ID: 970910602

View in Genome Browser
Species Human (GRCh38)
Location 4:21270452-21270474
Sequence CTGTTTTACAATCAGTAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970910602_970910603 18 Left 970910602 4:21270452-21270474 CCATGCTACTGATTGTAAAACAG 0: 1
1: 0
2: 0
3: 12
4: 166
Right 970910603 4:21270493-21270515 TTAATTCATCAAATAGATCAAGG 0: 1
1: 0
2: 0
3: 27
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970910602 Original CRISPR CTGTTTTACAATCAGTAGCA TGG (reversed) Intronic
901255149 1:7818161-7818183 CTGTTTTCCAGTTAGTAGAATGG + Intronic
902583102 1:17421723-17421745 CTGTTTTAAAAACTATAGCAAGG + Intronic
903432084 1:23312686-23312708 CTGTTTTAAAAGCAGTAGCCTGG + Intronic
905022408 1:34826938-34826960 CTGCTTTACCAACTGTAGCAGGG - Intronic
907677724 1:56534109-56534131 CTGTATTACAAAGAGTATCATGG - Intronic
907943301 1:59109405-59109427 CTGTTTTTCAGACAGCAGCATGG - Intergenic
908722695 1:67143210-67143232 CTGTTCGAAAATGAGTAGCATGG + Intronic
909774964 1:79472491-79472513 CTGTTAGAAAATCTGTAGCAAGG + Intergenic
910270415 1:85387982-85388004 CTTTTTAACAATCAGTTCCAGGG + Intronic
911385500 1:97170283-97170305 CTGATTTACACTTAATAGCAAGG - Intronic
913472681 1:119205151-119205173 CTCCTTGACAGTCAGTAGCAGGG + Intergenic
915621083 1:157084717-157084739 CTGTTTTAAAATTAGGAACAAGG - Intergenic
916200494 1:162266613-162266635 ATGTTTAAGACTCAGTAGCAAGG - Intronic
918134854 1:181662691-181662713 CTGGTTTACACTCAGTAGGTGGG + Intronic
921664992 1:217858438-217858460 CTGTTTTGTAATCTGTAACATGG - Intronic
1063954258 10:11251550-11251572 CTGTTTTTCAAGCAGCAGCCTGG + Intronic
1064743187 10:18453945-18453967 CTGTTTTTAAACAAGTAGCATGG + Intronic
1065713508 10:28541053-28541075 CTATTTTACAATCAGTATTTTGG + Intronic
1066160441 10:32722277-32722299 CTGTTATACATTCAGTAGTTGGG + Intronic
1068730424 10:60351993-60352015 CTGTATTAAAATAAATAGCAAGG + Intronic
1068741732 10:60481180-60481202 CTGTTTGTCAAACAGTAGCAAGG + Intronic
1068884997 10:62088990-62089012 CTGTTTTACAACCCGAAGCATGG + Intronic
1069953811 10:72037421-72037443 CAGTTTTACTATCAGTGGCCAGG - Intergenic
1071353627 10:84771082-84771104 ATGTTTTACAATGACTTGCAAGG - Intergenic
1079331466 11:19536408-19536430 CTGGACCACAATCAGTAGCAAGG - Intronic
1081337336 11:41882816-41882838 CTGTTCTCCAAACAGTAGGAGGG + Intergenic
1082661019 11:55911456-55911478 CTGTTTTATGAGCAGCAGCAGGG - Intergenic
1083373830 11:62203614-62203636 CTCATTTACAATCAATAGCATGG + Intergenic
1084018212 11:66399694-66399716 CTGTTAAACAATCAATACCATGG - Intergenic
1084928196 11:72531253-72531275 CTGTTTTTGTATCAGTACCATGG + Intergenic
1085849874 11:80107917-80107939 CTGTTTTCCCATCTGTAGAATGG - Intergenic
1086810994 11:91309976-91309998 CTGTTTCACCATCAGAAACATGG + Intergenic
1087561738 11:99798629-99798651 CTGTTTTTACATCAGTACCATGG + Intronic
1087815983 11:102659563-102659585 CTGTTTTCCCATCAATAGAATGG - Intergenic
1088961584 11:114671772-114671794 CTGTTTTACAAGAAATAGCAAGG + Intergenic
1089719763 11:120404612-120404634 CGGGTTTACAATCAGTAGTCTGG + Intronic
1090724820 11:129515447-129515469 CTGTTTTGATATCAGTACCATGG + Intergenic
1095135470 12:38596006-38596028 CTGTATTTCAATCAGCAGAAAGG + Intergenic
1095636370 12:44438653-44438675 CAGTTTTACTATCTGTACCATGG + Intergenic
1098594971 12:72261783-72261805 CTTTTTTAGAATCAATAGCCTGG + Intronic
1101593612 12:106143752-106143774 CAGTTTTACGATGATTAGCAGGG - Intergenic
1102015382 12:109644797-109644819 CAGTTTCCCAATCTGTAGCATGG - Intergenic
1102197666 12:111036028-111036050 CTCATTTACAAACATTAGCAGGG - Intronic
1103733235 12:123042421-123042443 CTGTTTTTCCATGATTAGCAGGG + Intronic
1109078356 13:57865927-57865949 CTGTTTTTCTTTCTGTAGCATGG - Intergenic
1109220825 13:59639359-59639381 CTGTTTTAAAATCAGTTCCCAGG - Intergenic
1110355903 13:74567143-74567165 ACGTTTTACAATCAGTTGCATGG + Intergenic
1110393239 13:75000552-75000574 CTGTTTTTCCATCTGTAACATGG - Intergenic
1110884749 13:80618806-80618828 ATGTTTAGCAATCAGCAGCATGG + Intergenic
1111069646 13:83148223-83148245 CTATTTTACATCCAGTAGGATGG - Intergenic
1114872993 14:26680499-26680521 TTGTCTTACTATCAGTAGCCTGG + Intergenic
1115750496 14:36484787-36484809 CTGTATTACATTTAGTGGCAAGG + Intronic
1115789205 14:36859810-36859832 CTGTTTTACTATCATGAGCCAGG - Intronic
1117025702 14:51617812-51617834 CTGTTTCACTATCTGTAGAAGGG + Intronic
1118404418 14:65409794-65409816 CTGTTATACAACAAGTAACAGGG - Intergenic
1119304419 14:73595998-73596020 CTGTTCAACCATCAGTAGCAGGG + Exonic
1121168343 14:91831535-91831557 CTGTTTTAGAAAGAGTAGCTTGG + Intronic
1121229361 14:92345332-92345354 CTGTTTCACTGTCTGTAGCATGG + Intronic
1121382671 14:93487717-93487739 CTGCATTGCAATCATTAGCATGG - Exonic
1125400824 15:39301018-39301040 GTGATTTACTATCAGTAGCCTGG - Intergenic
1125612616 15:40982106-40982128 CTATTATACACTCAGGAGCAAGG + Intronic
1125735042 15:41918985-41919007 CTGTTCTCCAATCTGTACCATGG - Intronic
1130246535 15:82255336-82255358 CTGTATTGCAACCAGTAGGAAGG - Intronic
1130454113 15:84087800-84087822 CTTTATTACAACCAGTAGAAAGG + Intergenic
1131141862 15:89983076-89983098 CTGAATTACAATCAATAGGAGGG - Intergenic
1131451916 15:92548477-92548499 TTGTTGCACAATCAGTATCAGGG - Intergenic
1137777996 16:51072341-51072363 CTGTTTTCTCATCAGTAACACGG - Intergenic
1139316641 16:66076959-66076981 ATATTTTACAATTACTAGCAAGG - Intergenic
1139800914 16:69522007-69522029 CCCTTTTACAATAAGTAACATGG + Intergenic
1144090838 17:11854788-11854810 CTGTCTCACTTTCAGTAGCATGG + Intronic
1146963830 17:37008067-37008089 ATGTTTGAAAATCAGTAGAAAGG + Intronic
1147621742 17:41872628-41872650 CTGTTTTACAAACAGTATTTGGG - Intronic
1147760253 17:42793512-42793534 ATGTTTTAAGATCAGAAGCAGGG + Intronic
1151273629 17:73016072-73016094 CAGTTTTACTATCTGTATCATGG + Intronic
1152236146 17:79139901-79139923 CAGTTTTCCCATCAGTAACATGG - Intronic
1155705100 18:28800455-28800477 CTGAGATACAAACAGTAGCAAGG - Intergenic
1156490303 18:37492060-37492082 CTGTAATTCAATTAGTAGCAAGG - Intronic
1158533521 18:58285160-58285182 GGGCTTTACAAGCAGTAGCAGGG - Intronic
1159146117 18:64456528-64456550 CTGTTTTGGAACCAGTACCATGG - Intergenic
1167824848 19:51962853-51962875 CTGTTTTAGATACAGTAGGATGG - Intergenic
926492315 2:13539619-13539641 CTGTTGGACAATAAGGAGCAAGG + Intergenic
928250996 2:29679851-29679873 CTGTTTTACAATAAATACTAAGG - Intronic
929090894 2:38216359-38216381 CTACTTTGCACTCAGTAGCATGG - Intergenic
930517654 2:52428729-52428751 TTCTATTACATTCAGTAGCAGGG + Intergenic
932185378 2:69690865-69690887 TTGTTTTACAAACAGTACTAAGG - Intronic
933428495 2:82144267-82144289 CTGCTTTAAAATCAGTATTACGG + Intergenic
935764191 2:106348597-106348619 CTGTTTTTGTATCAGTACCACGG + Intergenic
936020837 2:108993752-108993774 CTTTTGTTTAATCAGTAGCAGGG - Intergenic
939168955 2:138671531-138671553 CTGTTTAACAAACAGGCGCAGGG + Exonic
939558265 2:143703019-143703041 CTGTTTTACAAGGAGTGGTAGGG - Intronic
940483067 2:154260432-154260454 TTATTTTAAAATCAGTAGGATGG + Intronic
942804622 2:179915634-179915656 CAGTTTTCCCATCAGCAGCACGG - Intergenic
943205082 2:184884581-184884603 CTGTTTTTGTATCAGTACCATGG - Intronic
945132377 2:206586622-206586644 TTGTTTTAAACTCTGTAGCAGGG + Intronic
945710258 2:213285904-213285926 CTGGTTACCATTCAGTAGCAAGG - Intronic
947059204 2:226143386-226143408 CTGTTTTATAAACATAAGCATGG - Intergenic
948691856 2:239711290-239711312 CTGTTATACAAGCAGAAGCCTGG + Intergenic
1169411458 20:5374000-5374022 CAGTTTTCCCATCAGTAGAAGGG + Intergenic
1177109402 21:17006497-17006519 CTGTTTTTGTACCAGTAGCATGG - Intergenic
1182078500 22:27511744-27511766 CTGTTTCTCCATCAGTAACATGG + Intergenic
1183105926 22:35615132-35615154 CTCTTTTACAATCAGAAGATTGG + Intronic
1184195236 22:42923149-42923171 CATTTTTAAAACCAGTAGCATGG - Intronic
1184478369 22:44733779-44733801 CTGTGTTACAATGAGTAGGTGGG - Intronic
949357735 3:3199649-3199671 CAGTTTTACTTTCAGCAGCATGG + Intergenic
950121737 3:10486289-10486311 CTGTTTTTCAAACAGCAGCCAGG + Intronic
951054286 3:18129234-18129256 CTGTTCTAGGATCAGAAGCATGG + Intronic
951614460 3:24525730-24525752 CTGTTTTACCATCTGTAAAATGG - Intergenic
953105038 3:39869659-39869681 CTGTTTTACCATCTGTAACATGG + Intronic
958109496 3:89121919-89121941 CTGTTTTACTGTAAGCAGCAGGG - Intronic
959214319 3:103430987-103431009 GTGTTTTACAATCTCGAGCAAGG - Intergenic
959256618 3:104023325-104023347 CTGTTTTTCTACCAGTACCATGG - Intergenic
962349154 3:134644211-134644233 CTGTTTCACAAACATTTGCAGGG + Intronic
965355667 3:167670120-167670142 CTGGTTTAGAATCTGGAGCAAGG + Intergenic
967667431 3:192189927-192189949 GTGTTTGACACTCAGGAGCAAGG + Intronic
969399776 4:6946691-6946713 CAGTTTTACCATCTGTAGAATGG - Intronic
970910602 4:21270452-21270474 CTGTTTTACAATCAGTAGCATGG - Intronic
971312167 4:25534757-25534779 CTGTTTTACCATCTGTAAAATGG + Intergenic
971774074 4:30937997-30938019 ATATTTTACAATCAGTGGTAAGG + Intronic
972590116 4:40477906-40477928 CACTTTTACTATCAGTAGAAGGG - Intronic
972877159 4:43376702-43376724 CTGTTTTTGTATCAGTACCACGG - Intergenic
976277642 4:83293868-83293890 CTCTTTTACAACCAGTTTCACGG + Exonic
979327122 4:119393337-119393359 CTTTTTTATAGTGAGTAGCATGG - Intergenic
979361542 4:119771281-119771303 CTGTTTTACAATCTGTTAAATGG - Intergenic
980066827 4:128198579-128198601 CTTTTGTACCATCAGTAGAAAGG + Intronic
980575150 4:134677894-134677916 CTGTTTTTGTATCAGTACCATGG + Intergenic
982655507 4:158143955-158143977 CTATTTTAATATCAGTAACAAGG - Intronic
983245004 4:165278025-165278047 CTTTTTTATAGTGAGTAGCATGG - Intronic
985075125 4:186206546-186206568 CAGTTTTACAGTGAGAAGCAGGG + Intronic
985211193 4:187596594-187596616 CTATTTCACAATCAGTAAAATGG + Intergenic
988687532 5:33539482-33539504 CTGTTTTACAACCAGCACCTTGG - Intronic
990527209 5:56639680-56639702 CTGTTTTATTATCAGTATCTGGG + Intergenic
993452149 5:88085370-88085392 CTGTTTTACACTTAGAAGTAAGG + Intergenic
993648947 5:90494576-90494598 CTGTGTTACAACCACTAGGATGG - Intronic
993960499 5:94291476-94291498 CTGTTTTGGAACCAGTAGCATGG + Intronic
995008801 5:107234172-107234194 CTGGTTTATAAGCAGTAGCTGGG - Intergenic
997974436 5:138431750-138431772 CTTTTTTACAAAAATTAGCAGGG + Intronic
998514201 5:142737895-142737917 CTGTTGTAGAATCATGAGCAAGG + Intergenic
998722418 5:144968762-144968784 CTATTTTAAAATCAGCAACAAGG + Intergenic
1000429934 5:161139346-161139368 CTGTTTTTCAGTCAGTTGCCTGG - Intergenic
1004561326 6:16754217-16754239 TTTTTTTAAAATCAGTAGCAGGG + Intronic
1005189666 6:23206260-23206282 CTGTTTTACAATCGTTCTCAGGG - Intergenic
1007100181 6:39240622-39240644 TAGTTTTAGAATCAGCAGCAGGG - Intergenic
1008310212 6:49959294-49959316 GTGTTTCACTATCACTAGCATGG + Intergenic
1008698774 6:54073691-54073713 CTGTTTCAGGATCAGCAGCATGG - Intronic
1010181237 6:73088586-73088608 GGGTTTTAGAATCAGTAACAGGG - Intronic
1013726975 6:113110677-113110699 CTTTTTTATAACGAGTAGCAGGG + Intergenic
1014560209 6:122880664-122880686 CTGTTTTAATACCAGTACCAAGG + Intergenic
1016627574 6:146190323-146190345 ATGTTTTAAAATTAGTAGCTTGG - Intronic
1021140268 7:17015830-17015852 TTGTTTTTCAATTAGTAACATGG - Intergenic
1023052965 7:36268831-36268853 CTGTTTCACCATCTGTAACAAGG - Intronic
1025824551 7:64999635-64999657 CTGTTTTTCTTTCTGTAGCACGG - Intronic
1028514752 7:91664815-91664837 CTGTTTCACCAACAGAAGCAAGG + Intergenic
1031170138 7:118283036-118283058 CTGTATTAAAATCTTTAGCAAGG - Intergenic
1031822051 7:126514446-126514468 CTGTTTTACTATCAGAAAAATGG + Intronic
1032809306 7:135394480-135394502 ATGTTTAACTTTCAGTAGCATGG - Intronic
1039116628 8:34098530-34098552 CTGTTTTTCAATAAGTTGAAAGG - Intergenic
1046432526 8:114147619-114147641 CTGTTCTAAAATCAAAAGCAAGG + Intergenic
1048153282 8:131915232-131915254 CTGTTTTATAATCAATAGCTCGG + Intronic
1048310510 8:133318930-133318952 CCTTTTTACAAGCAGTAGGAGGG + Intergenic
1049526241 8:143128123-143128145 CTGATTTACAAACAGCAGAAGGG - Intergenic
1053671046 9:40362018-40362040 CTGTTTTTCCATAAGTAGAAGGG + Intergenic
1054382163 9:64502078-64502100 CTGTTTTTCCATAAGTAGAAGGG + Intergenic
1054513567 9:66014281-66014303 CTGTTTTTCCATAAGTAGAAGGG - Intergenic
1054842481 9:69758687-69758709 CTGTTTTACAATCATCACCTTGG + Intronic
1055185410 9:73446417-73446439 ATATTTTACAATCAGAAGAAGGG - Intergenic
1055399125 9:75904589-75904611 CTGGTTTACACTCACTAGGATGG + Intronic
1056330771 9:85519458-85519480 CTGGTACACAAGCAGTAGCAGGG - Intergenic
1057810661 9:98254599-98254621 CTGTTTTCCTATCAGCAGCAAGG - Intronic
1059416004 9:114162891-114162913 CAGTTTTCCCATCAGTAGAATGG + Intronic
1059735162 9:117093137-117093159 CTGTTTTTCAATCTGAAACATGG - Intronic
1060081066 9:120645854-120645876 CTGCTTGACACTCAGCAGCAAGG + Intronic
1061650339 9:132042847-132042869 CTTTTATACAATCAATACCATGG - Intronic
1061763264 9:132865125-132865147 CTGTTTCACAATTAGAAGCCAGG - Intronic
1187840544 X:23482613-23482635 ATGATTTACAATCAGCAGCCAGG + Intergenic
1188489995 X:30727500-30727522 CTTTTTTATAGTGAGTAGCATGG + Exonic
1189353872 X:40297130-40297152 CTGTTTTGCTTTCATTAGCATGG - Intergenic
1191031096 X:55972993-55973015 CTGTTTTTGTATCAGTACCATGG - Intergenic
1195123237 X:101778920-101778942 CTTTTTTATAGTGAGTAGCATGG - Intergenic
1201226245 Y:11821455-11821477 ATGTTTTACAATCTGCAGAATGG + Intergenic