Intronic
1084525663 11:69696370-69696392 TAAAAAAAAAAAAATGAGCTGGG + Intergenic
1084766956 11:71317574-71317596 TTAAATATAAAGACCCAGCTAGG - Intergenic
1084853943 11:71968218-71968240 TAAAATACAAAGAGTTAGCTAGG - Intronic
1085094274 11:73746607-73746629 AAAAATAAAAAAATTTAGCTGGG + Intronic
1085173897 11:74470384-74470406 TTAAAAAAAAAAAATTAGCTGGG + Intergenic
1085595742 11:77808036-77808058 TTAAATAAAAAAATTAGGCTGGG + Intronic
1085596121 11:77811881-77811903 ATAAATAAATAGGCTGAGCTTGG + Intronic
1085723807 11:78936350-78936372 TTCAATAAAAACACTGAACTTGG - Intronic
1086378227 11:86223281-86223303 CTAAATGAAAAGAGTGAGGTAGG + Intergenic
1086634999 11:89071196-89071218 TTAAGTAAGAATGTTGAGCTGGG + Intergenic
1086843342 11:91717142-91717164 TACAATAACAAGATTTAGCTTGG + Intergenic
1086855004 11:91855471-91855493 TTTAATATAAAAATTCAGCTGGG - Intergenic
1087015803 11:93553618-93553640 TTGAATAACAAGATCTAGCTTGG - Intergenic
1087246798 11:95848416-95848438 TTAAATAAAAAGACAGAACAAGG + Intronic
1087592797 11:100213531-100213553 TTAAATAACAAGTCTTAGCTAGG - Intronic
1088038502 11:105348251-105348273 TAACATAAAAAAATTAAGCTAGG + Intergenic
1088056946 11:105594820-105594842 TTAAATATAAAAACAGAGCTAGG + Intergenic
1088252058 11:107869551-107869573 TTAAATAATAAGGTTAGGCTGGG - Intronic
1088273539 11:108060191-108060213 TTAAAAAAAAAAATTAAGCTTGG + Intronic
1088485365 11:110335264-110335286 TTAAAAAAAAAAAATCAGCTGGG + Intergenic
1088510850 11:110573380-110573402 TAAAATAAAAAGATTTATGTAGG - Intergenic
1088516502 11:110641046-110641068 TTAGATAAACAGAGTGAGCAAGG + Intronic
1088669256 11:112125717-112125739 TTAAATTAAAAAAATTAGCTGGG - Intronic
1088863758 11:113826468-113826490 TTAAAAAAAAAAAATTAGCTGGG - Intronic
1088927556 11:114317702-114317724 TCAAAAAAAAATGTTGAGCTAGG + Intergenic
1088952558 11:114586398-114586420 TGAAATAAAAAGAAGGAGTTGGG - Intronic
1088963691 11:114696401-114696423 TTAAATACAAAGATATAGGTAGG + Intronic
1089233966 11:117006861-117006883 TTTAATAACAAGATTAATCTGGG - Intronic
1089273853 11:117320058-117320080 TCAAAAAAAAAAATTTAGCTAGG + Intronic
1089592947 11:119556479-119556501 ACAAAAAAAAAGATTAAGCTGGG + Intergenic
1089627110 11:119758282-119758304 TTCAGAAAAAAGACTGAGCTGGG - Intergenic
1089820699 11:121223463-121223485 TTAAAGCAAGAGATTGAGTTGGG - Intergenic
1089852243 11:121509456-121509478 TTAAATAAATAAATTCATCTAGG - Intronic
1090006657 11:123008620-123008642 TTAAGTAAGAATCTTGAGCTGGG + Intergenic
1090046991 11:123344361-123344383 TTAGTTAAAGAGACTGAGCTGGG - Intergenic
1090131684 11:124148804-124148826 TTAAATAAAAAGACTCATATAGG - Intergenic
1090282830 11:125471383-125471405 TTAAATAAAAAGACAGAGATAGG + Intronic
1090720077 11:129463938-129463960 TTCAATAAATAGATGGTGCTGGG + Intergenic
1090738506 11:129634015-129634037 TTAAAAAAAAAAAATTAGCTGGG + Intergenic
1091458561 12:626788-626810 TTAAATAAAATAACTTAGCTTGG + Intronic
1092108170 12:5938902-5938924 TTAAAAAAAAATATTGGCCTTGG - Intronic
1092356207 12:7797516-7797538 CTAAATACAAAGAATTAGCTGGG - Exonic
1092550817 12:9497479-9497501 TTAATTAAAAAGGTTGAAATAGG - Intergenic
1092935141 12:13354953-13354975 TTAAAAGAAAAGATAGAGCCAGG + Intergenic
1092977231 12:13757098-13757120 CAAAATAAAATGGTTGAGCTGGG - Intronic
1093009289 12:14087700-14087722 TTAATTAAAAAGTTTGGGCCGGG - Intergenic
1093213655 12:16337214-16337236 TTAAAAAAATATATTGTGCTTGG + Intergenic
1093301463 12:17463481-17463503 TGTAATAAAAAGAGTGGGCTTGG - Intergenic
1093379738 12:18478130-18478152 TTTAAAAAAAGGACTGAGCTGGG + Intronic
1093853266 12:24067225-24067247 TCAAATAAAAATAAAGAGCTGGG + Intergenic
1093868552 12:24258010-24258032 TAAAATAAAAAAAATTAGCTGGG + Intergenic
1093917777 12:24824593-24824615 TGAAATAAAAACATTTAGGTGGG - Intronic
1094004029 12:25727777-25727799 TAAAATAAAAAGATTTAAATAGG + Intergenic
1094521002 12:31188894-31188916 TTAATTAAAAAGGTTGAAATAGG + Intergenic
1094624671 12:32112299-32112321 TCAAATAAAAAGAAGGGGCTGGG - Intronic
1094665813 12:32519640-32519662 TAAAATAAAAAAATAAAGCTGGG + Intronic
1094730980 12:33175713-33175735 TTAAATATAAAGACTCAGATAGG - Intergenic
1095580400 12:43790436-43790458 TTAAAAAAAAAAAATTAGCTGGG - Intergenic
1095633772 12:44407537-44407559 TTAAAAAAAAAAAATCAGCTGGG - Intergenic
1095790086 12:46157185-46157207 CAAAATAAAAAGATTGATTTAGG - Intergenic
1096133376 12:49179021-49179043 TTAAAAAAAAAAATTAGGCTGGG - Intergenic
1096235117 12:49921163-49921185 TTAAATAAATACAATTAGCTAGG + Intergenic
1096301564 12:50432697-50432719 TTAAATACAAAAAATTAGCTGGG + Intronic
1096833791 12:54335011-54335033 TAAAATAAAAAAAATCAGCTGGG + Intronic
1096853646 12:54461252-54461274 TTAAAAAAAAAAAATAAGCTGGG - Intronic
1096872275 12:54600747-54600769 TAAAATAAAAACAATTAGCTGGG - Intergenic
1097632010 12:62075572-62075594 TCAGATAAAAAGATTAAACTTGG + Intronic
1097762402 12:63482695-63482717 TTAAATACAAAAAATTAGCTGGG - Intergenic
1098198840 12:68033301-68033323 CTAAATAAAAAGTTTCAACTGGG + Intergenic
1098616141 12:72525464-72525486 TCAAATTAAAAGATTGTGCCTGG + Intronic
1098762504 12:74442522-74442544 TTAAAATACAAGATTGAGTTTGG - Intergenic
1098825425 12:75290759-75290781 ATAAAAAAAAAGATTTAGCCGGG + Intronic
1098892330 12:76022324-76022346 TTGAATAAAAAGCATGAACTGGG - Intergenic
1099254974 12:80304282-80304304 TTTAATAAAAATATTTAGCAGGG - Intronic
1099305170 12:80945142-80945164 CTAAATAAAAATATTCAGGTTGG - Intronic
1099626347 12:85079522-85079544 TTAAGTAAAAAGATAGAGGCTGG - Intronic
1099966389 12:89450505-89450527 TTAATTAAGAAGATTGACCTTGG - Intronic
1100247788 12:92781069-92781091 TTAAAAAAAAAAATTTAGCTGGG - Intronic
1100497646 12:95140876-95140898 TAAAATAATAGTATTGAGCTTGG + Intronic
1100640912 12:96481611-96481633 TTTAAAAAAAATATTGAGATGGG + Intergenic
1100759002 12:97785476-97785498 TAAAATATAATCATTGAGCTTGG - Intergenic
1100977014 12:100133079-100133101 AAAAATAAAAAAATTTAGCTGGG + Intronic
1101061447 12:100976705-100976727 TTTAATGAGAAGATGGAGCTTGG - Intronic
1101144317 12:101827113-101827135 ATAAATAAAAAAAGTTAGCTAGG - Intronic
1101180830 12:102215908-102215930 TAAAATAAAAAAAGTAAGCTAGG - Intergenic
1101259777 12:103016986-103017008 TTGAAAATAAAGATTGAGCTGGG - Intergenic
1101793210 12:107949555-107949577 TGAAATAGAAAGAATTAGCTGGG + Intergenic
1101826122 12:108221393-108221415 AAAAATACAAAAATTGAGCTGGG + Intronic
1101899565 12:108781261-108781283 ATAAATAAATAAATTTAGCTGGG + Intergenic
1102023398 12:109699380-109699402 TTTAAAAAAAAAATTTAGCTGGG - Intergenic
1102074812 12:110051425-110051447 TTAAAAAAAAAAAATGAGATTGG - Intronic
1102128503 12:110505450-110505472 TAAAATAAAAAAATAGAGGTGGG + Intronic
1102308799 12:111827666-111827688 ATAAATAAAAAGATTGGGCACGG - Intergenic
1102529534 12:113536195-113536217 TTAAAAAAAAAAATAGAGTTGGG - Intergenic
1102550576 12:113688838-113688860 TTAAATGAAAAGATTGACAGAGG - Intergenic
1102700232 12:114832727-114832749 TTAAAAAAAAAAATTTAGCCGGG - Intergenic
1102839559 12:116103580-116103602 TTAAAAAACAAAATTGATCTGGG - Intronic
1102944599 12:116974904-116974926 ATAAATAAAAAGATGAAGGTAGG + Intronic
1103093600 12:118115504-118115526 TTTATTAAAAAGTTTTAGCTGGG + Intronic
1103366306 12:120386272-120386294 TAAAATAACAAAATTTAGCTGGG + Intergenic
1103383945 12:120517057-120517079 TTAATTAAAGAAATTGGGCTGGG + Intronic
1103653112 12:122448645-122448667 TTAAAGAAAAAAAATTAGCTTGG - Intergenic
1104111993 12:125712792-125712814 TAAAATAAAAAGAATGCTCTTGG + Intergenic
1104134208 12:125922051-125922073 TTAAATAACAAAATGTAGCTGGG + Intergenic
1104356427 12:128090603-128090625 TTAAAAGAAAGGATTGAGCCGGG - Intergenic
1104497218 12:129252202-129252224 TAAAACCAAAAGATGGAGCTGGG + Intronic
1105719094 13:23096124-23096146 TTAAATAAAAAAAATTAGCTGGG + Intergenic
1105750116 13:23415326-23415348 TAAAATTAAAAGACTGGGCTGGG - Intronic
1106159400 13:27187087-27187109 ATAAATAAAAAGGTTGGGCATGG + Intergenic
1106213801 13:27675964-27675986 TAAAATAAAAAAAATTAGCTAGG - Intergenic
1106291179 13:28363901-28363923 TCAATTAAAAAGCATGAGCTGGG - Intronic
1106729285 13:32522711-32522733 TTAAGTCAAAAGATAGAGCTGGG + Intronic
1106921641 13:34570403-34570425 TTAATTAAAAAAATTTGGCTGGG - Intergenic
1107611426 13:42117503-42117525 ATGATTAAAAAGATTTAGCTGGG - Intronic
1107769267 13:43772586-43772608 TAAAATACAAAGAATTAGCTTGG + Intronic
1108068138 13:46599975-46599997 TAAAATAAAAAAATTAAGATCGG - Intronic
1108204641 13:48075287-48075309 TTAAATAAGAAGATTATTCTGGG + Intronic
1108269608 13:48747013-48747035 TTGAGTAAAAGGAATGAGCTGGG + Intergenic
1108393170 13:49968041-49968063 TTAAAAAAAAAAATTGGGCCAGG - Intergenic
1109224855 13:59680996-59681018 ATAAATAAAATGATTCAGATCGG - Intronic
1109444972 13:62424586-62424608 TAAAATGAAAAGATTAGGCTAGG + Intergenic
1109450196 13:62504041-62504063 ATAAATAAAAACACTGTGCTAGG - Intergenic
1109854503 13:68109231-68109253 TTTAAAAAAAAAATTGAGATAGG + Intergenic
1109871372 13:68338339-68338361 TTACAAAAAAAGAATTAGCTGGG - Intergenic
1110725670 13:78820077-78820099 ATAAATAAAGAGATTGATCATGG + Intergenic
1110923355 13:81117888-81117910 TTAAGTTAAAACATTGGGCTGGG + Intergenic
1111147492 13:84203166-84203188 TTAAAAAAAAAAAGTGAGATTGG + Intergenic
1111269513 13:85863210-85863232 TAAAAAAAAAAGATTCATCTGGG - Intergenic
1111835344 13:93381658-93381680 TGAAATTAGAAAATTGAGCTAGG - Intronic
1111977812 13:94986036-94986058 AAAAATAAAAAGATAGGGCTGGG + Intergenic
1112148709 13:96731814-96731836 AAAAATAAAAACATTTAGCTGGG - Intronic
1112180593 13:97075733-97075755 TTAAATTAAAAACTTGGGCTGGG + Intergenic
1112286633 13:98110585-98110607 TTAAAAAAAAAAATCCAGCTTGG - Intergenic
1112429111 13:99334105-99334127 ATAAATAAAAAGAATTAGCTGGG - Intronic
1112546640 13:100377473-100377495 TAAAATAAAAAGATGGAGGCTGG - Intronic
1112783281 13:102925624-102925646 TTATAGAAAAAAATCGAGCTGGG + Intergenic
1113173033 13:107527937-107527959 TTAAATAAGAAAATTCAGTTAGG - Intronic
1113475783 13:110580183-110580205 AAAAATAAAAAAATTTAGCTGGG - Intergenic
1113892105 13:113741880-113741902 GCAAATAAAAAGGTTGAACTTGG - Intergenic
1114006659 14:18320967-18320989 TTAAAAAAAAAGACAGAACTAGG - Intergenic
1114503456 14:23189646-23189668 TTAAAAAAAAAAAATTAGCTGGG + Intronic
1115101134 14:29701402-29701424 TTTAATAAAATCATTGATCTAGG - Intronic
1115292749 14:31791115-31791137 TTAAACAAAAAAAGTTAGCTGGG + Intronic
1115302208 14:31897169-31897191 TTAAAAAAAAAAAATTAGCTGGG - Intergenic
1115594242 14:34893884-34893906 TTAAATAAAAATATAGAGATGGG - Intergenic
1115831241 14:37344732-37344754 TTATATATAAAGAGTGAGCCAGG + Intronic
1115908010 14:38222891-38222913 AAAAATAAAAAGATTAAGGTGGG - Intergenic
1115949715 14:38707199-38707221 TTAAAAAAAAAAATTGAAGTTGG - Intergenic
1116056009 14:39864776-39864798 TTCAATGAAAAGAATGATCTTGG - Intergenic
1116136844 14:40935646-40935668 TTAAATTAAAATATTGAACTTGG + Intergenic
1116146512 14:41078373-41078395 TTAAATAAAAACAGTGAGTGTGG - Intergenic
1116254540 14:42534443-42534465 TAAAATACAAAGAATTAGCTGGG + Intergenic
1116495522 14:45555111-45555133 ATAAATAAAAAGATTTTGGTGGG + Intergenic
1116515509 14:45800353-45800375 AAAAATAAAAAGAATTAGCTGGG + Intergenic
1116551451 14:46244888-46244910 TTAAAAAAAAATCTTGAACTTGG + Intergenic
1116763076 14:49038785-49038807 TAAAATAAAAAGACTGAGTAAGG + Intergenic
1116962776 14:50983681-50983703 TTAGAGGAAAAGATTGAACTTGG - Intronic
1117395483 14:55305249-55305271 TAAAATAAAAAAAGTTAGCTGGG + Intronic
1118008369 14:61585643-61585665 TTAAAGAAAAAGATGTAGGTAGG + Intronic
1118378392 14:65197286-65197308 TTAAATAGAAAGAATGAACAAGG - Intergenic
1118416408 14:65541570-65541592 TTAAACAAAAAGGTTGAGGATGG - Intronic
1118469303 14:66060174-66060196 TTAAATAAAAATAGTGAGGTGGG + Intergenic
1118470500 14:66070510-66070532 TGAAATCAAAAGAATAAGCTTGG + Intergenic
1118834087 14:69463777-69463799 TTAAAAAAAAAAAATTAGCTGGG + Intergenic
1119042626 14:71288779-71288801 TTAAAAAAAAAGTTAGAGATGGG - Intergenic
1119458432 14:74777404-74777426 AAAAATAAAAAAATTTAGCTGGG + Intronic
1119492307 14:75046017-75046039 GAAAATAAAAAAATTTAGCTGGG + Intronic
1119744610 14:77035133-77035155 TTAAAAAAAAAGAGAGAGATGGG + Intergenic
1119925915 14:78493558-78493580 ATAAATAAAAAGAATTAGCCAGG + Intronic
1120209448 14:81620629-81620651 TTAAATAAAAAAGTTTACCTAGG + Intergenic
1120330273 14:83083753-83083775 TTAACTTAAAACATTGAGTTAGG + Intergenic
1120375432 14:83699101-83699123 TTAAATATAAAGATTCAGATAGG + Intergenic
1120534948 14:85683314-85683336 GTAAATAAAAAGAGGGAGCCAGG + Intergenic
1120589498 14:86358603-86358625 TTAAAAAAAAATATTCACCTTGG - Intergenic
1122006959 14:98713511-98713533 TTATTTAAAAAGAATCAGCTGGG + Intronic
1122223972 14:100261987-100262009 ATAAATAAAAATAATTAGCTGGG + Intronic
1122395054 14:101420445-101420467 TTAAATATAAAGATACAGATAGG + Intergenic
1122494602 14:102143878-102143900 TTAAAAAAAGAGATTGTGGTCGG + Intronic
1122561141 14:102615291-102615313 TTAAAAAAAAAAATTTAGCCAGG - Intronic
1122992385 14:105242953-105242975 TAAAATACAAAAAATGAGCTGGG + Intronic
1202829388 14_GL000009v2_random:10038-10060 TTTAAAAAAAATATTCAGCTGGG - Intergenic
1123915913 15:25027034-25027056 GTAAATAGGAAGCTTGAGCTGGG + Intergenic
1124185744 15:27527069-27527091 AGAAATAAAAGGATTTAGCTGGG + Intronic
1124842333 15:33254591-33254613 TTAAAAAAAAAAAATTAGCTGGG + Intergenic
1124874685 15:33580828-33580850 TTAGATCAGAAGACTGAGCTGGG - Intronic
1125030432 15:35070564-35070586 TAAAATAAAAAAACTTAGCTGGG + Intergenic
1125174108 15:36800993-36801015 TGAAATAAAAAATTTGGGCTAGG + Intronic
1125291035 15:38146949-38146971 TTAAAAAAAAAAAAAGAGCTTGG + Intergenic
1125330679 15:38579269-38579291 TTAAAAAAAAAAAATTAGCTGGG + Intergenic
1125611110 15:40970959-40970981 TTAAAAAAAAAAAATTAGCTGGG + Intergenic
1125622099 15:41072556-41072578 TAAAATAAAAAAAATTAGCTGGG + Intronic
1125622915 15:41080557-41080579 TTTAATAAACAGATTGAGGCCGG + Intronic
1125645341 15:41267771-41267793 AAAAAAAAAAAAATTGAGCTGGG + Intronic
1125786079 15:42319502-42319524 ATAAATAAAAAGAATTAGCTGGG - Intronic
1125967492 15:43886157-43886179 TTTTATAAAATGATAGAGCTGGG + Intronic
1126008361 15:44279790-44279812 TTAAAAAAGAAGTTTGAGCTGGG - Intergenic
1126030093 15:44488513-44488535 TTAAATAAAAATATTCAGGCTGG + Intronic
1126048330 15:44664758-44664780 TAAAATACAAAAATTTAGCTGGG - Intergenic
1126224873 15:46259431-46259453 TTATTTAAAAAAATTGAGATGGG - Intergenic
1126581324 15:50244926-50244948 AAAAATGGAAAGATTGAGCTGGG - Intronic
1126617412 15:50598848-50598870 TCACATAACAATATTGAGCTAGG - Intronic
1126837713 15:52684237-52684259 TTAAATATAAATTTTCAGCTGGG + Intronic
1126848290 15:52782340-52782362 TGAGATAATAAGATTGGGCTAGG - Intronic
1127080368 15:55372288-55372310 TTAAATAAAAAAACAGAGATAGG - Intronic
1127532896 15:59862552-59862574 GCCAATAATAAGATTGAGCTGGG - Intergenic
1127573230 15:60264501-60264523 TTAAACAAAAACAGTAAGCTTGG + Intergenic
1127765063 15:62177599-62177621 TTAAAGAAAAAAAACGAGCTGGG - Intergenic
1127811177 15:62566846-62566868 TTAAAAAAAAAAAGTGGGCTGGG - Intronic
1127929553 15:63583312-63583334 TCAATTAAAAAAAATGAGCTAGG + Intronic
1128004764 15:64228473-64228495 TAAAATACAAAGAATTAGCTGGG + Intronic
1128101642 15:65005767-65005789 CTAAATACAAAAATTTAGCTGGG - Intronic
1128138653 15:65283263-65283285 TTAAAAAAAAAAATTGAGATGGG - Intronic
1128278899 15:66378004-66378026 TTAAAAAAAAAAAATTAGCTGGG - Intronic
1128284450 15:66424780-66424802 AAAAAAAAAAAGATTGAGATTGG - Intronic
1128451501 15:67808325-67808347 ATAAATAAAAATAGTGAGCTAGG + Intergenic
1128508393 15:68297098-68297120 CAAAATAAAAAGAATTAGCTGGG - Intronic
1128990143 15:72253016-72253038 TTAAAAAAAAAAAATTAGCTGGG + Intronic
1129280802 15:74483471-74483493 AAAAATAAAAATATTTAGCTGGG + Intergenic
1129456685 15:75679844-75679866 TAAAATACAAAAAATGAGCTGGG - Intronic
1129768938 15:78191025-78191047 TTAAATATAAAGACACAGCTAGG + Intronic
1129981859 15:79879843-79879865 TTAAAAAACAAGAAAGAGCTAGG - Intronic
1130311677 15:82761453-82761475 TTACTTAAAAAGATGGAACTGGG + Intronic
1130603295 15:85292868-85292890 TAAAATAAAAAAAATTAGCTGGG - Intergenic
1130735397 15:86542896-86542918 TTAAATAAAAAGACACAGATAGG - Intronic
1130752451 15:86726720-86726742 ATAAATAAAAACAATTAGCTGGG - Intronic
1130760184 15:86811290-86811312 TAAAATAAAAGGATAGAACTCGG + Intronic
1131109345 15:89755142-89755164 AAAAATAAAAATGTTGAGCTAGG - Intergenic
1131330484 15:91494366-91494388 TTAAATAAAAGGCTTGAAATTGG + Intergenic
1131407625 15:92178344-92178366 TTAAAAAATAAGATCCAGCTTGG - Intergenic
1131600278 15:93840766-93840788 TTAAATATAAAGATACAGATAGG - Intergenic
1131672696 15:94636680-94636702 AAAAATAAAAAAAATGAGCTGGG + Intergenic
1131674794 15:94660947-94660969 TAAAATAAAAAGATCAAACTAGG - Intergenic
1132955875 16:2593185-2593207 CTAAATGAAGACATTGAGCTGGG - Intronic
1133005076 16:2875701-2875723 TTAAAAAAAAAAATTTAGCCAGG + Intergenic
1133087514 16:3376261-3376283 TTAAAAAGAAAGAAAGAGCTAGG - Intronic
1133311387 16:4848798-4848820 TTAAATAAAAACATGAATCTTGG + Intronic
1133312325 16:4857187-4857209 TAAAAAAAAAAAATTTAGCTAGG + Intronic
1133376148 16:5288962-5288984 TAAAATAAAAAAAATTAGCTGGG + Intergenic
1133542554 16:6770587-6770609 TTAAAAAAAAAAATTGAACAGGG - Intronic
1133778091 16:8913734-8913756 TAAAATAAAAAGAGTGAGGAGGG - Intronic
1134426549 16:14154017-14154039 TTAAATATAAAGATGCAGATGGG - Intronic
1134470242 16:14518436-14518458 TTAAAAAAAAAAATTCAGATTGG + Intronic
1134481021 16:14619297-14619319 TTAAATAAAAACATTAGACTGGG + Intronic
1134646607 16:15873112-15873134 TTAATTAAAAAAATAGAGATGGG + Intronic
1134754307 16:16652610-16652632 TTTAAAAAAAAGAATTAGCTGGG + Intergenic
1134991753 16:18706414-18706436 TTTAAAAAAAAGAATTAGCTGGG - Intergenic
1135388129 16:22063011-22063033 ATAAATAAAAAAAATTAGCTGGG - Intronic
1135561149 16:23478036-23478058 TTAAAAAAAAAAAATTAGCTGGG + Intronic
1135608695 16:23845921-23845943 ATAAATAAAAAGAGAGAGCACGG + Intronic
1135818761 16:25660247-25660269 TTAAAAAAAAAAAATTAGCTAGG + Intergenic
1136129841 16:28212612-28212634 AAAAATAAAAAAATTTAGCTGGG - Intergenic
1136228571 16:28874180-28874202 ATAAATAAAAAGGTTTATCTCGG + Exonic
1136457044 16:30386116-30386138 TTAAAAAAAAAAAATTAGCTGGG + Intronic
1137011366 16:35324037-35324059 TAAAATAAAAATAATTAGCTGGG + Intergenic
1137015694 16:35372139-35372161 TAAAATAAAAAAATTTAGCTGGG + Intergenic
1137042007 16:35621526-35621548 ATAAAAAAAAAAATTTAGCTTGG - Intergenic
1137744672 16:50812087-50812109 TTAAAAAGAAAGATTGAGCTGGG - Intergenic
1138004556 16:53320011-53320033 ATAAATAAATAGAAGGAGCTGGG + Intronic
1138049497 16:53761255-53761277 TGAAAAAAAAAAAATGAGCTGGG - Intronic
1138293095 16:55864746-55864768 ATAAAAAAAAAGAATTAGCTGGG + Intronic
1138361837 16:56436752-56436774 TTATACAAAAAGACTGAGATAGG + Intronic
1138568563 16:57852034-57852056 TAAAAAAGAAAGAATGAGCTGGG - Intronic
1138617638 16:58183214-58183236 TTAAAAAAAAAAAATTAGCTGGG + Intronic
1138627032 16:58260670-58260692 AATAATAAAAATATTGAGCTAGG - Intronic
1138669136 16:58598764-58598786 TTTAAAAAAAAGATTGGGCTGGG + Intronic
1138688626 16:58748283-58748305 AAAAAAAAAAAGATTGAGATGGG - Intergenic
1138740910 16:59309033-59309055 TTAAATGAATTGATTGTGCTTGG - Intergenic
1138866512 16:60827921-60827943 TTAAATAAAAGGATAAAGTTGGG + Intergenic
1138987737 16:62350961-62350983 TGAAAGAAATAGATTGGGCTTGG - Intergenic
1139077551 16:63471260-63471282 TTATATTAAAAGAATGAGATTGG + Intergenic
1139755934 16:69143733-69143755 TTAATTAAAAAAATAGAGATGGG + Intronic
1139873950 16:70129995-70130017 TTAAATGAAAGCATTGAGCCGGG + Intronic
1139993703 16:70960989-70961011 CTATTTAAAAAGAATGAGCTAGG - Intronic
1140060984 16:71569495-71569517 AGAAATAAAAAAAATGAGCTGGG - Intronic
1140084926 16:71786752-71786774 TTAAAAAAAAAATTTGGGCTGGG - Intronic
1140313225 16:73868826-73868848 TGACATAAAAATATGGAGCTTGG - Intergenic
1140361831 16:74351144-74351166 TTAAATGAAAGCATTGAGCCGGG - Intergenic
1140542285 16:75767951-75767973 ATAAATTAAAATATTGGGCTGGG - Intergenic
1140844147 16:78870760-78870782 TAAAATACAAAAATTTAGCTGGG - Intronic
1141004028 16:80335461-80335483 TTAAATATAAAGATATAGATAGG + Intergenic
1141095803 16:81162271-81162293 TTAAGTACAATGATTAAGCTAGG + Intergenic
1141113363 16:81288421-81288443 AAAAATAAAAAGAATGAGCTAGG - Intronic
1141848044 16:86624364-86624386 ATAAAGAAAAAGATGCAGCTAGG - Intergenic
1141914941 16:87089265-87089287 TTAAAAAAAAAAATTGAGACAGG + Intronic
1141929648 16:87193552-87193574 AAAAATAAAAAAATTTAGCTGGG - Intronic
1142297397 16:89234620-89234642 TTAAGGAAAAAGATTGTGCCAGG + Exonic
1142658798 17:1413244-1413266 TTAAATTAAAAGATTTAAATTGG + Intergenic
1142816769 17:2432570-2432592 ATAAAAAAAAAAATTAAGCTTGG + Intronic
1142989568 17:3721222-3721244 TTAAATAAAATGAATAAGCTGGG - Intronic
1143845146 17:9768119-9768141 CTAAATAAAAAAAATTAGCTGGG + Intergenic
1143990056 17:10951072-10951094 TTAAATATAAAGATACAGATAGG - Intergenic
1144118994 17:12131406-12131428 TTAAAAAAAAAAAATTAGCTGGG - Intronic
1144417330 17:15062042-15062064 TAAAATAAAAAAATTGACTTTGG - Intergenic
1144503070 17:15806378-15806400 AAAAAAAAAAAGATTGGGCTGGG - Intergenic
1144897722 17:18554496-18554518 ATAAATAAAAAAATTTAGCCAGG - Intergenic
1144962381 17:19052220-19052242 TTAAAAAAAAAAAATTAGCTGGG - Intergenic
1144972780 17:19122300-19122322 TTAAAAAAAAAAAATTAGCTGGG + Intergenic
1145042904 17:19590044-19590066 TTAAAGACAAAGATTGGGCCGGG + Intergenic
1145134650 17:20391222-20391244 ATAAATAAAAAAATTTAGCCAGG + Intergenic
1145165252 17:20609085-20609107 GAAAAAAAAAAGATTGGGCTGGG - Intergenic
1145178135 17:20719775-20719797 TTAAATAAACAGAATGAACCTGG - Intergenic
1145376315 17:22352101-22352123 CTAAATAAAAAAAATTAGCTGGG - Intergenic
1145775941 17:27528742-27528764 TAAAATAAAAAAAGTTAGCTGGG + Intronic
1146365741 17:32225954-32225976 CTAAATAAAAAAAATTAGCTGGG + Intronic
1146539626 17:33683226-33683248 TAAAATACAAAAATTTAGCTGGG - Intronic
1146659836 17:34658386-34658408 TTAAACATAAAAATTTAGCTGGG - Intergenic
1146945897 17:36873295-36873317 AAAAATAAAAAGAATTAGCTGGG - Intergenic
1146989003 17:37250341-37250363 TTAAAGATAAAGATTAAGGTTGG + Intronic
1147026584 17:37590212-37590234 TTAAATAAGAAGATACAGGTAGG + Intronic
1147231003 17:39017844-39017866 ATAAATACAAAAAATGAGCTGGG - Intergenic
1147455892 17:40537896-40537918 TTAAATACAAAAATTTAGCTAGG + Intergenic
1147641895 17:42007682-42007704 TAAAATACAAAAATTTAGCTGGG - Intronic
1147679528 17:42232220-42232242 TAAAATAAAAACATTTACCTTGG - Intronic
1147704138 17:42414402-42414424 TTAAAAAAAAAAATAGAGCTTGG - Intronic
1147738251 17:42654607-42654629 TTAAAAAAAAAAATAGAGATGGG - Intergenic
1147749680 17:42722327-42722349 ATAAAAAAAAAAATTGGGCTAGG + Intronic
1147817330 17:43219569-43219591 TTAAAAAAAAAAAAAGAGCTGGG + Exonic
1148167634 17:45494300-45494322 TAAAATACAAAGAATTAGCTGGG + Intergenic
1148599990 17:48886966-48886988 TAAAAGAAATAGATTGGGCTGGG + Intergenic
1148692115 17:49534980-49535002 TTTAATTAAAAGTTTCAGCTGGG + Intergenic
1149228971 17:54509957-54509979 TTAAAATTAAAGATTGAGGTAGG - Intergenic
1149460020 17:56821068-56821090 ATAAATAAAAATAATTAGCTGGG - Intronic
1149566166 17:57642196-57642218 TTAAAAAAAACTACTGAGCTGGG - Intronic
1149675098 17:58452846-58452868 TTAAATTAAAAGATTTAAATTGG + Intronic
1149803630 17:59593941-59593963 TTAAATTAAAAGGCTTAGCTAGG - Intronic
1149842861 17:59981543-59981565 TTAAATTAAAAGGCTTAGCTAGG + Intergenic
1149889184 17:60371091-60371113 TTAATTAAAAACAATTAGCTGGG + Intronic
1149892122 17:60399500-60399522 TTAAAAAAAAAAATTTAGCTGGG + Intronic
1150074297 17:62179566-62179588 AAAAAAAAAAAGATTGAGCAGGG + Intergenic
1150081515 17:62243866-62243888 TTAAATAAACAGAATGAACCTGG + Intergenic
1150144710 17:62758579-62758601 TTAAATAAGAAGCAAGAGCTGGG + Intronic
1150333729 17:64314903-64314925 ATAAATAAAAAAAATTAGCTGGG - Intergenic
1150598885 17:66632538-66632560 TTAAAAAAAAAAAATTAGCTGGG - Intronic
1151031115 17:70740546-70740568 TAAAATAAAAAAATTGAATTAGG + Intergenic
1151133827 17:71925570-71925592 TTAAATAAATAAATTTGGCTGGG - Intergenic
1151471974 17:74324209-74324231 TTAAAAAAAAAAAATGAGCCAGG + Intergenic
1152036858 17:77878955-77878977 ATAAATAAAAAAATTTAGCTGGG - Intergenic
1152270720 17:79323251-79323273 ATCAAGAAAAACATTGAGCTAGG + Intronic
1152664841 17:81561744-81561766 TAAAAAAAAAAGAATTAGCTGGG - Intronic
1153038698 18:789896-789918 TTAAATACAAAAAATTAGCTAGG + Intronic
1153142360 18:1987732-1987754 TAAAAAAAAAAAAGTGAGCTGGG + Intergenic
1153211896 18:2776380-2776402 TAAAAAAAAAAAATTTAGCTGGG - Intronic
1153300752 18:3590069-3590091 TTAAATAAAAAAAATTAGCCTGG - Intronic
1153308139 18:3651495-3651517 AAAAATAGAAAGATTCAGCTGGG + Intronic
1153609159 18:6864843-6864865 TTAAAAAAAAAAATTTAGCTGGG - Intronic
1154264216 18:12865646-12865668 TAAAATAAAAAGAGTGAGCTGGG + Intronic
1155411101 18:25546128-25546150 CTAAAGAAAGAGATAGAGCTGGG + Intergenic
1155676309 18:28433289-28433311 TTTAATAAATAGATGGTGCTGGG - Intergenic
1156324663 18:36063461-36063483 TTAAAATAAAAGAATGAGCTGGG - Intronic
1156368421 18:36450630-36450652 TAAAATAAAAATAATTAGCTGGG + Intronic
1156423657 18:36984611-36984633 CTAAATAAAAAGACTGAGAGTGG + Intronic
1156576718 18:38325502-38325524 TTAGAGAAAGAGAGTGAGCTTGG - Intergenic
1156919072 18:42497317-42497339 TTAAAGAGAGAGATTGAGGTTGG - Intergenic
1157002905 18:43548890-43548912 TCAAATAAAAAGAGTCAGCCAGG + Intergenic
1157030300 18:43897975-43897997 TTGAAAAAAAAGATAGAGTTAGG - Intergenic
1157507219 18:48236624-48236646 CTAAAGCAAAAGATTGAGGTGGG + Intronic
1157627776 18:49065656-49065678 TTAAAAAAAAAAATTGAGGCCGG - Intronic
1157843383 18:50980040-50980062 TTAAATAAACAGTTGGAGTTGGG + Intronic
1157869378 18:51215891-51215913 AAAAATAAAAAAATTTAGCTGGG - Intronic
1158124864 18:54090094-54090116 TTAAATAGCAAGATAGAGATAGG + Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158291101 18:55944694-55944716 TTAAATATAAAGACTTAACTAGG - Intergenic
1158711757 18:59843887-59843909 AAAAAAAAAAAAATTGAGCTGGG + Intergenic
1158736914 18:60092672-60092694 TTATATATATATATTGAGCTGGG - Intergenic
1159044353 18:63354505-63354527 TAAAATAAAAAAAATTAGCTGGG + Intronic
1159120310 18:64161439-64161461 TTAAATAAAAACATTGAGATTGG + Intergenic
1159169415 18:64745576-64745598 ATAAATAGAAAGATAGAACTAGG - Intergenic
1159182551 18:64927497-64927519 GTAGATAAAAAGGTTGAGGTTGG + Intergenic
1159350997 18:67272397-67272419 TTAAAAAAAAAAATAGAGATCGG - Intergenic
1159546743 18:69849124-69849146 TTATATTAAAAGATGGAGTTAGG - Intronic
1160802911 19:978697-978719 TAAAATAAAAAAAATTAGCTGGG + Intergenic
1161205499 19:3039060-3039082 TTAAAAAAAAAAAATTAGCTGGG + Intronic
1161537039 19:4825998-4826020 TAAAATAAAAATAATTAGCTGGG + Intronic
1161540797 19:4850237-4850259 TTAAATAAATACATGCAGCTGGG - Intronic
1161623346 19:5311038-5311060 TTAAATAAAAAAAATTAGCTGGG - Intronic
1161755412 19:6129887-6129909 TTAAAAATAAAAATAGAGCTGGG - Intronic
1161797931 19:6398229-6398251 TTAAAAGAAAAAATTTAGCTGGG + Intergenic
1161816847 19:6504450-6504472 TTAAAAAAAAAGAATTTGCTGGG - Intergenic
1161866274 19:6834144-6834166 TTAAAAAAAAAAAATTAGCTAGG - Intronic
1161925947 19:7299834-7299856 CTAAATACAAAGAATTAGCTGGG + Intergenic
1162038295 19:7954138-7954160 AAAAATACAAAGATTTAGCTGGG - Intergenic
1162083326 19:8233032-8233054 TAAAATAAAAAGATTCAGGCTGG - Intronic
1162294784 19:9805807-9805829 TTAAATACAAAAAATTAGCTGGG + Intergenic
1162311190 19:9908283-9908305 AAAAATAAAAAGAATTAGCTGGG - Intronic
1162408158 19:10488315-10488337 ATAAACAAAAACATTAAGCTGGG + Intronic
1162444879 19:10716725-10716747 TAAAATAAAAATAATTAGCTGGG + Intergenic
1162509949 19:11111934-11111956 TTAAAGAAAAAAAATTAGCTGGG + Intronic
1162726624 19:12693728-12693750 TTAAAAAAAAAAAATTAGCTGGG + Intronic
1162816452 19:13198126-13198148 TTAAATATAAATATTTAGGTGGG - Intergenic
1162864480 19:13534343-13534365 TGAAATAAAATGAATGGGCTGGG + Intronic
1163344685 19:16733058-16733080 TAAAATTAAAAAAATGAGCTGGG + Intronic
1163354670 19:16802297-16802319 AAAAATAAAAATAATGAGCTGGG + Intronic
1163444047 19:17336530-17336552 GTAAATAAAAATATTGAGCAGGG + Intronic
1163606269 19:18277384-18277406 TCAAAAAAAAAAATTTAGCTGGG + Intergenic
1163915357 19:20236403-20236425 TAAAATACAAAAATTTAGCTGGG + Intergenic
1164109984 19:22147348-22147370 AAAAATAAAAAAATTTAGCTGGG - Intergenic
1164635234 19:29786736-29786758 AAAAATAAAAAAATTTAGCTGGG - Intergenic
1164962585 19:32447415-32447437 TTAATTAAAAAGAGCTAGCTTGG + Intronic
1165134812 19:33661149-33661171 TAAAATAAAATAAATGAGCTGGG + Intronic
1165135265 19:33663888-33663910 TAAAATAAAAAGCATGAGGTAGG + Intronic
1165436957 19:35800851-35800873 TAAAATAAAAACAGTTAGCTGGG - Intronic
1165440581 19:35824775-35824797 TTCAATAGAAAGATGGAGCCAGG + Intergenic
1165604697 19:37091764-37091786 AAAAATACAAAAATTGAGCTGGG + Intronic
1165741750 19:38209116-38209138 TTAAAAAAAAAAGTTAAGCTGGG - Intergenic
1166401438 19:42483576-42483598 TTAAAAAAAAAAAATTAGCTCGG + Intergenic
1166665062 19:44674559-44674581 ATAAATAAAAAAAATTAGCTGGG - Intronic
1166682148 19:44775596-44775618 ATAAATAAATAGATTGGGCCGGG - Intergenic
1166711120 19:44938050-44938072 TAAAAAAAAAAAATTTAGCTAGG - Intergenic
1166766968 19:45257113-45257135 TTAAAAAAAAAAAATTAGCTAGG - Intronic
1166850862 19:45760170-45760192 TGAAATCAAAAGACTAAGCTGGG + Intronic
1167025071 19:46909940-46909962 TAAAATAACAACATTGAGCTGGG - Intergenic
1167060357 19:47141010-47141032 TTAAAAAAAAAAAATTAGCTGGG - Intronic
1167217879 19:48176912-48176934 TTAAAAAAAAAAAATTAGCTGGG + Intronic
1167449456 19:49558404-49558426 ATAAAAAAAAAAATTGAGCCGGG - Intronic
1167457463 19:49604739-49604761 TTATATAAAAAGATAAAACTTGG - Intronic
1167878287 19:52432791-52432813 CTAAATACAAAAAATGAGCTGGG - Intronic
1167908729 19:52684072-52684094 AAAAATACAAAAATTGAGCTGGG + Intronic
1167958661 19:53088499-53088521 TTAAATAAAAATATAGAGACAGG - Intronic
1168142949 19:54401569-54401591 ATAAAAAAAAAAATTTAGCTGGG - Intergenic
1202710181 1_KI270714v1_random:15047-15069 TTAAAAAAAAAAAATTAGCTGGG - Intergenic
925197017 2:1933881-1933903 TTAAATAAACACATTGGTCTAGG + Intronic
926263108 2:11285665-11285687 TAAAATACAAAAAATGAGCTGGG + Intronic
926267665 2:11340460-11340482 TTAAAGAAAATGAGTTAGCTAGG - Intronic
926326336 2:11787559-11787581 TTCAATAAGAACATCGAGCTGGG - Intronic
926396364 2:12446738-12446760 TTAAAAAAAAAGATTCAGAATGG + Intergenic
927129391 2:20045303-20045325 TTAAAAAGAATGATTAAGCTGGG + Intronic
927361272 2:22236982-22237004 TTGAATAGAAAGATGGAGATGGG - Intergenic
927549443 2:23985059-23985081 TTAAAAAAAAAAAGTTAGCTGGG - Intronic
927598456 2:24418967-24418989 TTAATTTAAGAGATTGGGCTCGG + Intergenic
927908912 2:26882580-26882602 TTAAAAATAAATATTGTGCTGGG - Intronic
928007072 2:27572301-27572323 TTAAACAAAGAGCTAGAGCTTGG + Intergenic
928009184 2:27592284-27592306 ATAAATAAAAAAACTAAGCTGGG - Intronic
928035713 2:27820877-27820899 TTAAATACAAAAAATTAGCTGGG + Intronic
928141948 2:28737163-28737185 TAAAATAAAAAAATTTAGCCAGG - Intergenic
928818466 2:35328967-35328989 TTAAAAAAAAAGATAGCACTAGG + Intergenic
928829449 2:35461830-35461852 TTAAATAAAAAGAGAGTTCTGGG + Intergenic
928994303 2:37270749-37270771 TTAAACAAAAAGATTAAAGTGGG - Intronic
929104923 2:38355439-38355461 TTTAATAAAAAGACAGAGCTTGG + Intronic
929138450 2:38646610-38646632 TTAACAAAAAAGTTAGAGCTGGG - Intergenic
929379136 2:41329197-41329219 TTACATAGAAAGATTGATGTTGG + Intergenic
929522813 2:42670096-42670118 CTAAATACAAAGAATTAGCTGGG + Intronic
929827100 2:45317409-45317431 TAAAATACAAAAAATGAGCTTGG + Intergenic
929882324 2:45847736-45847758 TAAAATAAAAAGATCGAACCAGG - Intronic
930060603 2:47285308-47285330 CTAAATATAAAAATTTAGCTGGG + Intergenic
930240142 2:48927777-48927799 TTAAAAAAAAAAAATTAGCTGGG + Intergenic
930345878 2:50180318-50180340 TTAAAAACAAAAATTGAGCCTGG - Intronic
930531247 2:52591104-52591126 AAAAATAAAAAAATTTAGCTAGG - Intergenic
930909055 2:56608163-56608185 TTAAATATAAAGATTCAGATGGG - Intergenic
931418702 2:62105526-62105548 TTAAATGACCAGATTGGGCTGGG + Intronic
931516016 2:63051144-63051166 TTGAAAAAAAAGATAGAGGTGGG + Intronic
931587672 2:63845906-63845928 ATTAATAAAAATATTGAGGTAGG + Intronic
931613989 2:64136740-64136762 TAAAATACAAACATTTAGCTGGG + Intronic
931936253 2:67200198-67200220 TAAAATACAAAAAATGAGCTGGG + Intergenic
932116703 2:69056832-69056854 TAAAATAAAAAAATTTAGCTGGG - Intronic
932690161 2:73906484-73906506 ATACATAAAAATTTTGAGCTAGG + Intronic
932899037 2:75676941-75676963 TTCAATAAAAATATTGAACAGGG + Intronic
933360717 2:81280307-81280329 TTAAATAGAAAGATTGGGATTGG + Intergenic
933407009 2:81873367-81873389 TAAAATAAAAAGATTATTCTGGG - Intergenic
933568975 2:83985794-83985816 TTAGATATAAAGATGGAGATAGG - Intergenic
935014635 2:99168993-99169015 TTAAAGAGACAGATGGAGCTTGG - Intronic
935578659 2:104736613-104736635 TAAAATAAAATGAATGAGCTGGG + Intergenic
935667083 2:105522147-105522169 TTAAAAAAAAAAAATTAGCTGGG + Intergenic
936107959 2:109641745-109641767 TTAAAAAAAAAGATGGTGATGGG - Intergenic
936418099 2:112337915-112337937 TTAAAAAAAAAGACTGGGCCAGG - Exonic
937154501 2:119709524-119709546 TGAAATAAAAATATTAGGCTGGG + Intergenic
937191212 2:120100948-120100970 TTAAATAATCATATTGAGATGGG + Intronic
937560169 2:123213859-123213881 TTTAAAAAAAAGTTTTAGCTAGG + Intergenic
937607815 2:123823191-123823213 AGAAATAAAAAGATTGACCAGGG + Intergenic
937660523 2:124425246-124425268 TTTAATAAAAAGATTTAGTATGG - Intronic
937671695 2:124544796-124544818 TTAAGTATAAAGATTGGGTTTGG + Intronic
939655815 2:144823235-144823257 TTAAATAAAAATAGTGAGAGTGG - Intergenic
939994432 2:148906896-148906918 TAAAATTAAAAGAATTAGCTGGG + Intronic
940188680 2:151015072-151015094 TAAAATACAAACAGTGAGCTGGG + Intronic
940315711 2:152325532-152325554 TTGAATAAAAAGGGTGAGATTGG + Intergenic
940432541 2:153610377-153610399 TAAAATAAACAGATTGGGCCGGG + Intergenic
940440768 2:153713641-153713663 TAAAATAAAAAAAGTTAGCTGGG - Intergenic
940481465 2:154237271-154237293 TTACATAATAAGATTAAGGTAGG - Intronic
940570033 2:155419624-155419646 TAAAAAAAAAAAATTCAGCTGGG + Intergenic
940625957 2:156175562-156175584 TGAAATGAACAGACTGAGCTAGG + Intergenic
941600645 2:167539258-167539280 TTAAAAAAAAAAATTGGACTGGG + Intergenic
941789835 2:169539602-169539624 TTAAAAAAAAAAAATTAGCTGGG + Intronic
941931450 2:170944477-170944499 TGAAATAGAAAAATAGAGCTAGG + Intronic
942051226 2:172142861-172142883 AAAAAAAAAAAGATTGGGCTGGG - Intergenic
942120064 2:172767969-172767991 AAAAATAAAAAAAATGAGCTGGG - Intronic
942940354 2:181608163-181608185 TAAAAAAAAAAAAGTGAGCTGGG - Intronic
943007074 2:182398125-182398147 ATAAAAAAAAAGCTTGAGTTGGG + Intronic
943399841 2:187393997-187394019 TAAAATAGAATGATTGACCTAGG + Intronic
944245443 2:197525575-197525597 AAAAATAAAAAGGTTGGGCTAGG + Intronic
944447825 2:199809221-199809243 TCCTATAAAAAGATTGAGTTCGG + Intronic
944559023 2:200916685-200916707 TAAAATAAAAAAATTGAAATAGG - Intronic
944660855 2:201920424-201920446 TTAAATATAAAAAATGAGGTGGG + Intergenic
944815772 2:203373616-203373638 TTAGAAAAAAAGATTAAGCAAGG + Intronic
945346573 2:208724926-208724948 TTAAATAAAATGATTGCTTTGGG + Intronic
945373126 2:209045814-209045836 TTAAATTCAAAAATTGAGCAAGG - Intergenic
945447047 2:209950851-209950873 TTAAAAAAAAAAATCCAGCTGGG - Intronic
945628388 2:212239204-212239226 TTAAATAAAAAAATATAGCCAGG - Intronic
945714544 2:213341690-213341712 TAAAACAAAAAAATTTAGCTGGG - Intronic
945880225 2:215317248-215317270 TTAAATAAAAAGTTTTACATGGG - Intronic
945912778 2:215668641-215668663 TTAAATAAAAAGAGCCATCTGGG - Intergenic
946220673 2:218223469-218223491 TTAAGTAAAAAAAGTGACCTTGG + Intronic
946277346 2:218641538-218641560 TTAAAAAAAAAAATTGAGGCTGG - Intronic
946533488 2:220601384-220601406 TGAAATAAAAAGAATGAACAGGG - Intergenic
946618937 2:221540213-221540235 TTAAATAAGAAAACTGGGCTGGG - Intronic
946827480 2:223693959-223693981 ATAAATAAAAAAATTGGGTTTGG + Intergenic
946927412 2:224639468-224639490 AAAAAAAAAAAGATTGAGATGGG - Intergenic
946943817 2:224798623-224798645 AAAAAAAAAAAGATTGAGCCAGG - Intronic
947706313 2:232279096-232279118 TTAAATACAAAAAATAAGCTGGG - Intronic
948442977 2:238008761-238008783 TATAATATAAAGGTTGAGCTGGG - Intronic
948606336 2:239138025-239138047 TTAAATAAAAACATGTATCTAGG + Intronic
1168833729 20:862506-862528 TAAAAATAAAAAATTGAGCTGGG + Intergenic
1169120804 20:3094516-3094538 GAAAAAAAAAAGATTGGGCTTGG + Intergenic
1169237344 20:3941777-3941799 GAAAATAAAAAGATGAAGCTGGG + Intronic
1169281354 20:4269535-4269557 TAAAATAAAAAGCTGAAGCTGGG - Intergenic
1169474173 20:5916012-5916034 TTCAATTAAAAGTTTAAGCTAGG - Intronic
1169833974 20:9857079-9857101 TTAAAACAAAAGATTGTGTTCGG - Intergenic
1169838372 20:9906117-9906139 TAAAATACAAAAATTTAGCTGGG + Intergenic
1170058455 20:12233254-12233276 TTAAATGAAAAACTTGAGATAGG - Intergenic
1170112032 20:12815550-12815572 TCAAGTGAAATGATTGAGCTTGG + Intergenic
1170118670 20:12888643-12888665 TAAAATAAAAATAATTAGCTGGG + Intergenic
1170293590 20:14799302-14799324 TTTAATAGTAAGATTGTGCTGGG - Intronic
1170305342 20:14931833-14931855 TTAAAAAAAAAAAATTAGCTGGG + Intronic
1170344537 20:15368762-15368784 TTAAAAAAAAAGTTTGTGATTGG - Intronic
1170548570 20:17455948-17455970 TTAAATAAAAGGAGTAGGCTGGG + Intronic
1170621768 20:18002440-18002462 TTAAATAAAAAGAGTGGGGCTGG - Intronic
1170948195 20:20910864-20910886 TAAAATGAAAAGAATCAGCTGGG + Intergenic
1171890429 20:30707947-30707969 TTTAAAAAAAATATTCAGCTGGG + Intergenic
1171964629 20:31520150-31520172 CTAAATAAAAAGTGTGGGCTGGG - Intronic
1172290666 20:33773982-33774004 TTAAAAAATAAGATTTGGCTGGG + Intronic
1172543033 20:35736944-35736966 TTAAAAAAAAAGTCTGGGCTTGG - Intronic
1172579217 20:36033646-36033668 TTACATAAAGAGTTTGGGCTGGG - Intergenic
1172589591 20:36108137-36108159 AAAAATAAAAAAATTTAGCTGGG - Intronic
1172858559 20:38028213-38028235 ATCAATTAAAAGATTGAGATTGG + Intronic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1173202387 20:40963393-40963415 ACAAATAAAGACATTGAGCTCGG + Intergenic
1173204677 20:40983418-40983440 TAAAAAAAAAAGAATTAGCTAGG + Intergenic
1173206209 20:40996094-40996116 CTAAATATAAAAATTTAGCTGGG - Intergenic
1173343354 20:42175162-42175184 TCCAATAAAAAGTTTGAGCAGGG - Intronic
1173641487 20:44605749-44605771 TAAAAAAAAAAGAATTAGCTGGG + Intronic
1173679026 20:44863117-44863139 ATAAATAAAAAAAATTAGCTGGG + Intergenic
1174027411 20:47589534-47589556 TTAAAAAAAAAAAATTAGCTGGG - Intronic
1174269579 20:49357901-49357923 TTAAATAACAAGATCGGGCCAGG - Intergenic
1174455636 20:50646727-50646749 TGAAATAAACAGCTTGTGCTGGG + Intronic
1174910871 20:54606263-54606285 TTAAAAAAAAAGTTTAAGTTAGG - Intronic
1175474204 20:59258175-59258197 TTAAAAAAAAAGATGGAGGAGGG + Exonic
1175682159 20:60996859-60996881 TTAAATAATAAGAAGGAACTTGG + Intergenic
1176203435 20:63874979-63875001 AAAAATAAAAAAATTTAGCTGGG + Intronic
1176225820 20:63998539-63998561 ATAAATAAAAATATAGATCTTGG + Intronic
1176608572 21:8854878-8854900 TTAAAAAAAAATATTCAGCTGGG - Intergenic
1176899566 21:14422973-14422995 TTCAATAAAAAGATATAGCATGG + Intergenic
1176928190 21:14775509-14775531 TTAAATAAAAACAATATGCTAGG + Intergenic
1177114786 21:17072711-17072733 TTAAAGTAAAACATTGGGCTGGG - Intergenic
1177395980 21:20536790-20536812 ATAAACAAAAAGAATGAACTTGG + Intergenic
1177471063 21:21561733-21561755 TTAATTAAAATAAGTGAGCTGGG + Intergenic
1177704297 21:24680738-24680760 TTAAATATAAAGATTCAGATAGG + Intergenic
1177952566 21:27556883-27556905 TTAAAAAAAAAAAGTGAGGTTGG - Intergenic
1178170724 21:30036736-30036758 TTAAAAAAAAAAAATTAGCTGGG - Intergenic
1178201472 21:30411497-30411519 TTAAACAAAAAGTTTGTTCTTGG + Intronic
1178374258 21:32053626-32053648 TTATAAAAAAAGATCCAGCTGGG - Intergenic
1179139243 21:38709717-38709739 TAAAAAAAAAAAAATGAGCTGGG + Intergenic
1179275788 21:39890514-39890536 TAAAAAAAAAAAAATGAGCTGGG - Intronic
1180114301 21:45687645-45687667 TTAAATATAAAGATACAACTAGG + Intronic
1180358656 22:11864693-11864715 TTAAAAAAAAATATTCAGCTGGG - Intergenic
1180379610 22:12127638-12127660 TTAAAAAAAAATATTCAGCTGGG + Intergenic
1180431168 22:15251778-15251800 TTAAAAAAAAAGACAGAACTAGG - Intergenic
1180607845 22:17074516-17074538 TAAAATACAAAAAATGAGCTGGG - Intergenic
1181664437 22:24382540-24382562 TAAAATACAAAAAATGAGCTGGG + Intronic
1181796517 22:25315544-25315566 TTAAAAAAAAAAAGTTAGCTGGG - Intergenic
1181926947 22:26367502-26367524 AAAAATAAAAAAATTTAGCTGGG - Intronic
1182255612 22:29035734-29035756 ATAAAAAAAAAAATTTAGCTGGG - Intronic
1182401589 22:30081734-30081756 AAAAATAAAAAAATTTAGCTGGG - Intronic
1182611988 22:31556106-31556128 TTTACTAAAAAGAGTGAGCTTGG + Intronic
1182669856 22:31986829-31986851 AAAAATAAAAAGAATTAGCTGGG + Intergenic
1182777278 22:32840255-32840277 TTAAGTAAAAATATTAATCTTGG - Intronic
1183386296 22:37517340-37517362 TTATATAAAAAAATTCAGCTAGG + Intronic
1183409437 22:37646414-37646436 TAAAATAAAAAAAATTAGCTGGG - Intronic
1183563825 22:38598331-38598353 GTAGATAAAGATATTGAGCTTGG + Intronic
1183600809 22:38839482-38839504 TTAAAAAACAAGAATTAGCTGGG + Intronic
1183798008 22:40136558-40136580 TAAAAAAAAAAAATTTAGCTCGG - Intronic
1184513883 22:44948528-44948550 ATAAAAAAAAACATTTAGCTAGG + Intronic
1184701174 22:46174015-46174037 TAAAATACAAAGAATTAGCTGGG + Intronic
1185359742 22:50398473-50398495 TTAAATAAAGAAATAGAGATGGG - Intronic
1203295120 22_KI270736v1_random:34724-34746 TAAAATACAAAAAATGAGCTGGG + Intergenic
949483828 3:4518772-4518794 TTAAAAATAAAGGTTCAGCTTGG + Intronic
949721530 3:6996207-6996229 TAAAATACAAAAATTGAGCCAGG - Intronic
950061784 3:10077871-10077893 TTAAAAAAAAAAATGTAGCTGGG + Intronic
950251165 3:11466832-11466854 TTAAAAATAATGATGGAGCTGGG + Intronic
950515501 3:13462297-13462319 AAAAATAAAAAAATTTAGCTGGG + Intergenic
950867053 3:16197485-16197507 TTAAATAAAAACAGTGTGCAGGG - Intronic
951282990 3:20775634-20775656 TTAAAAAAAAAAAATTAGCTGGG - Intergenic
951372357 3:21866155-21866177 TTAAAAAAAAACACTGGGCTGGG + Intronic
951603037 3:24398142-24398164 TTAAAAAAATGGATTGAGGTGGG + Intronic
951636150 3:24779805-24779827 TTAAATATAAAGATAAAGATAGG - Intergenic
951693977 3:25426965-25426987 TTTAATAAAAGGATTGGGCAGGG + Intronic
951960000 3:28307366-28307388 ATAAATAAAAAAAATTAGCTAGG + Intronic
951982241 3:28577765-28577787 TTAAATAACAATATTGATTTTGG - Intergenic
951987797 3:28640300-28640322 TAAAATAAAAAGATGGAGAAGGG - Intergenic
952302656 3:32117671-32117693 TTATCTAAAAAGTTTGTGCTAGG + Intronic
952443177 3:33354216-33354238 TTAAATAAAAATTTTAGGCTGGG + Intronic
952536967 3:34321481-34321503 TAAAATACAAAAAATGAGCTGGG - Intergenic
952669234 3:35946408-35946430 ATAAATAATAAAATTGAGGTGGG + Intergenic
952788821 3:37181882-37181904 TTAAAAAAAAAAACTTAGCTGGG - Intronic
952913361 3:38210207-38210229 CTCACTAAAAAGACTGAGCTGGG - Intronic
953403290 3:42645521-42645543 CTAAATAAAAAAAATTAGCTGGG + Intronic
953514386 3:43575796-43575818 AAAAATAAAAAAATTTAGCTGGG - Intronic
953966729 3:47313376-47313398 TAAAATAAAATGAATTAGCTGGG - Intronic
954175413 3:48841040-48841062 TTAAAAAAAAAAAATTAGCTGGG - Intronic
954179508 3:48870672-48870694 TTAAAAAAAAAAAATTAGCTGGG - Intronic
954233136 3:49234333-49234355 TTAAAAAAAAAAAATTAGCTGGG - Intronic
954299877 3:49695261-49695283 TTAAAAAAAAAAAATTAGCTGGG - Intronic
954350096 3:50036053-50036075 AAAAATATAAAAATTGAGCTGGG - Intronic
954435732 3:50494969-50494991 TTAAATAAAAATATCCAGCCGGG - Intronic
954657135 3:52201597-52201619 AAAAATAAAAAGAATTAGCTGGG + Intronic
954862304 3:53701292-53701314 TAAAATAAAAAGAATTAGCTGGG - Intronic
954907071 3:54071915-54071937 TTAAAAAAAAAGATGTTGCTGGG + Intergenic
955100907 3:55848788-55848810 AAAAACAAAAAGATTGAGCAAGG - Intronic
955559948 3:60178217-60178239 TGAAATAAAAAGATGGGGCTTGG - Intronic
955775777 3:62431393-62431415 TAAAAAAAAAAGATTGAGGGGGG - Intronic
955814891 3:62831821-62831843 TTTAATACAAAGATTTAGTTAGG - Intronic
956028394 3:65008774-65008796 TTTAATAAAACTATTGAGGTGGG + Intergenic
956433948 3:69215038-69215060 TAAAATACAAAAAATGAGCTGGG - Intronic
956669748 3:71675697-71675719 TAAAATGAAAAGTTTGAACTAGG + Exonic
957133954 3:76260664-76260686 TTAAATAAAAACTTTGATATAGG - Intronic
957142443 3:76378499-76378521 TTAAATAAAAGGATTGATGGAGG - Intronic
957388420 3:79529323-79529345 TTAAACAAAAAAAATTAGCTAGG + Intronic
957392000 3:79587226-79587248 ATGAAAAAAAAAATTGAGCTGGG + Intronic
957645792 3:82923745-82923767 TTAAATGAAAAGATACAGATAGG + Intergenic
958500380 3:94898978-94899000 TTAAATAAAAAAATATAGATTGG - Intergenic
958652516 3:96955647-96955669 TTAAACATAAAGGTTGAGGTTGG + Intronic
958900989 3:99886616-99886638 TTAAATTAAGATATTGAGTTGGG + Intronic
959005385 3:101013888-101013910 TTAAATAGAAATATTTGGCTGGG + Intergenic
959140733 3:102483619-102483641 TTAAATAAAAAATTCGGGCTGGG - Intergenic
959488238 3:106953843-106953865 TTCAATTAAAAGATAGAGATTGG - Intergenic
959523838 3:107353550-107353572 TAAAATATAAAAACTGAGCTGGG + Intergenic
959916858 3:111826146-111826168 AAAAATAAAAAGAATTAGCTAGG + Intronic
960058994 3:113299731-113299753 TTAAAAAATAAGATCCAGCTAGG + Intronic
960129443 3:114039208-114039230 TTAGAAAAAAAAATTGGGCTGGG + Intronic
960194395 3:114747620-114747642 TTAAAAAACAAGATTGAGGCCGG + Intronic
960230226 3:115217414-115217436 CAAAATAAAAAGATGTAGCTCGG + Intergenic
960805123 3:121576326-121576348 ATAAATAAATAAATTGAGTTTGG - Intronic
961158676 3:124703491-124703513 TAAAAAAAAAAGATAGAGATCGG + Intronic
961527424 3:127514530-127514552 TTAAATATAAAATTTGGGCTTGG - Intergenic
962720709 3:138172286-138172308 TTAAATAAAGGGATGAAGCTGGG + Intronic
963360623 3:144268042-144268064 TCAAATAAAAATATTGGGCCAGG - Intergenic
963429894 3:145186731-145186753 TAAAATAAAAAAATTGAGGCAGG - Intergenic
963455239 3:145538244-145538266 TTAAAGAAAAAGATAGATGTGGG + Intergenic
963795218 3:149624858-149624880 ATAAATAAAATGAATTAGCTGGG - Intronic
963873937 3:150452055-150452077 TAAAATAAAAAAATTCAGCCTGG - Intronic
964012982 3:151912998-151913020 TTAAATAATCAGAGTGGGCTGGG - Intergenic
964188104 3:153971158-153971180 TTAAATTAAATTACTGAGCTGGG - Intergenic
964192622 3:154022026-154022048 AAAAATAAAAAAATTTAGCTGGG - Intergenic
964221371 3:154350034-154350056 AAAAATAAAAAAATTTAGCTAGG + Intronic
964333841 3:155633953-155633975 TTAAAAAAAAAGATGGAGTCAGG - Intronic
964797425 3:160514759-160514781 TAACATAAAAAGATTAAGATAGG - Intronic
964857905 3:161167038-161167060 TTAAAAAAAAAAAATTAGCTTGG - Intronic
964934688 3:162068419-162068441 TTAAATAAAAAGAATGAGGGAGG + Intergenic
965087830 3:164122350-164122372 TAAAATACAAAAATTTAGCTGGG + Intergenic
965207001 3:165732771-165732793 TTAAATAAAAATTTAGAGCAGGG - Intergenic
965529153 3:169753628-169753650 TTAACCAGAAAGATTGGGCTGGG - Intergenic
965665739 3:171091580-171091602 TAAAATACAAAAATTTAGCTGGG + Intronic
965779026 3:172264145-172264167 ATAAATAAAAAGAATTAGCCAGG - Intronic
966159198 3:176950203-176950225 TTAAATGAAATAATTGAGATGGG - Intergenic
966186795 3:177234672-177234694 TAAGATAAAAAGCTAGAGCTGGG + Intergenic
966528856 3:180951060-180951082 TTAAAAAAAAAAAATTAGCTGGG + Intronic
966583653 3:181597349-181597371 GAAAATAAAAAGATTGAAGTTGG - Intergenic
967030095 3:185597812-185597834 TAAAATACAAAGAATTAGCTGGG - Intronic
967147929 3:186621668-186621690 TAAAATAAAAAAAATTAGCTGGG - Intergenic
967420263 3:189264563-189264585 TTTATTAAAAAGATTCAGCATGG + Intronic
967502084 3:190209298-190209320 TTAAAAACAAAGACTGAGATTGG + Intergenic
967895395 3:194391833-194391855 AAAAATAAAAAAAATGAGCTGGG - Intergenic
968136578 3:196224158-196224180 TTAAATAAAAACATAGAGAAAGG - Intronic
968455510 4:696630-696652 TTAAAAAAAAACTTTGAGATGGG + Intergenic
969160561 4:5254078-5254100 CTACAAAAAAAGATTCAGCTGGG - Intronic
970455348 4:16218099-16218121 TTAAATAAAAAGGTTTATTTGGG + Intronic
970562510 4:17296667-17296689 TTAAAAAAAAAGTTTGGGATAGG - Intergenic
970771080 4:19613242-19613264 TTAAATACAAAAAATTAGCTAGG + Intergenic
970903434 4:21186933-21186955 TTAAATAAAAAGATTGAGCTGGG - Intronic
971073303 4:23119731-23119753 TAAAATGAATAGATTGAACTAGG - Intergenic
971716290 4:30181292-30181314 TTAAATAAAACTATTGGGCCTGG - Intergenic
972032608 4:34480051-34480073 TTAAATAAAAAGAATGTCATAGG - Intergenic
972488521 4:39564914-39564936 TATAAGAAAAAGATTAAGCTGGG + Intronic
972506892 4:39728312-39728334 TTATATATAGATATTGAGCTGGG + Intronic
972520583 4:39851634-39851656 AGAGATAAAAAGATGGAGCTAGG + Intronic
973007954 4:45036128-45036150 TTAAAAAAAAAAATTAAGCCGGG - Intergenic
973166480 4:47084178-47084200 TTAAATAAACAGAATGTGTTGGG + Intronic
973244910 4:48001112-48001134 TTAAATAAAAAGACACAGATAGG + Intronic
973743025 4:53936515-53936537 TTAAAAAAAAAGATCGGGCTTGG - Intronic
973810544 4:54565834-54565856 TTAAATATAAAAAATTAGCTGGG + Intergenic
973905285 4:55523137-55523159 TTAAAAAAAAAAAATTAGCTAGG + Intronic
975215015 4:71743063-71743085 TTGAAGAAAAAGATTGATCAAGG + Intronic
975253539 4:72208539-72208561 TTAAATAAAGATATTAAGCAAGG + Intergenic
975338346 4:73207537-73207559 TTAAATATAAAGACAGAGATAGG + Intronic
975555173 4:75656149-75656171 TTAAAAAAAAAAAATTAGCTGGG - Intronic
975623596 4:76319270-76319292 TTAAAAAAAAAAAATTAGCTAGG + Intronic
975672317 4:76793541-76793563 TTAAATAAAAAAAATCAGCTGGG + Intergenic
975907090 4:79226403-79226425 AAAAAGAAAAAGATTTAGCTGGG - Intronic
976146860 4:82050693-82050715 TTATATAAAAGGAGTAAGCTTGG - Intergenic
976640588 4:87333720-87333742 ATAAAGAAAAAGATTAGGCTGGG + Intergenic
977743231 4:100512643-100512665 AAAAATAAAAAAATTTAGCTGGG + Intronic
978175508 4:105727226-105727248 TTAAATATAAAGATAAGGCTGGG + Intronic
978352206 4:107831763-107831785 TAAAATAAAATGATTGAAGTTGG + Intronic
978493884 4:109338685-109338707 TTAAATAAAAAGACCCAGTTAGG - Intergenic
978532292 4:109727636-109727658 TTAAAAAGAAAGATTAAGCCAGG + Intronic
978640372 4:110863940-110863962 TTAAAAAAAATCATTGAGTTAGG + Intergenic
979087570 4:116432475-116432497 TTAAATAAGAATATTGTGATGGG - Intergenic
979296411 4:119037308-119037330 TTAAATCAAAAGATTGTACTTGG + Intronic
979307549 4:119164689-119164711 TCAAATCCAAAGATTGATCTGGG + Intronic
979635029 4:122947317-122947339 TTTGATAAAGAGATTGAGATTGG + Exonic
979663767 4:123288376-123288398 ATAAATAGAAGGATTGATCTTGG + Intronic
980121269 4:128730837-128730859 TTAAAAAAAAAAAATTAGCTGGG - Intergenic
980280297 4:130709577-130709599 TTAAATTAAAAGAATAAGTTTGG - Intergenic
980403109 4:132319523-132319545 TAAAATACAAAGAATTAGCTAGG - Intergenic
980426162 4:132630466-132630488 TTAAAAAAAAGAATTGAGGTTGG + Intergenic
980498802 4:133621066-133621088 ACAAATAAAAATATTGAACTTGG - Intergenic
980630654 4:135427413-135427435 TAAAATAAAAAAAATTAGCTGGG + Intergenic
980960033 4:139465888-139465910 TAAAAAAAAAAAAGTGAGCTGGG - Intronic
981106622 4:140889052-140889074 TTAAATGAAAAAATAGAGATGGG + Intronic
981182671 4:141764083-141764105 ATAAATATAAAAAATGAGCTGGG + Intergenic
981738889 4:147982535-147982557 AAAAAAAAAAAGATTTAGCTGGG - Intronic
981844096 4:149146645-149146667 TTAAATAAAAATGTAGAGATGGG + Intergenic
981949710 4:150391397-150391419 TTATATAAAAAGATTTATTTTGG + Intronic
982588011 4:157267128-157267150 TTAAAAAAAAATGTTGGGCTGGG + Intronic
982700439 4:158655062-158655084 TTTAATAAAAATATTTGGCTGGG - Intergenic
982710519 4:158753945-158753967 TTAAAAAAGAAAATTTAGCTAGG - Intergenic
982859772 4:160434448-160434470 TTAAATAAGCAGACTGGGCTTGG + Intergenic
982984174 4:162184051-162184073 TTACATGAAAAGTTTTAGCTTGG + Intergenic
983144860 4:164201026-164201048 TTGCCTAAAAAGAGTGAGCTAGG + Intronic
983162827 4:164438280-164438302 TTAAATAAAAATACTGGGCTGGG + Intergenic
983180116 4:164638059-164638081 AAAAAAAAAAAGATTGGGCTGGG + Intergenic
983306217 4:165991709-165991731 TTAAATAAAAAAATAGATATTGG + Intronic
983375757 4:166925667-166925689 TTAAAAAAAAAAATTTACCTTGG - Intronic
983708170 4:170683896-170683918 TAAAATTAAAAAATTTAGCTGGG + Intergenic
984106798 4:175557932-175557954 TAAAATACAAAAAATGAGCTGGG - Intergenic
984119332 4:175722886-175722908 TTAAAAAAAAAAAATGAGCTGGG + Intronic
984227683 4:177054677-177054699 TAAAATACAAAAATTTAGCTGGG - Intergenic
984369578 4:178845583-178845605 TAACATAAAAAGATGGAGTTTGG + Intergenic
984545816 4:181101065-181101087 TTTAATAAAATGATAGAGATGGG + Intergenic
984557891 4:181237063-181237085 TCAAAAGAAAATATTGAGCTGGG - Intergenic
985220039 4:187694859-187694881 TTGAACAAAAAGATTGAGCAAGG + Intergenic
985266707 4:188157897-188157919 AAAAATAAAAAGAATGAGCCAGG + Intergenic
1202770678 4_GL000008v2_random:203654-203676 TTTAAAAAAAATATTCAGCTGGG + Intergenic
986216313 5:5722406-5722428 TTAAATAGAATAGTTGAGCTCGG - Intergenic
986443433 5:7800499-7800521 TAAAATAAAAAAAATTAGCTGGG + Intronic
986666522 5:10109332-10109354 ATAAATAAAAAGAAAGAGCTGGG - Intergenic
987077360 5:14396628-14396650 TTAAAAAAAAAAAATTAGCTGGG - Intronic
987452110 5:18098177-18098199 TTAATTAAACAGGTTGAGGTAGG + Intergenic
987548816 5:19351507-19351529 TTAAAATAAAAAATTGAGCTGGG - Intergenic
987839538 5:23205590-23205612 TTAAATAGCATGATTAAGCTTGG + Intergenic
987874378 5:23660999-23661021 TTAAATAAACATATTGAGAAGGG - Intergenic
988222018 5:28358928-28358950 AGAAATAAGAAGATTGGGCTGGG + Intergenic
988371216 5:30370310-30370332 TAAAATGAAAATATTAAGCTAGG - Intergenic
988440712 5:31229110-31229132 TTAAATAAAATGATATAGTTTGG - Intronic
988788792 5:34588406-34588428 ATAAATAAAAACAATTAGCTGGG - Intergenic
989074749 5:37552070-37552092 ATAAAAAAAAATATGGAGCTCGG - Intronic
989214056 5:38885303-38885325 TCCAATAAAAAGATTTAACTAGG + Intronic
989952530 5:50316574-50316596 TTTAAAATAAAAATTGAGCTTGG - Intergenic
990081281 5:51916379-51916401 TTCAAGAAAAAAATTTAGCTGGG - Intergenic
990180332 5:53153894-53153916 GAAAATAAAAAGCTTAAGCTTGG - Intergenic
990261726 5:54030012-54030034 TAAAATAAAAAGAATTAGCCAGG + Intronic
990265696 5:54072622-54072644 TTAAACAAAAAGATAAAGCTTGG + Intronic
990384202 5:55243521-55243543 AAAAAAAAAAAGATTTAGCTGGG + Intergenic
990418040 5:55605479-55605501 TTAAATAATAAGACTTAGCCTGG - Intergenic
990945697 5:61247104-61247126 TTAAATAAAAACATTGTTTTAGG + Intergenic
991299225 5:65112689-65112711 AAAAAAAAAAAGATTCAGCTGGG + Intergenic
991316584 5:65315611-65315633 ATAAATATAAAGACTCAGCTAGG + Intronic
991337439 5:65564613-65564635 TTTAATGAAAATAATGAGCTGGG - Intronic
991381301 5:66030721-66030743 TTAAAAAAAAAAATTTAGCTGGG - Intronic
991684703 5:69170912-69170934 TCAATTAAAAAGAATGAGGTTGG - Intronic
991761608 5:69921628-69921650 TTAAAAAAAAAAAAGGAGCTGGG + Intergenic
991785721 5:70196472-70196494 TTAAAAAAAAAAAAGGAGCTGGG - Intergenic
991840836 5:70796677-70796699 TTAAAAAAAAAAAAGGAGCTGGG + Intergenic
991991157 5:72341149-72341171 TAAAATACAAAAATTTAGCTGGG - Intronic
992048332 5:72920178-72920200 TTAAAAAAAAAAAATTAGCTGGG - Intergenic
992111929 5:73502624-73502646 TTAAAAAACAAGATTTGGCTGGG + Intronic
992133027 5:73714004-73714026 CTAAATAAGAGGAATGAGCTGGG + Intronic
993542544 5:89170685-89170707 TTTAATAAAAAAAATAAGCTGGG + Intergenic
993552857 5:89296336-89296358 TAAAATACAAAAATTTAGCTAGG + Intergenic
994372140 5:98979266-98979288 TAAAATAAAAGGTTTGAGCCAGG - Intergenic
994478825 5:100306857-100306879 ATAAATGAAAAGATTCAGTTTGG - Intergenic
994579591 5:101623040-101623062 TTAAATAAAAATGATAAGCTAGG - Intergenic
994635101 5:102335829-102335851 TTTAATCAAAAGATAGAGATTGG + Intergenic
994731148 5:103492158-103492180 TTTAATAAAAAGTTTGATTTAGG + Intergenic
994741916 5:103629665-103629687 TTAAATATATAGAAAGAGCTGGG + Intergenic
994924755 5:106100553-106100575 TAAAATAAAAAAATTCAGCCTGG + Intergenic
995560514 5:113376082-113376104 TAAAATAAAAAAATTAACCTTGG + Intronic
995824528 5:116280118-116280140 TTAAATAAGAGGATTGGGCAAGG + Intronic
996067472 5:119095153-119095175 TCAAATAAAATTATTGAACTTGG - Intronic
996340070 5:122427825-122427847 TCAAATAGAAAGATTTACCTGGG + Intronic
996588797 5:125121889-125121911 TTAAATCAAAAGGATGAGATAGG - Intergenic
996945761 5:129065792-129065814 TAAATTAAAAATATTGAGATGGG + Intergenic
997256516 5:132432687-132432709 TAAAATACAAAAATTTAGCTGGG - Intronic
998074773 5:139226626-139226648 AAAAATAAAAAAATTTAGCTGGG + Intronic
999137345 5:149331139-149331161 TTAAATCAAAAAAGTGGGCTGGG + Intronic
999396694 5:151233947-151233969 AAAAATAAAAAAATTGAGCCGGG - Intronic
999464583 5:151790010-151790032 TTAAATAAAAATAATCAGCCAGG + Intronic
999541237 5:152574263-152574285 TGAAACAAAAAGACTGAGATAGG - Intergenic
999560741 5:152798909-152798931 TTAAATTAAAAGATACAGATTGG + Intergenic
999589000 5:153123486-153123508 ATAAAAAAAAAAATTGAGCCTGG + Intergenic
999795614 5:154987100-154987122 TTTAATACAAAGCTTGTGCTAGG - Intergenic
1000346118 5:160315173-160315195 TTAAATAAAAAGGATAAACTGGG + Intronic
1000648717 5:163788518-163788540 TTAAATCAAAATGTTAAGCTAGG - Intergenic
1000664414 5:163977331-163977353 TTAACTTAAAAGAGTGTGCTGGG + Intergenic
1000688814 5:164288509-164288531 AAAAATAAAAAAAATGAGCTGGG - Intergenic
1000803328 5:165756811-165756833 TCAAATAACTAGATTGAGGTGGG + Intergenic
1000838426 5:166185239-166185261 CTAAATAAAAGGATTGATGTAGG + Intergenic
1001175496 5:169464642-169464664 TAAAACAAAAAAATTTAGCTTGG + Intergenic
1001417876 5:171560454-171560476 TATAATAAAAAGAATCAGCTGGG - Intergenic
1001465636 5:171962963-171962985 TTAAATAAAAAGATTGGTGGTGG - Intronic
1001478573 5:172069301-172069323 TTAAATATAAAGATTTAGACAGG + Intronic
1001690493 5:173629308-173629330 CTAAATAACAAGAAGGAGCTGGG + Intergenic
1002121018 5:177005053-177005075 TTAAAAAAAAAAAATTAGCTGGG - Intronic
1003349271 6:5300830-5300852 TTAAATAAAAAAAATTAGCCAGG - Intronic
1003366274 6:5477857-5477879 AAAAATAAAAAAAATGAGCTGGG + Intronic
1003417488 6:5925091-5925113 TGTGATAAAAAGAATGAGCTTGG - Intergenic
1003579871 6:7330089-7330111 TTAAATAAAAACAATGAGGCAGG + Intronic
1003996858 6:11550332-11550354 CTAAATAAAAAAACTTAGCTGGG - Intronic
1004261639 6:14113091-14113113 ATAAATAAATAAATTTAGCTGGG - Intergenic
1004401424 6:15292314-15292336 TCAAATAAAAAGCTTCAGCTGGG - Intronic
1004617583 6:17304950-17304972 TAAAATAAAAAAAATTAGCTGGG - Intergenic
1004694030 6:18017570-18017592 TTAAATAAATAGAATGCGTTTGG + Intergenic
1006138026 6:31908292-31908314 TTTTATAAAAAGATTTATCTGGG - Intronic
1007045751 6:38772824-38772846 TAAATTAAAAAAATTGAGATGGG + Intronic
1008441732 6:51539610-51539632 TCAAATAAAAATGTTGAGCAAGG + Intergenic
1009351181 6:62680771-62680793 AAAAAAAAAAAAATTGAGCTGGG + Intergenic
1009421046 6:63465339-63465361 AAAAATACAAAGATTTAGCTGGG - Intergenic
1009578891 6:65506202-65506224 TTAAATATAAAGACTCAGGTAGG - Intronic
1010331933 6:74633460-74633482 TTAAATAAAAAGAAGGAACATGG - Intergenic
1010432357 6:75792942-75792964 TAAAAAAAAAAAATTTAGCTGGG - Intronic
1010660075 6:78559482-78559504 TCAATTAAATAGATTTAGCTTGG + Intergenic
1010719392 6:79264710-79264732 ATACATAAAAAGAATAAGCTTGG - Intergenic
1011098071 6:83688662-83688684 AAAAATAAAAAAATTTAGCTGGG - Intronic
1011426542 6:87238186-87238208 TTAAATATTAAGAGTAAGCTGGG + Intronic
1011440068 6:87378470-87378492 TTAAAAAAAGAGAATGGGCTGGG + Intronic
1011747162 6:90417629-90417651 TTTAATAACAAGACAGAGCTCGG - Intergenic
1012090287 6:94884598-94884620 TTAAATTAAAAACTTCAGCTGGG - Intergenic
1012219543 6:96631829-96631851 TTGAATAAAAATATAGAGCATGG - Intergenic
1013024794 6:106261370-106261392 TTAAACAAAGGGATTTAGCTGGG - Intronic
1013268262 6:108521336-108521358 TAAAATAAAAAAAATTAGCTGGG + Intronic
1013500367 6:110743479-110743501 TAAAATACAAAAAATGAGCTGGG + Intronic
1013932532 6:115551185-115551207 TTAAAAAAGAAAATTAAGCTAGG + Intergenic
1013965806 6:115953802-115953824 TTGAATAAATAGATTAAGTTGGG - Intronic
1014027314 6:116663784-116663806 TTAAAAAAAAAAAATTAGCTGGG + Intronic
1014206068 6:118656604-118656626 TTAAATAAAAAGGCTGAGGCAGG - Intronic
1014923379 6:127239908-127239930 TTAAAAAAAAAATCTGAGCTTGG - Intergenic
1014997644 6:128170506-128170528 TTAAATAAAGTGATTGATTTAGG - Intronic
1015036545 6:128662458-128662480 TTAAATTAAAATATTGAAGTGGG + Intergenic
1015434066 6:133165669-133165691 TTAAAAAAAAAAACTGGGCTTGG + Intergenic
1015762908 6:136684209-136684231 TTTAAAAAAAAAATTGAGATAGG - Intronic
1015807930 6:137131408-137131430 TGAAATACAAACATTGAGATTGG - Intergenic
1015836409 6:137425093-137425115 TTAAAAAAAAAAAATTAGCTGGG - Intergenic
1015986937 6:138894044-138894066 ATAATTAAAAAGAAAGAGCTTGG - Intronic
1015995571 6:138992751-138992773 TTACAAAAAAAAATTTAGCTGGG + Intergenic
1016043622 6:139458639-139458661 AAAAAGAAAAAGATTGGGCTGGG - Intergenic
1016228919 6:141777487-141777509 TAAAATAAAAAGATTCATCTGGG + Intergenic
1016461716 6:144285667-144285689 TTAAAAAAAAAAATAAAGCTTGG - Intergenic
1016625140 6:146158100-146158122 TTAAATAAAACCATTCAGCAAGG + Intronic
1016795940 6:148117351-148117373 TATAATAAAAAGATTTAGATGGG + Intergenic
1016831542 6:148438696-148438718 TGAAAAAAAAAGAATGTGCTGGG - Intronic
1017412497 6:154183603-154183625 ATAAAAAGAAAGATTGGGCTGGG + Intronic
1017663190 6:156694009-156694031 TAAAATACAAAAAATGAGCTGGG - Intergenic
1017740878 6:157405530-157405552 TTTAAAAAAAATTTTGAGCTCGG - Intronic
1017944492 6:159082924-159082946 CTAAATACAAAGAATTAGCTGGG + Intergenic
1018307392 6:162472198-162472220 ATAAAAAAAAAGTTTGAGTTTGG - Intronic
1018586271 6:165363214-165363236 TTAAATAAAAAGAAAGAAATGGG + Intronic
1018996409 6:168713791-168713813 ATAAATAAAAAGTTTGATTTAGG - Intergenic
1019349240 7:545917-545939 TTAAAAAAAAAAATTAAGCTGGG + Intergenic
1019508915 7:1407511-1407533 TTAAATACACAGATTTAGCCAGG - Intergenic
1019679672 7:2339364-2339386 TTAAAAAAAAAAAATTAGCTGGG - Intronic
1019842247 7:3459072-3459094 TTAAATCTATAGATTGACCTGGG + Intronic
1019945062 7:4321514-4321536 ACAAATAAAAAAATTTAGCTGGG - Intergenic
1019987333 7:4667225-4667247 AAAAATAAAAAAATTAAGCTGGG - Intergenic
1020390757 7:7655413-7655435 TTAAATGAAAAGTTTCAGTTTGG + Intronic
1020585146 7:10055994-10056016 ATAAATAAAAAGATTTGGGTGGG - Intergenic
1020712533 7:11626145-11626167 TTAAATAAAAAGAGGGTCCTAGG - Intronic
1021092313 7:16498120-16498142 TTAACTAAAAAGATCAAACTTGG - Intronic
1021226445 7:18033581-18033603 TAAAATAAAAAGAATGAGGGTGG - Intergenic
1021265220 7:18512156-18512178 TTAAATATAAAGTTTCAGATAGG - Intronic
1021718444 7:23483470-23483492 TTAAAAAAAAAAAGTTAGCTGGG - Intergenic
1021976639 7:26017679-26017701 AAAAAAAAAAAGAATGAGCTGGG + Intergenic
1022043692 7:26605139-26605161 TTTAATCTAAAGATTCAGCTGGG - Intergenic
1022047630 7:26635340-26635362 TTAAAAAAAAAAATTTAGCTGGG + Intergenic
1022061801 7:26804438-26804460 TTTAATAAAAAGAATGTGCCGGG + Intronic
1022153366 7:27633360-27633382 TTTAATAGAAAGAATCAGCTGGG + Intronic
1022254136 7:28639017-28639039 TTAATGAAATATATTGAGCTGGG + Intronic
1022558057 7:31319909-31319931 TAAAATAAAAAAAATTAGCTGGG - Intergenic
1022856443 7:34319525-34319547 TTAAAGAAAAAAATTGAGAATGG - Intergenic
1023232006 7:38042593-38042615 TTTAATAAAAAGAGGGAACTAGG + Intergenic
1023341956 7:39230322-39230344 TTAAAAAAAAAAATTTAGCTGGG + Intronic
1023393849 7:39734259-39734281 TTAAACACAAAGATTGAGGATGG - Intergenic
1023407075 7:39844719-39844741 TTAAATTAATAAATTGAGATGGG + Intergenic
1023419865 7:39967892-39967914 TTAAAAAAAAAAATTGAGATGGG + Intronic
1023717129 7:43055876-43055898 ATAAATAAAAACAATGGGCTGGG + Intergenic
1023956029 7:44887337-44887359 TAAAATACAAAAAATGAGCTGGG - Intergenic
1024008907 7:45251367-45251389 TTAAAAAAAAAAAATTAGCTGGG + Intergenic
1024124755 7:46281937-46281959 AAAAAAAAAAAGATAGAGCTGGG + Intergenic
1024190595 7:47003302-47003324 TGAAATAAAAAAATTCAGCCTGG + Intergenic
1024264373 7:47595563-47595585 TTAAAAAAAAAAAATGAGTTTGG + Intergenic
1024394645 7:48851602-48851624 TAAAATAAAATGATTAAGGTGGG + Intergenic
1024400615 7:48921039-48921061 TAAAATAAAATGATTAAGGTGGG - Intergenic
1024798255 7:53045365-53045387 TTAAATGCAAAAATTGAGGTCGG + Intergenic
1025013260 7:55416445-55416467 AAAAATAAAAAGATTTAGCCAGG - Intronic
1025112841 7:56234136-56234158 TTAAAAAAAAAAAATTAGCTAGG - Intergenic
1026005407 7:66596612-66596634 TAAAAAAAAAAAATTGGGCTGGG - Intergenic
1026055329 7:66978831-66978853 TAAAAAAAAAAAATTTAGCTGGG + Intergenic
1026125891 7:67579181-67579203 AAAAATACAAAAATTGAGCTGGG + Intergenic
1026293462 7:69029587-69029609 TTAAATTTAAAGAATTAGCTGGG - Intergenic
1026365138 7:69640773-69640795 TAAAATAAAAAGGTTGATATAGG + Intronic
1026659099 7:72283372-72283394 AAAAATAAAAAAATTTAGCTGGG + Intronic
1026990589 7:74583016-74583038 TTAAATAAAAAGAAAGAGGTAGG + Intronic
1027151379 7:75736419-75736441 TTAAAAAAAAAAATAGGGCTGGG + Intronic
1027446281 7:78276999-78277021 TTAATAAATAAGATTGAGATTGG - Intronic
1027493093 7:78855245-78855267 TAAAATAAAAAATTTTAGCTGGG - Intronic
1027580620 7:79990346-79990368 TAAAATACAAAAATTTAGCTGGG - Intergenic
1027912649 7:84271883-84271905 TCAAAGACAAAGATTGAACTAGG - Intronic
1028276242 7:88861313-88861335 TTAAAGAAAAAGATGAAGCCAGG + Intronic
1028524337 7:91766945-91766967 GCAAATAAAAAAATTCAGCTGGG + Intronic
1028641710 7:93049684-93049706 TTAAATATAAAGATACAGATAGG + Intergenic
1028792432 7:94867759-94867781 TAAAATAAAAAAAATTAGCTGGG - Intergenic
1029193289 7:98786794-98786816 TTAAAAAAAAAAAATGAGCTGGG - Intergenic
1029684252 7:102134756-102134778 AAAAATAAAAAGAATTAGCTGGG - Intronic
1030158433 7:106481564-106481586 TTAAATGAAAATATGAAGCTGGG - Intergenic
1030176839 7:106662387-106662409 TTAAATAAGGAGAATGAACTAGG - Intergenic
1030253897 7:107484765-107484787 TTAAGTAAAAAGAATTAGATGGG + Intronic
1030341169 7:108382422-108382444 TTAATTAAAAAAATAGAGATGGG - Intronic
1030371163 7:108700608-108700630 TTAAAAAAAAAAAATTAGCTAGG + Intergenic
1030429393 7:109423929-109423951 TTAAATACAAAGATTCTGATAGG - Intergenic
1030509117 7:110461354-110461376 TTAAATATAAAGATTCTGATAGG + Intergenic
1030583282 7:111386039-111386061 TTAAAAAAAAAAAATTAGCTGGG - Intronic
1030892273 7:115013515-115013537 TTAAATATCAAGATTGAGAGAGG - Intronic
1031216163 7:118895024-118895046 GGAAAGAAAAAGATTGAGGTAGG + Intergenic
1031692669 7:124809498-124809520 TTAAATTAAAAAATTGGGCTGGG - Intergenic
1032096940 7:128943324-128943346 TTAAAAAAAAAGATTGGGCCGGG - Intronic
1032212794 7:129931055-129931077 TTAAATACAAAAAATTAGCTGGG + Intronic
1032222407 7:130004510-130004532 TTAAATAAAAAGGTAGAGGGGGG - Intergenic
1032235551 7:130119046-130119068 TTAAAAAAAAAAAATTAGCTGGG + Intronic
1032301709 7:130693589-130693611 TTAAAGAAAAAGTATGAGGTTGG - Intergenic
1032556307 7:132839029-132839051 TTAAAAAAAAAAAATTAGCTGGG + Intronic
1032844585 7:135741661-135741683 AAAAATAAAAAAATTTAGCTGGG + Intronic
1033377205 7:140773451-140773473 TCAAATAAAAAGAGAGGGCTGGG + Intronic
1033972298 7:147056929-147056951 ATAAATAAAAAAAATAAGCTAGG - Intronic
1034322013 7:150194444-150194466 TTAAATATAAAGATTTAGATAGG - Intergenic
1034522885 7:151633813-151633835 TTAAACCAAAAGATTAATCTGGG - Intronic
1034752811 7:153586776-153586798 TTAAATAAGAATTTTGGGCTGGG + Intergenic
1034770737 7:153772729-153772751 TTAAATATAAAGATTTAGATAGG + Intergenic
1035885075 8:3282819-3282841 TTACATAAGAAAATTGAGTTAGG - Intronic
1035982438 8:4388114-4388136 TTAAATAATTACATTTAGCTGGG - Intronic
1036396440 8:8375493-8375515 TTAAAGAAAAAAATGGGGCTGGG - Intronic
1036811899 8:11872834-11872856 TTAAAAAAAAAGTTTGAGACAGG + Intergenic
1036813829 8:11886533-11886555 TTAAAAAAAAAGAATTAGCTGGG - Intergenic
1036927471 8:12920930-12920952 TTAAAAAAAGAGAATGGGCTTGG - Intergenic
1037087158 8:14866647-14866669 AAAAATACAAAGAATGAGCTGGG + Intronic
1037308813 8:17533750-17533772 TTAAATAAATAGCCTGTGCTTGG - Intronic
1037395719 8:18440600-18440622 TTATATAAAATTATTGAACTAGG + Intergenic
1037850501 8:22323523-22323545 TTAAAAAAAATGACTGGGCTGGG - Intronic
1038063685 8:23939448-23939470 TTAAATAAATAGATTGTGAGAGG + Intergenic
1038221954 8:25617734-25617756 TTAAAAAACAGGATTCAGCTGGG + Intergenic
1038460833 8:27715219-27715241 TTCAATAAAAAACCTGAGCTGGG - Intergenic
1038696489 8:29811286-29811308 TAAAATAAAGAGATTGGACTAGG - Intergenic
1038836221 8:31127761-31127783 ATAAATAAAAAAAATTAGCTAGG + Intronic
1039263529 8:35799528-35799550 ATTAATTAAAAGATTGAGCTGGG + Intergenic
1039311218 8:36320559-36320581 TCAAAGAAAAAGAACGAGCTAGG - Intergenic
1039364697 8:36917509-36917531 TTAAAAAAAAAAAATTAGCTGGG - Intronic
1039509303 8:38078024-38078046 TAAAATAAAAAAAATTAGCTGGG + Intergenic
1039681225 8:39738629-39738651 TTAAATATAAAAATTTAGATAGG + Intergenic
1039876934 8:41594838-41594860 TTAAAAAAAAAGTTTGGGCCGGG - Intronic
1039961291 8:42249920-42249942 TAAAAAAAAAAAATTCAGCTGGG + Intergenic
1040021260 8:42743343-42743365 CCTAACAAAAAGATTGAGCTGGG - Intergenic
1040580797 8:48697202-48697224 TTAAATAAAAACATTAAAATAGG - Intergenic
1040632313 8:49229915-49229937 TTAAATACAAAAAATGAGCCAGG + Intergenic
1041098940 8:54377654-54377676 CTAAATAAAAAAAATTAGCTGGG - Intergenic
1041117019 8:54549621-54549643 TTAAACAGAAAGATTGAGCCAGG - Intergenic
1041168126 8:55111845-55111867 TTAAATTAAAAGCTTGTCCTGGG + Intronic
1041374206 8:57195844-57195866 AAAAATAAAAAAATTTAGCTAGG - Intergenic
1041500876 8:58536987-58537009 TTAAATACAAAAATTTAGCCGGG - Intergenic
1041676035 8:60540775-60540797 TTATATAAAAAAAATGGGCTGGG - Intronic
1042262451 8:66873063-66873085 TAAAATAAAATGATTAAGATTGG - Intronic
1042531556 8:69821196-69821218 TTAAAAAAAAAAAATTAGCTGGG + Intronic
1042753324 8:72182321-72182343 TTGAATAAAAATAATGAGCCAGG - Intergenic
1042805971 8:72771574-72771596 TTAAATAATAAGTTTGAGAAGGG + Intronic
1043050860 8:75383871-75383893 TTTAAAAAAAAAAATGAGCTAGG - Intergenic
1043460053 8:80450548-80450570 TTAAAAAAAAATTTTCAGCTGGG + Intergenic
1043620686 8:82188661-82188683 TTATATAAAAATATAGAACTTGG - Intergenic
1043621919 8:82204275-82204297 TTAAAAAAAAAAAGTCAGCTAGG + Intergenic
1043826927 8:84940228-84940250 TAAAAAAAAAAGATTGGGGTTGG + Intergenic
1043939808 8:86184821-86184843 TTAAATTAAAAGATTTAAGTTGG - Intergenic
1044243878 8:89918457-89918479 TTAAAGAACAAGAGTCAGCTGGG - Intronic
1044685004 8:94818219-94818241 ATAAATAAAAAATTTCAGCTGGG - Intronic
1044751569 8:95421613-95421635 TTAAATAACAATCTTGAGCAAGG - Intergenic
1045331834 8:101162036-101162058 TAAAATACAAAAAATGAGCTAGG - Intergenic
1045707271 8:104940130-104940152 TTAAATATAAAGATTCAGATGGG - Intronic
1046316966 8:112516603-112516625 TTAAATAGAAAGACAAAGCTTGG + Intronic
1046729458 8:117709519-117709541 TAAAATACAAAAATTTAGCTGGG + Intergenic
1047270659 8:123354675-123354697 TAAAATACAAAAATTTAGCTGGG + Intronic
1047730841 8:127726853-127726875 TTAAAAAAAAAAAATTAGCTGGG - Intergenic
1047944600 8:129862629-129862651 AAAAATAAAAAAATTCAGCTGGG - Intronic
1048000287 8:130374372-130374394 TAAAATAAAAGGATAGGGCTGGG + Intronic
1048012287 8:130467459-130467481 AAAAAAAAAAAGATTTAGCTTGG + Intergenic
1048070527 8:131016341-131016363 GTAAGTAAAAAGAATTAGCTAGG + Intronic
1048516803 8:135118694-135118716 TTAAAAATGAAGATTGGGCTGGG - Intergenic
1048619363 8:136114755-136114777 TAAAATACAAAAAATGAGCTGGG + Intergenic
1048703440 8:137121262-137121284 ATAAATAAATAGATAGAGGTTGG + Intergenic
1049821693 8:144637988-144638010 TTAAAAGGAAAGAATGAGCTGGG - Intergenic
1050524508 9:6533915-6533937 TTAAAAAAAAAGCATCAGCTGGG + Intronic
1050529779 9:6578410-6578432 TTAAAAAAGAAGAAAGAGCTGGG - Intronic
1050631815 9:7567506-7567528 TTAAATAAAAAGATGTTGTTTGG - Intergenic
1050833558 9:10047225-10047247 TTTAATAAATATATTGATCTAGG + Intronic
1051443439 9:17113490-17113512 TTAAATAAAAACACTCAGCTTGG - Intergenic
1051540022 9:18205123-18205145 TTAATAAAATAGGTTGAGCTTGG - Intergenic
1051561719 9:18449123-18449145 TTATATAAAAAGCATGAGTTGGG + Intergenic
1051663676 9:19448307-19448329 TTAAAAAAAAAGTTTGGGCCAGG - Intronic
1051735492 9:20194059-20194081 TCAGAGAAAAAGATTGAGCTGGG + Intergenic
1051897890 9:22007375-22007397 ATAAATAAATAAATAGAGCTTGG + Intronic
1052001961 9:23294846-23294868 ATAAATAAAAAGCATGAGATAGG + Intergenic
1052077087 9:24156657-24156679 TTAAAAAAAAAAATTTAGCCAGG + Intergenic
1052749671 9:32476915-32476937 TTCATTGAAAAGATTGGGCTGGG - Intronic
1052758873 9:32569377-32569399 AAAAATAAAAAAAATGAGCTGGG - Intronic
1052902568 9:33806216-33806238 TTAAATAAAAAAAAAGAGTTGGG - Intergenic
1053051732 9:34967035-34967057 TAAAAAAAAAAAATTTAGCTAGG - Intronic
1053354164 9:37432382-37432404 TTAAAAAAAAAGAGTGGGCCAGG + Intronic
1053491831 9:38512810-38512832 TTAATTAAAAAAATTTGGCTGGG + Intergenic
1053539124 9:38955537-38955559 CTAAATAAAAAAAATTAGCTGGG + Intergenic
1053657961 9:40239302-40239324 TTAAAAAAAGATATTCAGCTGGG - Intronic
1053837559 9:42157129-42157151 TTAAATAAAAAGATAGGGCCGGG - Intergenic
1053883469 9:42619028-42619050 TAAAATAAAAAGATAGGGCCGGG + Intergenic
1053889200 9:42675271-42675293 TAAAATAAAAAGATAGGGCCGGG - Intergenic
1054222489 9:62426495-62426517 TAAAATAAAAAGATAGGGCCGGG + Intergenic
1054228221 9:62482677-62482699 TAAAATAAAAAGATAGGGCCGGG - Intergenic
1054370082 9:64385578-64385600 TTAAAAAAAGATATTCAGCTGGG - Intronic
1054526635 9:66136919-66136941 TTAAAAAAAGATATTCAGCTGGG + Intronic
1054627017 9:67408382-67408404 CTAAATAAAAAAAATTAGCTGGG - Intergenic
1054677713 9:67875332-67875354 TTAAAAAAAGATATTCAGCTGGG - Intronic
1054974779 9:71129677-71129699 TTAAATAAAAATATTTATATAGG + Intronic
1054986503 9:71268083-71268105 TTAAATAATAAACTTGGGCTGGG + Intronic
1055193823 9:73562108-73562130 TTAAATATAAAGATATAGATAGG - Intergenic
1055389134 9:75800168-75800190 TTAAATAGAAAGTTTGGGCTGGG + Intergenic
1055468506 9:76588943-76588965 TTATAGAAAAAGTTTGGGCTGGG - Intergenic
1055749176 9:79485840-79485862 TAAAAAATAAAGAATGAGCTGGG - Intergenic
1055767329 9:79678403-79678425 TTAAAAAAAAAGATGAAGTTAGG - Intronic
1055826054 9:80326108-80326130 TTCAATAATAAGATTAAGCGAGG + Intergenic
1055959929 9:81810633-81810655 GTAAATAAATAGATGGAGCTGGG + Intergenic
1056347014 9:85706990-85707012 TTAAATATAAAGATAGAAATAGG + Intronic
1056466803 9:86864798-86864820 TAAAAGAAAAAGTTTTAGCTTGG - Intergenic
1056762096 9:89423175-89423197 AAAAAAAAAAAGTTTGAGCTAGG - Intronic
1056860813 9:90179625-90179647 TTTAATAAAATGATTGAGGCAGG - Intergenic
1056959007 9:91105467-91105489 CTAATTAAAAAGATTAATCTTGG + Intergenic
1057056750 9:91968286-91968308 TTAAATAAAAAGATGCAAATAGG + Intergenic
1057246918 9:93464300-93464322 TGAGATAAAAAGATTTACCTAGG + Intronic
1057672129 9:97102024-97102046 TTAATTAAAAAAATTTGGCTGGG + Intergenic
1057672576 9:97107019-97107041 TAAAATATAAAGACTTAGCTGGG + Intergenic
1058008293 9:99943602-99943624 TCAAATATAGAGATTCAGCTGGG - Intronic
1058222699 9:102322439-102322461 TTAAATACAAAGACTGAGATAGG + Intergenic
1058683748 9:107463152-107463174 TTAAATAAATAGGCTGAGCTTGG + Intergenic
1058915838 9:109564677-109564699 TTAAATATAAAGATACAGGTAGG - Intergenic
1059011322 9:110464729-110464751 TTAAATAAAACTATAGAGGTAGG + Intronic
1059136282 9:111809588-111809610 TTAAATATTAATATTTAGCTGGG - Intergenic
1059186045 9:112272055-112272077 AAAAATAAAAAGAGTGAGATGGG - Intronic
1059523259 9:114963730-114963752 TTAAAAAAAAAGATTTCCCTTGG - Intergenic
1059560486 9:115329950-115329972 TTGAATAAAATGATGGAGTTAGG - Intronic
1059571616 9:115443566-115443588 TTAAATAAAGTGATTTAGGTCGG + Intergenic
1060145535 9:121249314-121249336 TTAAATACAAAAATTTAGCCAGG + Intronic
1060296087 9:122343777-122343799 AAAAATAAAAAGAATTAGCTGGG - Intergenic
1060321670 9:122567608-122567630 GTAGATAAAAGGATTGAGCATGG + Exonic
1060511475 9:124237708-124237730 TTAAATAAAAATATTGAGCTAGG + Intergenic
1060605366 9:124909310-124909332 TTAAAAAAAAAAATGGGGCTGGG + Intronic
1061021526 9:128018731-128018753 CTAAAAAAAAAAATTGAGCTGGG - Intergenic
1061049282 9:128184981-128185003 TTAAAAAGAAATATTAAGCTGGG + Intronic
1061535256 9:131244095-131244117 ATAAATAAAAAGATTGATGCAGG - Intergenic
1061562064 9:131411094-131411116 AAAAATAAAAAGAATTAGCTGGG + Intronic
1062661259 9:137635365-137635387 TTAAAAAAAAAAAATTAGCTGGG - Intronic
1203703970 Un_KI270742v1:20098-20120 TTTAAAAAAAATATTCAGCTGGG - Intergenic
1185491620 X:521666-521688 TCAAAATAAAAAATTGAGCTGGG - Intergenic
1185624228 X:1471457-1471479 TTAAAAAAAAAAAATGGGCTGGG - Intronic
1185627789 X:1494533-1494555 TTAAAAAAAAAAAATGAGTTTGG + Intronic
1185665961 X:1765873-1765895 TTAAAAAAAAAAATGCAGCTGGG + Intergenic
1185668084 X:1784156-1784178 TTAAATAAAAACAGCTAGCTGGG + Intergenic
1185726154 X:2423429-2423451 ATAAATAAATAAAATGAGCTTGG + Intronic
1185913286 X:4006193-4006215 TCCAATAAAAAAATTGAGCTTGG - Intergenic
1186015804 X:5191991-5192013 TAAAAATAAAAGATTGAGCCAGG + Intergenic
1186400435 X:9253712-9253734 CTACATAAAAAAATTTAGCTGGG + Intergenic
1186605600 X:11087065-11087087 TTAAATATAAAGATGGAAATAGG - Intergenic
1186825611 X:13337132-13337154 TAAAATACAAAAATTTAGCTGGG - Intergenic
1187563045 X:20420301-20420323 TTAAAGACAAATATTGAGATTGG + Intergenic
1188287349 X:28343912-28343934 TTAAAAAAAAAAAACGAGCTGGG - Intergenic
1188351887 X:29142167-29142189 TTAAATAATAAGATTGAACAAGG - Intronic
1188355247 X:29182802-29182824 TTAAATAAAGATCTTGAGATGGG + Intronic
1189501175 X:41560593-41560615 TTAAAAAAAAATTTTGGGCTGGG + Intronic
1190046901 X:47119296-47119318 TTAAAAAAAAAAATTTAGCTGGG - Intergenic
1190069261 X:47266046-47266068 TTAAATAAAGAAGCTGAGCTGGG - Intergenic
1190224889 X:48537738-48537760 TTAAAAAAAAAAAATTAGCTGGG - Intergenic
1190762068 X:53445121-53445143 TTAAAAAAAAAAAATTAGCTGGG - Intergenic
1190769239 X:53501834-53501856 TTAAAAAAAAAAAATTAGCTGGG - Intergenic
1190784488 X:53631488-53631510 TTAAAAAAAAAGATATAGTTAGG + Intronic
1191764077 X:64677658-64677680 TTAAATAAAAATATTGAGATAGG - Intergenic
1191806724 X:65143721-65143743 TTAAAAAAAAAAAATTAGCTGGG - Intergenic
1192581856 X:72289737-72289759 TTAAATAAAAATAATTAGCCAGG - Intronic
1192588122 X:72336734-72336756 TTAAATAAAAAAATTAAAATGGG - Intronic
1192676947 X:73207716-73207738 TTTATTAAAAAGCTTCAGCTAGG + Intergenic
1192773933 X:74222446-74222468 AAAAATAAAAAGGTTGGGCTCGG + Intergenic
1192834423 X:74784023-74784045 TTTTATAAAATGATTGGGCTAGG + Intronic
1192990314 X:76446414-76446436 TTAAATATAAAAATAGAGATAGG - Intergenic
1193106494 X:77680400-77680422 TTAAAAAACAAGATTTTGCTGGG + Intronic
1193126308 X:77874276-77874298 TTTAAAAAAAAGATGCAGCTGGG - Intronic
1193243698 X:79204011-79204033 AAAAATAAAAAAATAGAGCTGGG + Intergenic
1193289767 X:79758465-79758487 TTAAATAAAAAGACTGAAGCTGG - Intergenic
1193614737 X:83673203-83673225 GTAAAAAAAAAGAATGAGTTAGG - Intergenic
1194447033 X:94001287-94001309 TTAAGTAAAAAAATTCTGCTTGG + Intergenic
1194541850 X:95182744-95182766 TAAAATACAAAAATTTAGCTGGG - Intergenic
1194667923 X:96696084-96696106 TTATTTAAAAAGGTTGGGCTGGG + Intronic
1194753322 X:97708029-97708051 TAAAATAAAAAGATTTAGACCGG - Intergenic
1194870384 X:99124455-99124477 ATTAATCAAAAGATTGAGATTGG + Intergenic
1194978223 X:100413962-100413984 TAAAATGAAAAGAATGAGCCAGG - Intergenic
1195122100 X:101765133-101765155 TTACATGAAAAAATTGAGGTTGG + Intergenic
1195533940 X:105989140-105989162 TTAAATATAAAGTCTCAGCTAGG - Intergenic
1195548106 X:106136327-106136349 TTAAATAAAATGTATTAGCTGGG + Intergenic
1195953623 X:110305820-110305842 TTAAAAAAAAAAAATCAGCTGGG + Intronic
1196203928 X:112917592-112917614 TTAAATTAAAAGATTTAAATTGG - Intergenic
1196694773 X:118600110-118600132 TTAAATGAGATGATGGAGCTGGG + Intronic
1198547186 X:137704809-137704831 TTCAATAAAAAAATTGAGCTGGG - Intergenic
1198766865 X:140089275-140089297 TTAAATAAAACAATTGAGTAGGG - Intergenic
1199004702 X:142682012-142682034 TAAAATAAGAATATTGAACTGGG - Intergenic
1199022870 X:142902908-142902930 TTATATACAAAAATTAAGCTAGG - Intergenic
1199179257 X:144834341-144834363 AGAAATAAAAAGAATGGGCTGGG + Intergenic
1199374890 X:147096759-147096781 CTATATAAACAGAGTGAGCTTGG + Intergenic