ID: 970915497

View in Genome Browser
Species Human (GRCh38)
Location 4:21328858-21328880
Sequence GGTGGTACTCACCATTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970915497_970915511 30 Left 970915497 4:21328858-21328880 CCAGGCCAATGGTGAGTACCACC 0: 1
1: 0
2: 0
3: 15
4: 117
Right 970915511 4:21328911-21328933 AGGCTACTTCAGTCACCTTGTGG 0: 1
1: 0
2: 2
3: 36
4: 321
970915497_970915503 3 Left 970915497 4:21328858-21328880 CCAGGCCAATGGTGAGTACCACC 0: 1
1: 0
2: 0
3: 15
4: 117
Right 970915503 4:21328884-21328906 CTACCCCAGGTGTTCACTCAAGG 0: 1
1: 1
2: 3
3: 41
4: 313
970915497_970915500 -10 Left 970915497 4:21328858-21328880 CCAGGCCAATGGTGAGTACCACC 0: 1
1: 0
2: 0
3: 15
4: 117
Right 970915500 4:21328871-21328893 GAGTACCACCTGGCTACCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 81
970915497_970915507 10 Left 970915497 4:21328858-21328880 CCAGGCCAATGGTGAGTACCACC 0: 1
1: 0
2: 0
3: 15
4: 117
Right 970915507 4:21328891-21328913 AGGTGTTCACTCAAGGCCCCAGG 0: 1
1: 1
2: 10
3: 85
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970915497 Original CRISPR GGTGGTACTCACCATTGGCC TGG (reversed) Intronic
900671773 1:3858810-3858832 GGTGCTGCTCACCTTGGGCCAGG + Exonic
900870406 1:5298142-5298164 GGTGACACTGCCCATTGGCCAGG - Intergenic
904861729 1:33542925-33542947 GGTGATACCCACCATTGTTCTGG - Intronic
910384496 1:86666271-86666293 GGCAGTACTCACCACAGGCCAGG + Intergenic
917632320 1:176902571-176902593 GGTGTTAGTCAGCATTGGCATGG + Intronic
919336664 1:196244559-196244581 GGTAGTACCCAACATTGGCCTGG + Intronic
919511558 1:198471992-198472014 GGCAGTACTCACCATGGGCTTGG + Intergenic
920300563 1:204986156-204986178 GGTGGCACACACCTTGGGCCTGG + Intronic
1067736057 10:48851774-48851796 GGTGGTACCCACCTTTGCCTGGG - Intronic
1068392351 10:56414448-56414470 GGCAGTACTCACCATGGGCCTGG - Intergenic
1075856217 10:125632227-125632249 GGTGGCACTCACATTTGGACTGG + Intronic
1078843029 11:15096708-15096730 GGTAGTACTCACCATGAGCCTGG - Intergenic
1079832077 11:25281013-25281035 AGTGGCACCCACCATTGCCCAGG - Intergenic
1081111388 11:39138028-39138050 AGTGGTGCTCTCCCTTGGCCTGG + Intergenic
1085642092 11:78199094-78199116 GGTCGTATTCACCATTGAGCAGG - Intronic
1086893778 11:92289027-92289049 TGCGGGACTCACCATTGGCTGGG + Intergenic
1087191804 11:95262499-95262521 GGTTGCACTCACCATGTGCCGGG - Intergenic
1087492332 11:98844576-98844598 GGCAGTACTCCCCATGGGCCAGG - Intergenic
1087498095 11:98916621-98916643 GGCAATACTCACCATGGGCCTGG - Intergenic
1087624238 11:100578635-100578657 GGTGGTATTCACCATGGGGAGGG - Intergenic
1088220644 11:107566604-107566626 TGTGGTACTCACCATTCCCCTGG - Intergenic
1089354831 11:117842707-117842729 AGGGGTACTTACCACTGGCCAGG + Exonic
1089616178 11:119696167-119696189 GGTGGTAATCACTTTAGGCCAGG - Intronic
1090308900 11:125717192-125717214 AGGGGTACCCACCATTGCCCAGG - Intergenic
1090916255 11:131165666-131165688 GGTTGCACTTTCCATTGGCCTGG + Intergenic
1091369252 11:135044976-135044998 GATGGAGCTCACCATTGGGCTGG + Intergenic
1093845374 12:23964962-23964984 CCTGGTGCTCACCATTGCCCAGG - Intergenic
1095279314 12:40331816-40331838 GGAGGTACTCACCATAGGATTGG + Intronic
1098683893 12:73395245-73395267 AGGGGTGCCCACCATTGGCCAGG + Intergenic
1099268123 12:80473939-80473961 GGTGGAACCCACCAGTTGCCAGG - Intronic
1100101584 12:91113611-91113633 GATGTGAATCACCATTGGCCAGG - Intergenic
1103537973 12:121646436-121646458 AATAGTACTCACCACTGGCCGGG - Intergenic
1103724016 12:122989060-122989082 GCTGGCACTCACCACTGTCCTGG - Intronic
1108099288 13:46936746-46936768 GGCAGTACTCACCACAGGCCTGG + Intergenic
1108458692 13:50643287-50643309 CCTGGAACTCTCCATTGGCCTGG + Intronic
1112865923 13:103898382-103898404 GGCAGTACTCTCCATGGGCCTGG + Intergenic
1114495221 14:23127368-23127390 TGGGATACTCAGCATTGGCCTGG - Intronic
1118444517 14:65839195-65839217 GATTGTACTCACCATGTGCCAGG + Intergenic
1118448876 14:65879046-65879068 TTTGGTAATCACTATTGGCCAGG + Intergenic
1120107682 14:80515482-80515504 GGCAGTACTCATCATGGGCCTGG - Intronic
1120600951 14:86508214-86508236 GGTGGTATTCAACATTGTCCTGG + Intergenic
1122038749 14:98967045-98967067 TGAGGTACTCAGGATTGGCCTGG + Intergenic
1122961968 14:105098038-105098060 GGAGGTGCCCACCATTGCCCTGG - Intergenic
1128966284 15:72061547-72061569 GGCAGTACTCACCACAGGCCTGG + Intronic
1129424119 15:75452216-75452238 GGTAGGACCCTCCATTGGCCAGG + Intronic
1129561801 15:76578062-76578084 GGCAGTACTCACCATAGGCCTGG + Intronic
1129642442 15:77393986-77394008 GGCAGTACTCACCACGGGCCTGG + Intronic
1130961747 15:88664028-88664050 AGTTGTACTCACCACAGGCCTGG + Intergenic
1135300607 16:21323548-21323570 GGTGGTTCCCAGCCTTGGCCAGG + Intergenic
1136647591 16:31635564-31635586 AGTGGTGCCCACCATTGCCCAGG - Intergenic
1136771146 16:32842371-32842393 AGGGGTACGCACCATTGCCCAGG - Intergenic
1137367123 16:47870316-47870338 GGTGGTACTCAGCAGTGGAGTGG - Intergenic
1141718130 16:85738779-85738801 CCTGGCACTCACCATGGGCCCGG + Intronic
1203073569 16_KI270728v1_random:1104484-1104506 AGGGGTACGCACCATTGCCCAGG - Intergenic
1145274963 17:21423719-21423741 GGTGGTAACCACCAGTGACCAGG + Intergenic
1145312817 17:21709619-21709641 GGTGGTAACCACCAGTGACCAGG + Intergenic
1146242496 17:31243597-31243619 GGCAGCACTCACCATGGGCCTGG - Intronic
1146507026 17:33414385-33414407 GTTGGTAATGCCCATTGGCCAGG + Intronic
1148807321 17:50270538-50270560 GGTGGCACTCACCTCGGGCCTGG - Intergenic
1153586127 18:6622483-6622505 GGTGGTTCTCACCATGCTCCTGG - Intergenic
1156008400 18:32470296-32470318 GCTGGGACTCACCGTTGTCCAGG + Exonic
1160406645 18:78651167-78651189 GGTTGTCTTCACCATAGGCCGGG - Intergenic
1165902765 19:39176418-39176440 GGTGGAGCTCCCCATTGGTCTGG + Intronic
1166512179 19:43416318-43416340 GGTGGCCGTCACAATTGGCCTGG - Intronic
925513348 2:4651990-4652012 GGTGCTAGTCCCCATTGGCATGG - Intergenic
930230635 2:48840847-48840869 GGTAGTACTCACCACAGGCTTGG - Intergenic
930664690 2:54090435-54090457 GGGGGTTCACAACATTGGCCAGG - Intronic
931088700 2:58863084-58863106 AGAGAGACTCACCATTGGCCTGG + Intergenic
933766670 2:85713979-85714001 GGTGGTTCTCAACCTTGGCTGGG + Intergenic
940829984 2:158456799-158456821 GCTGGCCCTCCCCATTGGCCCGG - Intergenic
942975673 2:182014831-182014853 GGCAGTACTCACCATGGACCTGG - Intronic
943237196 2:185337821-185337843 GGCAGTACTCACCATGGGCCTGG - Intergenic
944526450 2:200624564-200624586 GTTGGTCCTCACCATGTGCCTGG - Intronic
1174013765 20:47471557-47471579 TATGGTACTCAGCATTTGCCAGG + Intergenic
1174982102 20:55408005-55408027 GGCAATACTCACCATAGGCCTGG - Intergenic
1175277768 20:57783548-57783570 GGGGGTACTTTTCATTGGCCAGG - Intergenic
1183958171 22:41394960-41394982 GATGGTACTCACTGTAGGCCAGG + Intronic
1184256704 22:43291034-43291056 GGCTGTACTCACCATTGGAGCGG + Exonic
949449656 3:4171638-4171660 GGCAGTACTCAACATTGCCCTGG + Intronic
953739686 3:45526969-45526991 GGTGCCACTCACCCTTGGCTGGG - Intronic
968979595 4:3839560-3839582 GGTGGTGCTCGCCCCTGGCCAGG + Intergenic
970259835 4:14212786-14212808 AGGGGTACCCACCATTGCCCAGG - Intergenic
970695971 4:18677590-18677612 GGTGGTACTCAGCAGAGACCTGG + Intergenic
970915497 4:21328858-21328880 GGTGGTACTCACCATTGGCCTGG - Intronic
972379053 4:38501857-38501879 GGTGGTGCTCACCATGTGCCAGG - Intergenic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
976218322 4:82735366-82735388 GGTGGTACCCAACCTTGGACAGG - Intronic
977166883 4:93710868-93710890 GGCAGTACTCACCATGGGCCTGG - Intronic
978258339 4:106719172-106719194 GGTAGTACTCGCCACAGGCCTGG + Intergenic
979395076 4:120178110-120178132 GGCAATACTCACCATGGGCCTGG + Intergenic
981192841 4:141883658-141883680 GATGGTACTCACCTTTTGCATGG - Intergenic
981517287 4:145623609-145623631 TTTGGTAATCACTATTGGCCAGG + Intronic
982615398 4:157634304-157634326 GGTGAGACCCAGCATTGGCCTGG + Intergenic
986409523 5:7463367-7463389 AGTGGTGCTCACCATAGGCCTGG + Intronic
986587367 5:9332475-9332497 GCTGGTACTCACATTGGGCCAGG + Intronic
989860650 5:46371805-46371827 AGGGGTGCTCACCATTGCCCAGG + Intergenic
990180226 5:53152630-53152652 GATAGTACACACCATTGGGCTGG - Intergenic
990827922 5:59922708-59922730 GGTGGTACTCACTGTGGGCCTGG + Intronic
994026821 5:95093981-95094003 AGTGGTGCTGGCCATTGGCCTGG - Intronic
999471018 5:151855541-151855563 GGTGGGACTAACCACTGGCTGGG + Intronic
1001177696 5:169487124-169487146 GGCAGTACTCCACATTGGCCTGG + Intergenic
1005810432 6:29511120-29511142 GGTGAACCTCATCATTGGCCTGG - Intergenic
1009373539 6:62938711-62938733 GGTAGTACACACCGTGGGCCTGG - Intergenic
1009388087 6:63111307-63111329 GGTAGTACTCACCATGAACCTGG - Intergenic
1015747163 6:136522492-136522514 GATGGTACTCATCATTAGCCAGG + Intronic
1022404066 7:30070260-30070282 GGTGGAACTCTCCTTTGGCAAGG + Intronic
1023871237 7:44264083-44264105 GGTGGGACTCAGCACTGGGCAGG - Intronic
1028299506 7:89180440-89180462 GGCAGTACCCACCATTGGCCTGG - Intronic
1030966338 7:115996796-115996818 GATAGTACTCACCACAGGCCTGG + Intronic
1031721971 7:125187669-125187691 GGCAGTATTCACCATGGGCCTGG + Intergenic
1034023731 7:147673666-147673688 GGTGGTACTAACCATAGTTCTGG + Intronic
1034230376 7:149521141-149521163 GGTGGTGCTGACCAGAGGCCAGG + Intergenic
1035164329 7:156976084-156976106 GGTGTTTCTCTGCATTGGCCAGG + Intergenic
1040693394 8:49967068-49967090 GCTTATACTCACTATTGGCCAGG + Intronic
1041929598 8:63272290-63272312 GGAGGTTCTGACCAATGGCCAGG + Intergenic
1044066283 8:87703851-87703873 GATAGTACTCACCATGGTCCTGG + Intergenic
1046812310 8:118546243-118546265 AGTGCTACTCAACATTGTCCAGG - Intronic
1046997419 8:120539790-120539812 GGTGGTACTCATTATGAGCCAGG + Intronic
1047352385 8:124088311-124088333 GGCAGTACTCACCATGGGACTGG - Intronic
1049414445 8:142488888-142488910 GGTGGGCCTCACCATCCGCCAGG + Intronic
1050508265 9:6369437-6369459 GGTACTACTCCCCATGGGCCTGG + Intergenic
1053495372 9:38545096-38545118 GCTGGAGCTCTCCATTGGCCTGG - Intronic
1059839125 9:118192221-118192243 GGTTATAATCACCATGGGCCTGG + Intergenic
1187836206 X:23434863-23434885 TGTAGTATTCACCATGGGCCTGG + Intergenic
1189847987 X:45153891-45153913 GAAGGTACTCAGCATGGGCCTGG - Exonic
1190808298 X:53860644-53860666 GGTAGTACTTGCCATGGGCCTGG - Intergenic
1190840382 X:54138595-54138617 GGTGGGGCTCACCTTTGGCCAGG + Intronic
1192927131 X:75767072-75767094 GGCAGTACTCACCATGGTCCTGG + Intergenic
1193441086 X:81539670-81539692 GGCAGTACTCACCACAGGCCTGG + Intergenic
1195314777 X:103666712-103666734 GCTTGTACTCCCCATTGGCCTGG + Intergenic
1196619650 X:117807339-117807361 GGCAGTACTCTCCATGGGCCAGG + Intergenic
1197025035 X:121738176-121738198 GGCAGTACTCACCATGGGCTTGG + Intergenic
1200361569 X:155612637-155612659 GGTGGTACTCACCTTAACCCTGG - Intronic