ID: 970916184

View in Genome Browser
Species Human (GRCh38)
Location 4:21338002-21338024
Sequence ATGGTGGAGCAGAAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 811
Summary {0: 1, 1: 0, 2: 3, 3: 61, 4: 746}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970916184_970916189 3 Left 970916184 4:21338002-21338024 CCTTCCACTTTCTGCTCCACCAT 0: 1
1: 0
2: 3
3: 61
4: 746
Right 970916189 4:21338028-21338050 GGATATGTAGCTTTTGTCCTTGG 0: 1
1: 0
2: 1
3: 19
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970916184 Original CRISPR ATGGTGGAGCAGAAAGTGGA AGG (reversed) Intronic
900177708 1:1298165-1298187 AAGGTGAAGCAGGAAGTGGGTGG - Intronic
900715657 1:4141839-4141861 ATGGTGGAGTGGAGGGTGGACGG + Intergenic
900900461 1:5512478-5512500 ATGGTGGAAGAGAGAATGGAGGG - Intergenic
901195715 1:7438757-7438779 CTGGTGGAGCAGAAAGAGCATGG + Intronic
901748833 1:11393371-11393393 ATGGTGGAGCAGACATAGAAAGG + Intergenic
902014327 1:13295139-13295161 CTGGTGTACCAGAAAGTGGTGGG - Intergenic
902814276 1:18907355-18907377 GTCGAGGAGCAGAAAGAGGATGG + Exonic
902971324 1:20054067-20054089 ATGGAGGAGGACCAAGTGGAGGG - Intronic
903395700 1:23000326-23000348 ATGGTGGTGCAGGATATGGAAGG + Intergenic
904014604 1:27409920-27409942 GTGGTGGAGGAGGAGGTGGAGGG + Exonic
904576635 1:31509243-31509265 ATGGTGTAGCAGATGGTGGCAGG - Intergenic
904592802 1:31624734-31624756 AGGATGGATGAGAAAGTGGATGG + Intronic
905393199 1:37651154-37651176 ATTGTGGAGCAGCAGGTGGAAGG - Intergenic
905429567 1:37911675-37911697 ATGGTGGTGCAGGATATGGAAGG - Intronic
906000439 1:42420009-42420031 ACTGTGGAACAGAAAGTGGGGGG - Exonic
907038596 1:51237480-51237502 TGGGTGGAGCAAAAAGAGGAGGG - Intronic
907203382 1:52747455-52747477 ATGGTGTAGCAGAAAAAGTATGG + Intronic
907328675 1:53657469-53657491 CGGATGGAGCAGAATGTGGAAGG + Intronic
908206538 1:61856082-61856104 ATGGTGTAGCAGAAAGAAGTGGG + Exonic
908617386 1:65937314-65937336 ATTGTGGAGGGGAAAGTGGTTGG + Intronic
908721546 1:67131614-67131636 ATGGTGGAACAGAAAGGGGAAGG - Intronic
909506074 1:76391426-76391448 ATGCTGGAGAAGTCAGTGGAAGG + Intronic
909686546 1:78355211-78355233 AAGGAGGAGGAGAAAGGGGAGGG - Intronic
909729776 1:78876848-78876870 ATGGTGGTGCAGGATATGGAAGG - Intergenic
910283980 1:85532666-85532688 ATGGTGGAGCAGCATATGAAGGG + Intronic
911147685 1:94568397-94568419 ATGGTGGTGCAGGATATGGAAGG + Intergenic
912707861 1:111928269-111928291 ATGGTGCACTAGAAAGTGAACGG + Intronic
912711217 1:111951323-111951345 GTGGTGCAGGAGAAAGTGTATGG - Intronic
912815031 1:112822142-112822164 ATGGTGGTGCAGTATATGGAAGG + Intergenic
912939175 1:114030033-114030055 ATGGTGGTGCAGGATATGGAAGG - Intergenic
913037565 1:114986717-114986739 ATGGTGGAGTAGGAAGTGCCAGG + Intronic
913095438 1:115511713-115511735 ATGGTGGTGCAGGATATGGAAGG + Intergenic
913245472 1:116866661-116866683 ATGGTGGTGCAGGATATGGAAGG - Intergenic
913965807 1:143376841-143376863 ATGGTGGTGCAGAGAGTTGGGGG - Intergenic
914060181 1:144202449-144202471 ATGGTGGTGCAGAGAGTTGGGGG - Intergenic
914096167 1:144546003-144546025 ATGGTGCAGCAGGAATTTGATGG + Intergenic
914118969 1:144763920-144763942 ATGGTGGTGCAGAGAGTTGGGGG + Intergenic
914206038 1:145530319-145530341 ATGGTGGAGCAGCATATGAAGGG - Intergenic
914302355 1:146387959-146387981 ATGGTGCAGCAGGAATTTGATGG - Intergenic
914847900 1:151292919-151292941 CTGGTGGAGCAGATGGTGGATGG - Exonic
916329081 1:163594740-163594762 ATGGTGGTGCAGGATATGGAAGG - Intergenic
916688085 1:167165981-167166003 ATGGTTGAGCAGACAGTAGTGGG + Intergenic
917526094 1:175789785-175789807 ATGGTGGAGGGGGAAGTGGCTGG - Intergenic
917749953 1:178044146-178044168 ATGGTGGTGCAGGATATGGAAGG - Intergenic
918014048 1:180615660-180615682 ATGGTCGAGCCAAAAGAGGAGGG - Intergenic
919739533 1:200973581-200973603 GGGGTGGAGGACAAAGTGGAGGG + Intronic
920427029 1:205886626-205886648 ATGGTGGTGCAGGATATGGAAGG + Intergenic
920901308 1:210112803-210112825 ATGGTGGTGCAGGATATGGAAGG + Intronic
920908336 1:210191667-210191689 ATGGTGGTGCAGGATATGGAAGG - Intergenic
921205425 1:212844726-212844748 ATGGTGGTGCAGGATATGGAAGG - Intronic
921289598 1:213645190-213645212 ATGACGGAGCAGAAAGAGGTGGG + Intergenic
921685995 1:218089789-218089811 ATGGTGGAGTGGAGAGAGGAGGG - Intergenic
921873295 1:220165599-220165621 ATGGTGGAGCTGAGACTGGTTGG + Intronic
922363252 1:224841978-224842000 ATGGTGGTGCAGGATATGGAAGG + Intergenic
922770274 1:228178140-228178162 ATGTGGGCTCAGAAAGTGGAAGG - Exonic
922935102 1:229416554-229416576 ATGGTGGTGCAGAATATGAAAGG - Intergenic
922975391 1:229779624-229779646 ATGGTGGAGCCAAAGGTGGAAGG - Intergenic
923224233 1:231924342-231924364 ATGTTGGAACCGGAAGTGGAAGG + Intronic
924003928 1:239586038-239586060 ATGGAAGAGTAGAAAGTGGATGG - Intronic
924895897 1:248337765-248337787 ATGGTGGTGCAGAATATGAAAGG + Intergenic
1063246090 10:4220281-4220303 ATGCTGGGGCAGAAAAAGGAAGG - Intergenic
1063989550 10:11545215-11545237 AGGGTGGGGCAGAGAGGGGAGGG - Intronic
1065718923 10:28605782-28605804 AAGTTGGAGAAGAAAGTGCAAGG - Intronic
1065984500 10:30936324-30936346 ATGCTTAACCAGAAAGTGGATGG - Intronic
1066444150 10:35466384-35466406 TTGCTGGAGCAGAAAGTGTGCGG + Intronic
1066622674 10:37374745-37374767 GTGGGGGAGCAGACAGTGAATGG - Intronic
1066622679 10:37374772-37374794 CTGGGGGAGCAGACAGTGAATGG - Intronic
1067360631 10:45574932-45574954 ATGGTGGTGCAGGATATGGAAGG - Intronic
1067799600 10:49349923-49349945 GAGGTGGAGCAGAAAGAGGAAGG + Intergenic
1068124606 10:52823837-52823859 ATGGTGGAAGACAAAGAGGAAGG + Intergenic
1068285172 10:54924142-54924164 ATGGTGAAGCAGGAAGTGGGGGG + Intronic
1068360576 10:55972107-55972129 AGGGTGGTGCAGAAATTGAAAGG - Intergenic
1068467400 10:57412597-57412619 ATGTTGGAGCTGAAACCGGAAGG - Intergenic
1068680352 10:59812752-59812774 ATGGTGGAGCAGAGACGGGCTGG + Exonic
1069102849 10:64344696-64344718 TTAGTGGAGGAGACAGTGGAGGG + Intergenic
1069729823 10:70603345-70603367 TAGGTTGAGCAGGAAGTGGATGG - Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070335709 10:75453697-75453719 TTGGTGGAGCAGAAGGTGAGAGG + Intronic
1070893749 10:79964192-79964214 ATGGTGGTGCAGGATATGGAAGG - Intronic
1071387260 10:85133906-85133928 ATGGGGGAGAAGCAAGTGAAGGG + Intergenic
1071709882 10:88039602-88039624 ATGGGGGAGAAGAAAACGGAGGG + Intergenic
1071822030 10:89288847-89288869 ATGGTGGTGCAGGATATGGAAGG - Intronic
1072497457 10:95976248-95976270 ATGGGTGAGCAGAAAGTGGAGGG - Intronic
1072884770 10:99263387-99263409 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1073083777 10:100875548-100875570 ATGGTGGAAGTGGAAGTGGAGGG + Intergenic
1073395018 10:103210449-103210471 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1073415605 10:103379163-103379185 ATGGTGGATCAGAAACCAGAAGG - Intronic
1074689953 10:115995275-115995297 CTGGTGGAGGGGTAAGTGGACGG + Intergenic
1074910570 10:117904986-117905008 ATGGTGGAGTAGGAAGAGGCTGG + Intergenic
1075065836 10:119288299-119288321 CAGGGGGAGGAGAAAGTGGAGGG + Intronic
1075349801 10:121713583-121713605 GTGGTGGCGCAGAAAGATGATGG - Intergenic
1075699368 10:124459128-124459150 GTGGTGGAGCAGAAAGCAGGAGG + Intergenic
1075923948 10:126235687-126235709 AATCTGGAGCAGAAAGTGGGAGG - Intronic
1076065461 10:127444494-127444516 CTGGAGGGGCAGAAAGTGCAGGG + Intronic
1076934383 10:133557797-133557819 CTGGTAGAGCAGAAAGAGGCAGG - Intronic
1077418969 11:2440612-2440634 ATGGGGGTGCAGATTGTGGAGGG - Intergenic
1077701106 11:4443482-4443504 AGGGTGGAGAAGGAAGGGGAGGG + Intergenic
1077701144 11:4443577-4443599 AGGGTGGAGAAGGAAGGGGAGGG + Intergenic
1077701151 11:4443596-4443618 AGGGTGGAGAAGGAAGGGGAGGG + Intergenic
1078043737 11:7893703-7893725 TTGTTGGAGCAGAGAGTGGATGG + Intergenic
1078489031 11:11752278-11752300 AGGGTGGAGCAGAATTTGAAGGG - Intergenic
1078791397 11:14546294-14546316 AGGGTGGAGAAAAAAGGGGAGGG - Intronic
1079349333 11:19679574-19679596 ATGGTGGGGTAGAGAGGGGAAGG - Intronic
1079408570 11:20165676-20165698 ATGATGGAGCATAGAGGGGAAGG - Intergenic
1079745679 11:24125830-24125852 ATGAGGGAGCAGAAAGATGAAGG + Intergenic
1079847361 11:25488544-25488566 ATGGTGGTGCAGAATATGGAAGG + Intergenic
1080596385 11:33777375-33777397 ATGGTAGATCAGAAAGCAGAAGG + Intergenic
1080994223 11:37580566-37580588 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1081160053 11:39738956-39738978 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1081622928 11:44629621-44629643 ATGGTGGAGCAGGAAATTGTTGG + Intergenic
1082201624 11:49378101-49378123 CTTGTGGAGCAGAATATGGAAGG - Intergenic
1084354535 11:68628696-68628718 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1084909352 11:72375221-72375243 AGGGTGGAGGAGGAATTGGAGGG - Intronic
1085530584 11:77189875-77189897 ATGGTGGAGCTGAGAGGGTAGGG + Intronic
1085570537 11:77554427-77554449 ATGGTGGTGAAGGATGTGGAAGG - Intronic
1085750837 11:79159829-79159851 GTGGTGGAAGAGGAAGTGGAAGG - Intronic
1085750982 11:79160976-79160998 GTGGTGGAAGAGGAAGTGGAAGG - Intronic
1085816041 11:79738663-79738685 ATGCTTGAGCAGCAAGTTGAAGG + Intergenic
1086133375 11:83422825-83422847 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1086134516 11:83432947-83432969 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1086135962 11:83444236-83444258 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1086654045 11:89328124-89328146 TTTGTGGAGCAGAATATGGAAGG + Intronic
1086658355 11:89385157-89385179 ATGGTGGTGCAGGATATGGAAGG - Intronic
1086825525 11:91490363-91490385 AGGAAGGAGCAGAAAGAGGAAGG - Intergenic
1087167750 11:95021818-95021840 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1087197200 11:95313691-95313713 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1087510590 11:99087515-99087537 ATGTTGCAGGAGGAAGTGGAAGG + Intronic
1087548240 11:99612272-99612294 AAGATGCAGCAGAAAGTGAATGG + Intronic
1087922383 11:103881303-103881325 ATGGTAGAGGAAAATGTGGAAGG - Intergenic
1088207705 11:107413216-107413238 ATGGAGGGGCAGGAAGTGTATGG + Intronic
1088912329 11:114201060-114201082 ATGGTGGAGCAGAAAGCGATAGG - Intronic
1089030262 11:115319376-115319398 ATGGTGAAGCAGAAAAAAGAAGG + Intronic
1089126017 11:116177142-116177164 AAGATGTAGCAGAAAGAGGAGGG + Intergenic
1089597232 11:119588366-119588388 AACCTGGAGCAGGAAGTGGAAGG - Intergenic
1089691490 11:120189402-120189424 ATGGGAGGGCAGGAAGTGGATGG + Intergenic
1089953655 11:122551508-122551530 ACGGTGGTGCAGAATATGGAAGG - Intergenic
1090224683 11:125063057-125063079 GTGGTGAGGCAGAAAGTGCAGGG + Intronic
1090286176 11:125501425-125501447 GTGGTAGAGCAGACATTGGATGG - Intergenic
1090633552 11:128671545-128671567 ATGATGGATCTGAAAGTAGAAGG + Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091470287 12:720567-720589 ATGGTGGAGGGCAAAGGGGAAGG + Intergenic
1091796585 12:3300788-3300810 ATGGAGGAGCAGAGACTGCATGG + Intergenic
1092205779 12:6613623-6613645 ATGGTGGTGCAGAATGGGGAGGG - Intergenic
1093230864 12:16540211-16540233 AGGGTGGAGAAGGAAGAGGAAGG - Intronic
1093315727 12:17647507-17647529 ATGGTGGAGCAGGAGGGGGTGGG - Intergenic
1093358775 12:18199504-18199526 ATGGTGGTGCAGAATATGAAAGG - Intronic
1094400992 12:30060368-30060390 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1094826071 12:34270114-34270136 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1095304496 12:40623899-40623921 GTGGTGGAGCAGAGAGAGTAAGG + Intergenic
1095339359 12:41070106-41070128 ATGGAGCCGCAGAAATTGGAAGG - Exonic
1095806441 12:46325264-46325286 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1095980986 12:47974722-47974744 CTGGTGGAGCAGCAAGAGCAAGG - Exonic
1095998700 12:48111448-48111470 ATGGTGGTGCAGGATATGGAAGG + Intronic
1096553398 12:52388951-52388973 CTGGTGGAGGTGAAAGGGGAAGG + Intergenic
1096647325 12:53045971-53045993 ACCCTGGAGCAGAAGGTGGAGGG - Intergenic
1096666218 12:53167362-53167384 ATGGTTGAGCTGAGACTGGAAGG - Intronic
1096883788 12:54696673-54696695 ATGGTGAAGCAGAAAGAGAGTGG + Intergenic
1097098838 12:56571749-56571771 ATGGATGAGCAGGAACTGGAGGG + Exonic
1097541875 12:60953303-60953325 ATGGTGGTGCAGAATATGAAAGG + Intergenic
1097968110 12:65603213-65603235 AGGGTGGAGCAGGAAGGGAAGGG - Intergenic
1098495425 12:71129550-71129572 AAGGTGAAGCAGGGAGTGGAAGG - Intronic
1099492209 12:83301276-83301298 TTGGTGTACCAGAAAGTTGACGG + Intergenic
1100420135 12:94424511-94424533 ATGGATGAGCAGGAACTGGAGGG - Intronic
1100449151 12:94688702-94688724 GTGGTGGAGTAGTAAGTAGATGG - Intergenic
1100604889 12:96143529-96143551 AGGGCAGAGCAGAAAGAGGAAGG + Intergenic
1100940628 12:99719670-99719692 ATGGTGGTGCAGAATATGGAAGG - Intronic
1101944997 12:109129928-109129950 TTGGTGCAGCAGGAAGGGGAAGG + Intronic
1102604830 12:114060390-114060412 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1103893150 12:124254872-124254894 CTGTTGGAGCTGAAAGAGGAGGG + Intronic
1104005590 12:124890044-124890066 ATGGTGGAGCAGCAGGAGGTGGG - Intergenic
1104056279 12:125233317-125233339 ATGGCAGAGCAGAAACTAGAAGG - Intronic
1104257934 12:127156125-127156147 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1105032613 12:132894571-132894593 ATGGTGGTGCAGAATATGGAAGG - Intronic
1105597286 13:21850982-21851004 GGGGTGGAGAAGAAAGTGAATGG - Intergenic
1105979165 13:25501085-25501107 ATGGTTGGGCAGAAAGGGGGAGG + Intronic
1106022195 13:25926204-25926226 ATGGTGGAGCACAGAGTACAAGG - Intronic
1106264447 13:28097729-28097751 ATGATTCAGGAGAAAGTGGAGGG - Intronic
1106334052 13:28766429-28766451 ATTGTAGAGCAGCATGTGGATGG + Intergenic
1106505014 13:30363677-30363699 ATGGTGTAGGAGAAAAAGGATGG - Intergenic
1106747367 13:32719536-32719558 ATGGTGGGGCAGGGAGTGGGGGG - Intronic
1107689025 13:42933579-42933601 ATGGTTGACCAGAAGGTTGAAGG - Intronic
1108164858 13:47681835-47681857 ATGGTGAAGTAGACAGAGGAGGG + Intergenic
1108328434 13:49359065-49359087 ATGGTGGAGTAGAAAGACAAGGG + Intronic
1108362128 13:49677489-49677511 ATGGTGCAGCCTAAAGTGGTGGG - Intronic
1108803585 13:54129216-54129238 ATGGTGGTGCAGAATATGGAAGG + Intergenic
1108813388 13:54259345-54259367 TTGTGGGAGCAGATAGTGGAAGG - Intergenic
1108899292 13:55379549-55379571 ATGGGGGAGAAGAAAATGAAAGG - Intergenic
1109071847 13:57779419-57779441 ATGGTGGAGGAGAGAATGAAAGG - Intergenic
1109353225 13:61209186-61209208 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1110558451 13:76886024-76886046 ATCGTGGAGCTGAACGTGGGGGG - Exonic
1110845631 13:80187860-80187882 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1110978763 13:81870360-81870382 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1111265686 13:85809242-85809264 ATTGTGGAGTAGAAAGGAGATGG - Intergenic
1111739715 13:92188788-92188810 ATGCTGAACCAGAAAGTGGAAGG - Intronic
1112361611 13:98724077-98724099 GTGGTGGAGTCAAAAGTGGATGG - Intronic
1112487792 13:99835439-99835461 ATGGAGGAAGAGAGAGTGGAGGG + Intronic
1112720796 13:102242470-102242492 ATCTTATAGCAGAAAGTGGAAGG + Intronic
1114067243 14:19071972-19071994 AAGATGGAGCTCAAAGTGGATGG + Intergenic
1114095017 14:19328055-19328077 AAGATGGAGCTCAAAGTGGATGG - Intergenic
1114222016 14:20705117-20705139 ATGGTGGTGAAGGATGTGGAAGG - Intergenic
1115496776 14:34012603-34012625 AGGATGGGGCAGGAAGTGGATGG + Intronic
1115555613 14:34543005-34543027 ATGGTAGAGCAGACGGAGGAGGG - Intergenic
1115558295 14:34560088-34560110 ATGGTAGAGCAGACGGAGGAGGG + Intergenic
1115577517 14:34725549-34725571 ATGATGGAGCAGAAAGAGAGAGG + Intergenic
1115934537 14:38536925-38536947 AGGGTGCAGCAGCCAGTGGAGGG + Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1117174471 14:53132622-53132644 ATGGTGGTGCAGGATATGGAAGG - Intronic
1118763150 14:68892820-68892842 ATGGTGGTGGAGAAGGTGGAGGG + Intronic
1118769283 14:68931050-68931072 CGGGTGGAGCAGAAAGTGTGAGG - Intronic
1119179313 14:72594255-72594277 GTGGTGGAGGAGGCAGTGGAAGG - Intergenic
1119631668 14:76237482-76237504 AGGCAGGAGCAGAAAGGGGAAGG - Intronic
1120539281 14:85734502-85734524 ATGGTGGTGCAGAATATGAAAGG + Intergenic
1120708595 14:87770735-87770757 TGGGTGGTGCAGAGAGTGGAAGG - Intergenic
1121766788 14:96494720-96494742 ATGGGGGAGCAGCAGGTAGAGGG - Intergenic
1121980316 14:98448804-98448826 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1122381050 14:101307328-101307350 ATGGTGGGGCAGGATATGGAAGG + Intergenic
1122507959 14:102244010-102244032 ATGGTGGGGCAGGATATGGAAGG - Intronic
1122765654 14:104067806-104067828 ATGGTGGAGCAGAAGAGAGAGGG + Intergenic
1122992603 14:105244502-105244524 AGGGTGGAGGAGGAAGTGGTGGG + Intronic
1125353167 15:38788998-38789020 GAGGTGGAGGAGAAAGGGGAGGG - Intergenic
1125709275 15:41771356-41771378 ATGGTGGTGCATTAAGAGGATGG + Intronic
1126368423 15:47920293-47920315 AAGGTGGACAAGAGAGTGGAAGG - Intergenic
1126413821 15:48397714-48397736 GTGGTGGCTCAGAAAGTGGAAGG - Intergenic
1126488639 15:49211676-49211698 ATGGTGGAAGACAAAGGGGAAGG + Intronic
1126844086 15:52743133-52743155 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1126966615 15:54061676-54061698 ATGGTGCAAGAGAAAGTAGAAGG + Intronic
1127818370 15:62632790-62632812 GTGGTTGTGCAGAATGTGGAGGG + Intronic
1129259698 15:74358017-74358039 ATGGTGGTGCAGGATATGGAAGG - Intronic
1129457656 15:75684170-75684192 CTGGTGGAACAGAAAGGGCATGG - Intronic
1129678249 15:77643809-77643831 ATGCTGGAGCAGGAAGAGGTGGG - Intronic
1129726145 15:77902789-77902811 CTGGTGGAACAGAAAGGGCATGG + Intergenic
1130056820 15:80533293-80533315 AGTGTGGAGCAGGAAGTGGAAGG + Intronic
1130274201 15:82468152-82468174 CTGGTGGAACAGAAAGGGCATGG + Intergenic
1130466546 15:84195526-84195548 CTGGTGGAACAGAAAGGGCATGG + Intergenic
1130497718 15:84478010-84478032 CTGGTGGAACAGAAAGGGCATGG - Intergenic
1130588843 15:85200119-85200141 CTGGTGGAACAGAAAGGGCATGG + Intergenic
1131066103 15:89435876-89435898 ATGGAGGAGCAGTAAGTCCATGG - Intergenic
1131551566 15:93361827-93361849 ATGGTTGAGCAAAAGGTGGTGGG - Intergenic
1132038218 15:98503856-98503878 ATGGGGGAGCAAAAAGGGGCAGG - Intronic
1132906777 16:2286541-2286563 ATGGTGGAGGAGGATGTGGCAGG + Intronic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133869262 16:9672619-9672641 ATGGTGGTGCAGAATATGAAAGG + Intronic
1133919102 16:10136117-10136139 ATGGTGGAGCAGAGTGTAAAAGG - Intronic
1134031750 16:10997682-10997704 CAGGTAGAGCAGAAAGTGAAAGG + Intronic
1134165703 16:11927624-11927646 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1134495031 16:14726185-14726207 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1134500415 16:14765305-14765327 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1134526955 16:14951917-14951939 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1134545448 16:15104433-15104455 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1134545461 16:15104504-15104526 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1134580165 16:15363745-15363767 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1134714543 16:16350451-16350473 AGGGTGGAGCTGAGGGTGGAAGG - Intergenic
1134722418 16:16393815-16393837 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1134945009 16:18318054-18318076 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1134952273 16:18358207-18358229 AGGGTGGAGCTGAGGGTGGAAGG + Intergenic
1135025123 16:18993747-18993769 ATGGTGGTGCAGGATATGGAAGG + Intronic
1135134350 16:19876590-19876612 ATGGCTGAGCAGGAAGTGGGAGG - Intronic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135310704 16:21402736-21402758 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135310725 16:21402862-21402884 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135310747 16:21402988-21403010 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310769 16:21403114-21403136 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310791 16:21403240-21403262 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310837 16:21403505-21403527 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310858 16:21403631-21403653 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310880 16:21403757-21403779 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310901 16:21403883-21403905 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310918 16:21404009-21404031 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310935 16:21404113-21404135 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310958 16:21404240-21404262 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310998 16:21404479-21404501 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135311021 16:21404603-21404625 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135311043 16:21404729-21404751 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363652 16:21835170-21835192 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363674 16:21835296-21835318 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363696 16:21835422-21835444 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363718 16:21835548-21835570 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135363740 16:21835674-21835696 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363762 16:21835800-21835822 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363785 16:21835939-21835961 AGGGTGGAGCTGAGTGTGGAAGG + Intronic
1135363807 16:21836065-21836087 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363829 16:21836191-21836213 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363851 16:21836317-21836339 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363868 16:21836443-21836465 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363885 16:21836550-21836572 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363907 16:21836676-21836698 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363929 16:21836802-21836824 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363951 16:21836928-21836950 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363972 16:21837054-21837076 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363994 16:21837180-21837202 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135447847 16:22534168-22534190 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135447869 16:22534294-22534316 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135447890 16:22534420-22534442 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135447930 16:22534660-22534682 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135447947 16:22534764-22534786 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135447964 16:22534890-22534912 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135447986 16:22535016-22535038 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135448007 16:22535142-22535164 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135448029 16:22535268-22535290 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135448050 16:22535394-22535416 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135448096 16:22535659-22535681 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135448118 16:22535785-22535807 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135448140 16:22535911-22535933 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1136233025 16:28898507-28898529 GTGGTGGAGCTGTGAGTGGATGG - Intronic
1136307450 16:29381937-29381959 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307472 16:29382063-29382085 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307494 16:29382189-29382211 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307517 16:29382328-29382350 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307539 16:29382454-29382476 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307561 16:29382580-29382602 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307583 16:29382706-29382728 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307605 16:29382832-29382854 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307627 16:29382958-29382980 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307645 16:29383084-29383106 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307663 16:29383209-29383231 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307684 16:29383335-29383357 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307705 16:29383461-29383483 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307726 16:29383587-29383609 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307747 16:29383713-29383735 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307767 16:29383839-29383861 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307791 16:29383977-29383999 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136320974 16:29484141-29484163 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1136320995 16:29484267-29484289 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1136321017 16:29484393-29484415 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1136321042 16:29484532-29484554 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1136321064 16:29484658-29484680 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1136321086 16:29484784-29484806 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136321108 16:29484910-29484932 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136321140 16:29485143-29485165 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136321162 16:29485269-29485291 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136321186 16:29485407-29485429 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435547 16:30223481-30223503 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435568 16:30223607-30223629 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435590 16:30223733-30223755 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435612 16:30223859-30223881 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435634 16:30223985-30224007 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435654 16:30224111-30224133 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435679 16:30224250-30224272 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435701 16:30224376-30224398 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435723 16:30224502-30224524 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435755 16:30224735-30224757 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435777 16:30224861-30224883 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435799 16:30224987-30225009 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435821 16:30225113-30225135 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435843 16:30225239-30225261 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435867 16:30225377-30225399 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136530253 16:30863381-30863403 ATGGTGGTGCAGGATATGGAAGG - Intronic
1137896359 16:52216946-52216968 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1138656130 16:58492469-58492491 ACGGTGGAGCAGATAATGGCAGG - Intronic
1138773026 16:59687513-59687535 ATGGTGGAGCAGGAGGAAGAGGG + Intergenic
1141075593 16:81004252-81004274 ATGGTGGAAACGAAAGTGAAAGG + Intronic
1143287325 17:5800063-5800085 AAGGTGGAGGAGAAGGAGGAAGG - Intronic
1143734040 17:8897834-8897856 ATGGTGGAGTGGAAAGATGAGGG + Intronic
1143755089 17:9061191-9061213 CTGGTGGAGGAGGAAGGGGAGGG + Intronic
1144772843 17:17769470-17769492 CTGGAGGAGCAGAAAGTAGTAGG + Intronic
1145293227 17:21566702-21566724 ATGCTGGAGGGGAAAGAGGAAGG + Intronic
1146932841 17:36790364-36790386 ATGGTGGTGTAGACAGTGGATGG + Intergenic
1148039278 17:44693507-44693529 ATGTTAGAGCAGAAAGTAAATGG + Intergenic
1149341331 17:55689261-55689283 ATGAAGGAACTGAAAGTGGATGG - Intergenic
1150305329 17:64079815-64079837 ATGGAGGAATAGAGAGTGGAGGG + Intronic
1151423682 17:74015797-74015819 CTGGAGGTGGAGAAAGTGGAAGG + Intergenic
1151503058 17:74504748-74504770 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1151555539 17:74844670-74844692 ATGGTGGGGCGGGGAGTGGAGGG + Intronic
1151569537 17:74919406-74919428 ATGGAGGAGCAGGAGTTGGAAGG - Intronic
1152577267 17:81148352-81148374 AGGGTGGAGGAGCAAGTGGGAGG - Intronic
1153417215 18:4859942-4859964 GTCATGGTGCAGAAAGTGGAGGG + Intergenic
1153584091 18:6603352-6603374 ATGGTGGAGCAGATAGCAAATGG + Intergenic
1153950494 18:10054126-10054148 ATGGAGGAGCAGGTAGGGGAGGG + Intergenic
1155356916 18:24961812-24961834 AGGATGGAGCAGAAAGGCGAAGG + Intergenic
1155941833 18:31807981-31808003 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1156302573 18:35848307-35848329 ATGGTGGTGCAGAATATAGAAGG - Intergenic
1156513201 18:37659001-37659023 ATGGTGGACCAGACAGTGGCAGG - Intergenic
1156535899 18:37864231-37864253 AATTTGTAGCAGAAAGTGGAAGG + Intergenic
1156709230 18:39922468-39922490 AATGTGGAGAAAAAAGTGGAAGG + Intergenic
1156916115 18:42465796-42465818 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1157436543 18:47674897-47674919 TTGATGGAGGGGAAAGTGGAAGG + Intergenic
1157502401 18:48200801-48200823 CTGGCGGAGCAGAAAGTAGATGG + Intronic
1157714823 18:49876847-49876869 ATGCTGGAGCAGAGGGTGGAGGG - Intronic
1158464843 18:57680896-57680918 ATGTGAGAGCAGAATGTGGAAGG - Intronic
1158547594 18:58409413-58409435 AGGGTCAAGTAGAAAGTGGAAGG + Intergenic
1160392649 18:78546907-78546929 ATGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160408960 18:78661689-78661711 TGGGTGGAGCAGGAAGAGGAGGG + Intergenic
1161370539 19:3908653-3908675 AAGGAGGAGAAGAAAGGGGAAGG - Intronic
1162262575 19:9544794-9544816 ATGGTGGTGAAGGATGTGGAAGG - Intergenic
1163398165 19:17076047-17076069 ACGGTGAAGGAGAAAGTGGATGG + Intronic
1164003691 19:21130557-21130579 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1164145490 19:22510196-22510218 AGGGTGGGGCAGGAGGTGGAGGG + Intronic
1164202196 19:23028174-23028196 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1164813640 19:31177482-31177504 AAGATGGAACAGAGAGTGGAGGG - Intergenic
1164846723 19:31438787-31438809 ATTGTGGAGCAGCAGGTGGTAGG - Intergenic
1165249472 19:34517706-34517728 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166734693 19:45077082-45077104 ATGGTGGAGCTGAGGCTGGAGGG + Intergenic
1166978787 19:46620815-46620837 TTTGTGGAGCAGAAAGGGGCTGG + Exonic
1167890841 19:52537954-52537976 ATGGTGGGGTAGGAAGTGGTGGG + Intronic
1168211841 19:54896425-54896447 ATGGTGGGGCAGAATATGAAAGG + Intergenic
1168248540 19:55127199-55127221 ATGGTGGGGCAGAATATGAAAGG - Intergenic
1168486621 19:56768023-56768045 TTGGTGGAGGAGACAGTAGAAGG - Intergenic
1202699585 1_KI270712v1_random:154334-154356 ATGGTGGTGCAGAGAGTTGGGGG - Intergenic
925433551 2:3817349-3817371 ATGGTGGTGCAGGATATGGAAGG + Intronic
925537988 2:4936848-4936870 ATGATGGGGCAGAAGGTGGAGGG + Intergenic
925842588 2:8006566-8006588 ATGGAGGAGAAGAGAGAGGAGGG - Intergenic
925868672 2:8250863-8250885 AGGGTGGAGCAGAGGTTGGAGGG - Intergenic
926003706 2:9354680-9354702 ATGGTGTTGTAGAAAGTGGTCGG + Intronic
926175598 2:10588921-10588943 ATGGAGGTGCAGAGGGTGGAGGG - Intronic
926361704 2:12094152-12094174 ATGGTTTAGCAGAAGGTGCAGGG + Intergenic
926936388 2:18089897-18089919 ACGGTGGAGAAGATAGTAGAGGG + Intronic
927134435 2:20086399-20086421 ATGGTGGTGCAGGATATGGAAGG - Intergenic
928106742 2:28475421-28475443 ATGGTGGTGGAGAAGGAGGAAGG - Intronic
928600422 2:32898985-32899007 ATGGGGGAGAAGCAAGAGGAGGG - Intergenic
929350320 2:40943063-40943085 ATGGATAAGAAGAAAGTGGAAGG + Intergenic
929652516 2:43695388-43695410 ATGTTGGGCCTGAAAGTGGAAGG + Intronic
930570317 2:53077820-53077842 AAGGTGGAGCAGCAACTGGGAGG - Intergenic
930706406 2:54508944-54508966 ATGGTGGTGCAGGATATGGAAGG + Intronic
932159162 2:69445106-69445128 ATGGTGGTGCAGGATATGGAAGG + Intergenic
932952781 2:76313813-76313835 ATGGTTCAGCAGAACATGGATGG - Intergenic
933138234 2:78762045-78762067 ATGGTGGTGCAGGATATGGAAGG - Intergenic
933179500 2:79213374-79213396 ATGGTGGTGCAGGATATGGAAGG + Intronic
934117496 2:88811060-88811082 ATGCTGGAGAGGAAAGGGGAGGG + Intergenic
934170529 2:89537822-89537844 ATGGTGGTGCAGAGAGTTGGGGG - Intergenic
934280831 2:91612142-91612164 ATGGTGGTGCAGAGAGTTGGGGG - Intergenic
935147439 2:100405465-100405487 AAGGTGGGGCAGAGAGAGGATGG + Intronic
935684760 2:105673480-105673502 AAAGTGAAGCGGAAAGTGGATGG - Intergenic
936161098 2:110084796-110084818 ATGCTGGAGAGGAAAGGGGAGGG + Exonic
936183565 2:110286558-110286580 ATGCTGGAGAGGAAAGGGGAGGG - Intergenic
936345962 2:111675281-111675303 ATTGAGGAGCAGAAAGTTGTTGG + Intergenic
936599245 2:113879685-113879707 GGGGTGGAGCAGAAAGTAGGAGG + Intergenic
936794011 2:116185793-116185815 ATGGTGGTGCAGAATATGAAAGG + Intergenic
937412752 2:121690593-121690615 ATGGGGGAGGAGTAAGGGGAGGG - Intergenic
937552133 2:123107551-123107573 ATGGGGGAGGGAAAAGTGGAAGG - Intergenic
937920040 2:127122402-127122424 AGGGAGGAGCAGAAATAGGAGGG - Intergenic
938394105 2:130929348-130929370 ATGGAGGAAGAGAAACTGGATGG - Intronic
939232312 2:139444675-139444697 TTGGTGCAGTAGAAAGTGGGAGG + Intergenic
939335290 2:140819083-140819105 ATGGTGGAGCAGCAAGGGCAAGG - Intronic
939460459 2:142491376-142491398 ATGGTGGTGCAGGATATGGAAGG + Intergenic
940074501 2:149726065-149726087 ATGGTGTAGCAGAAAAAGAAGGG + Intergenic
940095302 2:149967232-149967254 ATGGTGTACCTGAAAGTGAAAGG + Intergenic
940183251 2:150957230-150957252 ATGGTGGTGCAGGATATGGAAGG - Intergenic
940233754 2:151486839-151486861 TGGATGGAGCAGAAAGGGGATGG + Intronic
940508543 2:154585064-154585086 GTGGTGGTGCAGGATGTGGAAGG + Intergenic
941440045 2:165523371-165523393 ATGGTGGTGAAGAAAGAGGTTGG - Intronic
941442685 2:165557579-165557601 GTGCTGGAGGAGAAAGAGGAGGG + Intronic
941455854 2:165711652-165711674 ATGGTGGTGCAGGATATGGAAGG + Intergenic
941750902 2:169134725-169134747 ATGGTGGTGCAGGATATGGAAGG - Intronic
943054386 2:182957998-182958020 GTGGTGGAGCATAACGTGTAAGG + Intronic
943412645 2:187562015-187562037 ATGGTGGTGCAGAATATGAAAGG + Intronic
943553941 2:189377715-189377737 GTGAAGGAGGAGAAAGTGGAGGG - Intergenic
944387734 2:199183553-199183575 ATGGTGGTGCAGAATATGAAAGG - Intergenic
945030968 2:205663386-205663408 ATGGTGAGGCAGACAGTGAAGGG - Intergenic
945192280 2:207201362-207201384 ATGGTGCAGTAGAAAGAGAATGG - Intergenic
945275790 2:207986269-207986291 AAGCCAGAGCAGAAAGTGGATGG + Intronic
945361920 2:208903409-208903431 ATGGTGGTGCAGAATATGAAAGG - Intergenic
945376390 2:209082252-209082274 ATGGTGGTGCAGAATATGAAAGG - Intergenic
945554986 2:211265621-211265643 ATGGTGGTGCAGGATATGGAAGG - Intergenic
945858463 2:215094143-215094165 ATGGTGGTGCAGGATATGGAAGG - Intronic
946871442 2:224089174-224089196 ATGGTGGTGCAGGATATGGAAGG + Intergenic
947598804 2:231431789-231431811 ATGGTGGAGCAGGATATGGAAGG + Intergenic
948583943 2:239006812-239006834 ACAGTGGAGCAGAGAGTGGAAGG - Intergenic
948648886 2:239426536-239426558 ATGCCTGAGCAGAAACTGGAAGG - Intergenic
948772135 2:240257060-240257082 ATGGTGGAGCAGCACATGGGAGG + Intergenic
948873527 2:240815709-240815731 GGGGTGGAGGAGAAAGTGGAGGG + Intronic
1168873079 20:1147516-1147538 ATTGAGGAGGAGAAAGGGGATGG - Intronic
1168942993 20:1729289-1729311 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1169523665 20:6400140-6400162 ATTATGGGACAGAAAGTGGAGGG + Intergenic
1170073748 20:12396926-12396948 ATGGTAGAGCAGAAAGACCAGGG - Intergenic
1170436357 20:16333869-16333891 ATGGTGGGGCAGAAGGTGTTGGG - Intronic
1170680123 20:18518919-18518941 ATGGTGGTGCAGGATATGGAAGG + Intronic
1170962241 20:21035768-21035790 ATTGAGGAGCAAAAAGAGGAAGG + Intergenic
1171054571 20:21893854-21893876 GTGGGGGAGAGGAAAGTGGAAGG - Intergenic
1171941201 20:31331462-31331484 AAAATGGAGCAGAAAGAGGAAGG + Intergenic
1172811664 20:37652403-37652425 ATGATGGAGGAGACAGTGGTGGG - Intergenic
1172831906 20:37843057-37843079 ATGGTGGAGAACAAAACGGAAGG - Intronic
1173408866 20:42791947-42791969 ATGGTGGAGCCCAAAGTCAAGGG - Intronic
1173479978 20:43390753-43390775 ATCGGGGAGGAGAAAGTGCAGGG - Intergenic
1173652385 20:44674925-44674947 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1173848893 20:46205492-46205514 GTGGTGCAGCAGAAACTGCAAGG - Intronic
1174118536 20:48244841-48244863 ATGGTGGATGAGAAGGGGGATGG - Intergenic
1174130806 20:48342153-48342175 CTGGAGGAGCAGACAGTGCAGGG - Intergenic
1174530764 20:51211818-51211840 ATTAGGGAGCAGAAAGTGGGGGG - Intergenic
1175433735 20:58927768-58927790 TTGGTGTAGCAGGGAGTGGAAGG - Intergenic
1175817220 20:61889518-61889540 ATGATGGATGAGTAAGTGGATGG + Intronic
1176242924 20:64083454-64083476 ATCCTGGAGGAGAACGTGGATGG - Exonic
1178202526 21:30423647-30423669 ATGATGGAGGAGAAGGAGGAGGG + Intronic
1178235677 21:30838385-30838407 AGGTTGAAGCAGAAAGTGTAGGG - Intergenic
1179014936 21:37588257-37588279 ATGGTGGTGCAGGATATGGATGG + Intergenic
1179778663 21:43685300-43685322 ATGGGGGAGGAGACACTGGATGG - Intronic
1180047032 21:45311682-45311704 GTGGTGGAGCAGAGGGTGCATGG - Intergenic
1180485719 22:15794540-15794562 AAGATGGAGCTCAAAGTGGATGG + Intergenic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181835075 22:25598866-25598888 ATAATGGAGCAGAATATGGAGGG + Intronic
1181960091 22:26616569-26616591 AGGGTGGAACAGCTAGTGGAGGG - Intronic
1182737619 22:32542088-32542110 ATGGGGGAACAGACTGTGGAGGG + Intronic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184757687 22:46526161-46526183 ATGGAGGAGCAGGAGGCGGACGG - Intronic
949808462 3:7980121-7980143 ATGTTGGAGCAGATTGTGCAAGG + Intergenic
949854019 3:8443534-8443556 AAGGTGGAGCAGGAAGAGGCAGG + Intergenic
950120402 3:10478649-10478671 ATGATGGAGAAGAAAGAGGCAGG - Intronic
951693417 3:25420698-25420720 ATGATGGATCAGAGAGTGAATGG + Intronic
951762470 3:26161700-26161722 ATGGTGGTGCAGAATATGGAAGG + Intergenic
951766138 3:26201703-26201725 AAGGTGGAGAAGAAAATGGTGGG + Intergenic
952297216 3:32072133-32072155 ATGGTGGTGCAGGATATGGAAGG - Intronic
952792132 3:37208228-37208250 ATGGTGGTGCAGGATATGGAAGG - Intergenic
952890637 3:38037855-38037877 AGTGTGGAGTAGAAAGTGGTTGG + Intergenic
952894879 3:38071819-38071841 ATGGTGGTGCAGAATATGAAAGG + Intronic
953018687 3:39100400-39100422 GTGGTAGAGCAGAAGGTGGTGGG + Exonic
953656219 3:44856840-44856862 ATGGTGGTGCAGGATATGGAAGG + Intronic
954161443 3:48725638-48725660 ATGGTGGTGCAGGATATGGAAGG + Intronic
954463717 3:50642286-50642308 ATGGCTGTGCAGAAACTGGATGG - Exonic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
955932465 3:64071403-64071425 ATGATGGAGTAGGAAGTGGAGGG - Intergenic
956083889 3:65589430-65589452 ATACTGGAGCAGGAAGTGCAAGG - Intronic
956225053 3:66947861-66947883 AAAATGAAGCAGAAAGTGGAAGG - Intergenic
956233233 3:67040313-67040335 ATGGTGGTGCAGGATATGGAAGG + Intergenic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956819140 3:72937026-72937048 ATGGTGGAGGACATAGAGGAAGG + Intronic
958676512 3:97274507-97274529 ATGGTGGTGCAGAATATGAAAGG + Intronic
959111707 3:102130646-102130668 ATCTTATAGCAGAAAGTGGAGGG - Intronic
959423060 3:106151425-106151447 ATGGTGTAGCTGAAAGTGACGGG - Intergenic
959738417 3:109687644-109687666 AAGGTTGAGCAGAAAGAGCATGG + Intergenic
959961356 3:112302648-112302670 ATGGTGCATCAGAACCTGGAGGG + Intergenic
959986750 3:112581703-112581725 ATGGTGGAAAAGAAAGAGAAAGG - Intronic
961458375 3:127035362-127035384 ATGGTTGTGGAGAAAGTGGCCGG + Exonic
961534289 3:127560163-127560185 ATGGTGGAACAGTAAGTGCTAGG - Intergenic
962074709 3:132069596-132069618 ATGGGGGACCAGAAGGTTGAAGG - Intronic
962149419 3:132877205-132877227 TTGATGAAGCAGAAAGTGGGAGG - Intergenic
962523643 3:136219264-136219286 ATGGTGGTGCAGGATATGGAAGG + Intergenic
963111585 3:141693150-141693172 ATGGTGGTGCAGGATATGGAAGG + Intergenic
963320084 3:143801844-143801866 ATGGTGGTGCAGGATGTGGAAGG - Intronic
964125172 3:153228212-153228234 ATGGTGGTGCAGAATATGAAAGG + Intergenic
964299941 3:155276499-155276521 ATGGTGGTGCAGAATATGGAAGG + Intergenic
965070633 3:163911921-163911943 ATGGTGGTGCAGGACATGGAAGG - Intergenic
965335441 3:167427151-167427173 ATGGTGGTGCAGGATATGGAAGG - Intergenic
965491855 3:169347233-169347255 ATGGGGGGGCAGTTAGTGGATGG + Intronic
965861672 3:173157284-173157306 ATGGTGGTGCAGGATATGGAAGG + Intergenic
966279620 3:178211918-178211940 ATGGTGGTGCAGGATATGGAAGG - Intergenic
966303670 3:178507061-178507083 TTGGTGGAGCAGAAAGTCTATGG + Intronic
966397331 3:179517046-179517068 ATGGTGGTGCAGGATATGGAAGG + Intergenic
966765052 3:183453677-183453699 AAGGAGGAGGAGAGAGTGGAGGG + Intergenic
967005035 3:185375865-185375887 ATGGTGGTGCAGGATGTGAAAGG + Intronic
967188817 3:186967764-186967786 ATGGAGGCCCAGAAAGGGGAAGG + Intronic
967218587 3:187230346-187230368 AAAGTGGAGCTGAAAGTTGAGGG + Intronic
967818415 3:193818056-193818078 ATGGTGGTGCAGAATGTGTGGGG + Intergenic
969234621 4:5856957-5856979 ATGGTGGTGATGATAGTGGATGG - Intronic
969234627 4:5856995-5857017 ATGGTGGTGATGATAGTGGATGG - Intronic
969973239 4:11070124-11070146 ATAGTGAAGCAGACAGTGAATGG - Intergenic
970228959 4:13889580-13889602 ATGGTGGAATAGAAATTGAAAGG + Intergenic
970256134 4:14172053-14172075 ATGGTGGTGCAGAATATGAAAGG + Intergenic
970533014 4:17001846-17001868 ATGGTGGTGCAGAATATGAAAGG - Intergenic
970590848 4:17559609-17559631 ATGGTGGAGTAGACAGGGGAGGG - Intergenic
970853771 4:20631826-20631848 ATGGTGGTGCAGAATATGAAAGG + Intergenic
970916184 4:21338002-21338024 ATGGTGGAGCAGAAAGTGGAAGG - Intronic
971553188 4:27979493-27979515 ATGGTGGTGCAGGATATGGAAGG - Intergenic
971586758 4:28414496-28414518 AAGGGGGAGGAGAAAGAGGAAGG - Intergenic
972027283 4:34398777-34398799 ATGGTAGAGTAGAAGGAGGAAGG + Intergenic
972987413 4:44781049-44781071 ATGGGGGAACAGAGAGGGGAAGG - Intergenic
973113046 4:46419111-46419133 ATGGTGGAGCAGGAAAGAGAGGG + Intronic
973289989 4:48461522-48461544 ATGATGGAGCTGCAAGTGGTAGG + Intergenic
973673654 4:53241755-53241777 ATGGTGGTGCAGCAGGAGGAGGG - Intronic
973840843 4:54858881-54858903 ATGGTAGCTCAGAAGGTGGAAGG + Intergenic
974441717 4:61926862-61926884 ATGGTAGAGCAGAGAGTATAAGG - Intronic
975152401 4:71035549-71035571 ATGGTGGTGCAGGATATGGAAGG - Intergenic
975650943 4:76592229-76592251 TGGGTGGAGCAGAATGTGGCGGG + Intronic
976171994 4:82313794-82313816 ATGGTGGACCCGAAACTGGAGGG - Intergenic
976913741 4:90343371-90343393 ATGGTGGAGGCCAAGGTGGATGG + Intronic
977177069 4:93830232-93830254 AAGGGGGAGCAGAAGGTGGGCGG - Exonic
977782172 4:100993401-100993423 ATGGTGGTGCAGGATATGGAAGG + Intergenic
978214530 4:106182748-106182770 TTAGTGGAGAAGAAAGTAGAGGG + Intronic
978373243 4:108050337-108050359 CTGGTGGAGCCGGAAGTGCAGGG + Intronic
978373337 4:108050920-108050942 CTGGTGGAGCCGGAAGTGCAGGG - Intronic
978520829 4:109613192-109613214 ATATTGGAGTAGAAAGTAGAGGG + Intronic
979161596 4:117468313-117468335 AAGATGGAGCAGAAAGCTGAAGG + Intergenic
980003085 4:127513003-127513025 ATGGTGGTGCAGAACATGAAAGG + Intergenic
980302383 4:131011395-131011417 ATGGTGGTGCAGGATATGGAAGG - Intergenic
980407548 4:132373227-132373249 ATGGTAGAGCAAAAGGTGGAAGG - Intergenic
980552340 4:134355513-134355535 ATGGAGGAGCTGAGAGTCGATGG + Intergenic
980969550 4:139556097-139556119 ATGGTGGAGGAGGCGGTGGAAGG - Exonic
981482620 4:145254347-145254369 ATGGTGGTGCAGGATATGGAAGG + Intergenic
982081368 4:151793452-151793474 ATGGTGGGTCAGAGAGAGGAAGG + Intergenic
982140372 4:152311698-152311720 ATGGTTGGGGGGAAAGTGGAGGG - Intergenic
982319145 4:154060829-154060851 ATGGTGGTGCAGGATATGGAAGG - Intergenic
982396446 4:154920384-154920406 ATGGTGGTGCAGAATATGAAAGG + Intergenic
983249327 4:165327158-165327180 ATGGTAGACCAGAAAAAGGAAGG + Intergenic
983883443 4:172957692-172957714 ATGGTGGTGCAGGATATGGAAGG + Intronic
983994424 4:174164075-174164097 TTGTTGGATCAGAAACTGGAAGG - Intergenic
984411066 4:179398687-179398709 GTCGTGGAGAAGGAAGTGGAGGG - Intergenic
984412040 4:179407545-179407567 ATGGTGGTGCAGGATATGGAAGG - Intergenic
984437579 4:179724830-179724852 ATGGTGGTGCAGGATATGGAAGG - Intergenic
984989387 4:185364239-185364261 ATGGGGGAGCGGAAAGAGGAGGG + Exonic
985078715 4:186243684-186243706 ATGGTGGTGCAGAATATGGAAGG + Intronic
985965065 5:3333263-3333285 ATGGAGGAGCAGGACGTGCATGG - Intergenic
985993634 5:3584218-3584240 ATTGTGCAGCAGAATGTAGAAGG + Intergenic
986469991 5:8064034-8064056 AAGGTGGAGAAGAGAATGGAAGG - Intergenic
987510838 5:18836312-18836334 GAGGAGGAGGAGAAAGTGGAGGG - Intergenic
987642334 5:20628701-20628723 CTGGTGGAGCAGTAAGAAGAAGG - Intergenic
988199411 5:28050034-28050056 ATGGTGGTGCAGGATATGGAAGG - Intergenic
988485661 5:31666234-31666256 GTCTTGGAGCAGAAGGTGGAGGG + Intronic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
990564854 5:57018680-57018702 ATGGTGGTGCAGGATATGGAAGG + Intergenic
991126888 5:63079613-63079635 ATGGTGGAAGACAAAGAGGAAGG - Intergenic
991528503 5:67590825-67590847 ATGGTAGAGGGGAAAGTGGTAGG - Intergenic
992451722 5:76882002-76882024 ATGGTGGTGCAGGATATGGAAGG + Intronic
993012669 5:82501263-82501285 AAGGTGCAGAAGAAGGTGGAAGG - Intergenic
993494540 5:88593106-88593128 ATAATGAGGCAGAAAGTGGAAGG + Intergenic
993825514 5:92680941-92680963 ATGGTAGAGTAGAAAGGGCATGG + Intergenic
994325226 5:98439106-98439128 ATGGTGGTGAAGGATGTGGAAGG - Intergenic
994375487 5:99012890-99012912 ATGGTGGTGCAGGATATGGAAGG + Intergenic
994721962 5:103390820-103390842 ATTGTGGAGTAGAAAGAGGAAGG - Intergenic
995229445 5:109742479-109742501 ATAGTTGAGAAGACAGTGGAAGG - Intronic
995434814 5:112123629-112123651 TTGGGGGAGGAGAGAGTGGAAGG - Intergenic
995467406 5:112465351-112465373 ATGGTGTACCTGAAAGTGGTGGG - Intergenic
996039535 5:118794605-118794627 CTTAGGGAGCAGAAAGTGGAGGG + Intergenic
996052876 5:118952041-118952063 AAGGTGGCGCAGAAATTGAAAGG + Intronic
996574747 5:124968442-124968464 ATGGTGGTGCAGGATATGGAAGG + Intergenic
996725495 5:126670306-126670328 ATGGTGGTGCAGGATATGGAAGG + Intergenic
997678516 5:135733054-135733076 ATGGTGGTGCAGAATATGGAAGG + Intergenic
998107690 5:139478684-139478706 AGGGTGGTGCAGTAAGAGGAGGG - Intronic
998171070 5:139872297-139872319 ATGGTGGACCAGGGAGTGGCTGG + Intronic
999325002 5:150638464-150638486 ATGGTGAAGCAAAATGTGAAGGG + Intronic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
1000030807 5:157399536-157399558 ATGGTGGAGTAGAAAGGCCAAGG + Intronic
1000113869 5:158135209-158135231 ATGGGGCAGGAGAAAGGGGATGG + Intergenic
1000438842 5:161244149-161244171 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1000607214 5:163338028-163338050 ATGGTGGTGCAGGAGATGGAAGG - Intergenic
1001333924 5:170782671-170782693 ATGGAGGGGCAGGAAGGGGAGGG - Exonic
1001353963 5:171002547-171002569 ATGGTGGTGCAGGATATGGAAGG + Intronic
1001469517 5:172000867-172000889 ATGGTTTAGCAGAAAGGGCATGG - Intronic
1001623480 5:173109139-173109161 AGGGTTGAGGAGAAAGTGAACGG + Intronic
1001959389 5:175871282-175871304 AAGGTGGAGGAGAGAGGGGAGGG + Intronic
1002915571 6:1525502-1525524 ATGCTGGAGCAGAATGGGAAGGG - Intergenic
1002916770 6:1535421-1535443 AGGGTGGGGCAGGAAGCGGAGGG + Intergenic
1003100091 6:3170416-3170438 ATGGTGGTGCAGAATATGGAAGG - Intergenic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003313288 6:4987558-4987580 GTGGTGGAGCAGGATGTGGAGGG - Intergenic
1003404559 6:5817622-5817644 ATGGTGAAGCAGGTATTGGAGGG - Intergenic
1003822762 6:9918284-9918306 ATGGAGGAGCAGCATGTGGTGGG - Intronic
1004043126 6:12002028-12002050 ATGGTATAGCAGAAAGTTTAGGG + Intergenic
1004489183 6:16097998-16098020 ATGGTGGACCAGAATGTGCAAGG - Intergenic
1005626773 6:27669839-27669861 ATGGTGGAGGAGAGAGAGGCTGG - Intergenic
1005790735 6:29297005-29297027 ATGGTGGAACAGCCAGTGGGTGG - Intergenic
1005898249 6:30196258-30196280 ATGGTATAGTAGAAAATGGAAGG - Intronic
1006191132 6:32210267-32210289 TTGCTGGAGCAGAGAGTAGAAGG + Intronic
1006325114 6:33347829-33347851 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1008118987 6:47588518-47588540 ATGGTGGTGTGGATAGTGGAAGG + Intronic
1008408641 6:51147301-51147323 ATGCTGGTGCAGTAAGTGTAGGG + Intergenic
1008504493 6:52216462-52216484 ATAGTTGATGAGAAAGTGGAGGG - Intergenic
1009464665 6:63954434-63954456 ATGGTGGTGCAGGATATGGAAGG - Intronic
1009749973 6:67870194-67870216 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1009751729 6:67884944-67884966 ATGGTGGTGGAGAATATGGAAGG + Intergenic
1009905881 6:69868782-69868804 CTGGAGGACCAGAAAGTAGATGG - Intronic
1010203210 6:73300323-73300345 AAGGTGGTGTGGAAAGTGGAAGG - Intronic
1011007968 6:82669406-82669428 ATGGCACAGCAGAAAATGGAAGG - Intergenic
1011632309 6:89339492-89339514 ATGGGGGAGGAGAGAGGGGAGGG + Intronic
1012675376 6:102106129-102106151 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1013335943 6:109161378-109161400 CTGCTGGAGCAGAAAGCAGAGGG + Intronic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1013807762 6:114013647-114013669 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1015554980 6:134451786-134451808 GTTGGGGAGCAGAGAGTGGAGGG + Intergenic
1015801071 6:137062651-137062673 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1016751219 6:147632324-147632346 ATGGTGGTGCAGGATATGGAAGG + Intronic
1017056799 6:150443863-150443885 ATGGTGCAGCAGAAAGAGGCTGG + Intergenic
1017270133 6:152494655-152494677 ATGGTGGTGCAGGATATGGAAGG - Intronic
1017922537 6:158884723-158884745 ATGGTGGTGCAGGATCTGGAAGG + Intronic
1018077880 6:160232495-160232517 ATGGTGGTGCAGGATATGGAAGG - Intronic
1018602711 6:165562569-165562591 ATAGTTGAGAAGAAAGTGGTAGG - Intronic
1018969332 6:168515446-168515468 CTCGTGGAGCGGAAAGCGGACGG - Intronic
1019781364 7:2942179-2942201 ATGGTGCAGAAGGGAGTGGAAGG - Intronic
1020035193 7:4959756-4959778 GTGGGGGAGCGGAAAGTGGGGGG + Intergenic
1020207156 7:6127708-6127730 ATTGTGAAGAATAAAGTGGAAGG - Intronic
1020472359 7:8553409-8553431 ATGATGGAGCAGAAATTGGCTGG + Intronic
1020540819 7:9459868-9459890 ATGATGGTGCAGAATATGGAAGG + Intergenic
1020794509 7:12663840-12663862 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1021172997 7:17418266-17418288 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1021189533 7:17603558-17603580 ATGGAGGAGGAGAAAGGGAAAGG + Intergenic
1021299362 7:18953330-18953352 ATGTTGCAGCAGAAAGCGCATGG - Intronic
1021430131 7:20549619-20549641 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1021660873 7:22916903-22916925 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1022138628 7:27472817-27472839 ATGGTGGTGTAGAAAGAGAAAGG - Intergenic
1023173658 7:37414397-37414419 AAGGTGGAGAAGAGAGAGGACGG + Intronic
1023842249 7:44104251-44104273 AAGGAGGAGCCGAGAGTGGACGG - Intergenic
1024171405 7:46791300-46791322 ATGGAGGGGCAGCAAGGGGAAGG + Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026986967 7:74560902-74560924 ATGGTGGAGACAGAAGTGGATGG - Intronic
1027683719 7:81254618-81254640 ATGGTAGAGCAAAAAGGGGAAGG + Intergenic
1027976466 7:85162631-85162653 GGAGTGGAGCAGTAAGTGGAAGG + Intronic
1028372082 7:90103783-90103805 ATGGTGGAGTAAAAAGTGTAAGG - Intergenic
1028528561 7:91812641-91812663 ATGGTGGAACAGAAATTGTTAGG - Intronic
1028744536 7:94312385-94312407 ATGGTGAAGTAGAAAATAGAAGG - Intergenic
1029155193 7:98512436-98512458 TTGGTGGGGCTGAAAGAGGAAGG + Intergenic
1029597631 7:101546103-101546125 AAGGAGGTGCAGAGAGTGGACGG + Intronic
1030445575 7:109644163-109644185 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1030587534 7:111439249-111439271 ATTGTGGAGTAGAGATTGGAAGG - Intronic
1031101737 7:117489309-117489331 ATGCTGAAGAAGAAAGTGGTAGG + Intronic
1031339424 7:120580430-120580452 CTTGTGGAGCAGAAGGTGGAAGG - Intronic
1031354915 7:120778671-120778693 ATGGTGGTGCAGAATATGAAAGG + Intergenic
1031777653 7:125921963-125921985 ATGGTGGTGCAGAATATGGAAGG - Intergenic
1032495474 7:132358472-132358494 TTGGTGGAGAAGAAAACGGAAGG + Intronic
1033046597 7:137967854-137967876 ATGGTGTCCCAGGAAGTGGATGG - Intronic
1033084984 7:138333046-138333068 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1033088869 7:138366914-138366936 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1033211780 7:139465275-139465297 ATGGTGGTGCAGGATATGGAAGG - Intronic
1033330992 7:140416760-140416782 GTGGTGGAGGAGCAGGTGGAAGG + Intronic
1033464724 7:141580145-141580167 ATGGTGGTGCAGGATATGGAAGG + Intronic
1033559927 7:142521528-142521550 ATGGTGGAGAGGTAAGTGGAGGG + Intergenic
1033604214 7:142913894-142913916 AGGGAGGGGCAGAAAGAGGAAGG - Intronic
1033625842 7:143108838-143108860 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034408880 7:150926437-150926459 ATGCTGGAGCAGACAAGGGAGGG + Intergenic
1034411709 7:150945552-150945574 ATGGAGGAGGAGGAAGGGGAGGG + Intronic
1034529677 7:151687956-151687978 AGGGTGGAGCGGGTAGTGGAAGG + Intronic
1035674338 8:1444599-1444621 ATGATGGAGAAGGAGGTGGAGGG - Intergenic
1036472053 8:9060971-9060993 ATGGTGGTGCAGAATATGAAAGG + Intronic
1036658172 8:10691015-10691037 CTGGTGACTCAGAAAGTGGAGGG - Intronic
1036800118 8:11784706-11784728 CTGGTGGAGCTGAAAGAGTATGG + Intronic
1037229595 8:16640470-16640492 AGGGTGGAGGAGAAAGAGAATGG - Intergenic
1038399622 8:27273117-27273139 ATGGTGTCTCAGAAAGAGGAGGG + Intergenic
1039379834 8:37074716-37074738 ATGATTGAGCAGAGAGAGGAAGG - Intergenic
1039485217 8:37904542-37904564 ATGGAGGAGCAGAAAGGGGCTGG + Intergenic
1039585238 8:38701753-38701775 GTGGAGCAGCAGGAAGTGGACGG + Intergenic
1042504095 8:69541105-69541127 ATGGTGGAGCAGGAAGGTGGTGG + Intronic
1043148127 8:76681440-76681462 ACGCTGGAGCAGAAAGTGGGGGG - Exonic
1043185089 8:77138233-77138255 AAGGTGGAGAAGGAGGTGGAGGG - Intergenic
1043223254 8:77693100-77693122 GTGGTTGAGAAGAAAGTGGGAGG - Intergenic
1043599170 8:81917839-81917861 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1043717633 8:83506749-83506771 ATGGTGGTGCAGAATATGAAAGG + Intergenic
1043786433 8:84406524-84406546 ATTGTGGATCAGAAAGTGCTGGG + Intronic
1043838007 8:85067107-85067129 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1044970900 8:97618667-97618689 ATGGATGATCAGAAAGTGAAAGG - Intergenic
1045078347 8:98595721-98595743 ATGGTGGAGCAAAAAGTCAAAGG + Intronic
1045325446 8:101114431-101114453 ATGGTGGGGTGGAGAGTGGATGG + Intergenic
1045533101 8:103002804-103002826 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1046075148 8:109304587-109304609 ATGGTGGTGCAGGATATGGAAGG - Intronic
1046362622 8:113182945-113182967 CTGGTGGAGCAGAAAACAGATGG + Intronic
1046489555 8:114932303-114932325 ATGTTGAAACAGAAAGAGGAGGG - Intergenic
1046538280 8:115544853-115544875 AAGGAGGAGAAGAAGGTGGAGGG + Intronic
1046825070 8:118680241-118680263 ATGGTGCTGGAGAAATTGGATGG - Intergenic
1047184602 8:122621206-122621228 ATGGTGGAGCACAAGGTAGATGG + Intergenic
1047191901 8:122685987-122686009 ATGGTGGAGCAGAAAGCGTAAGG + Intergenic
1048143491 8:131818816-131818838 ATGGTGGAGCAGAAAATCCCTGG - Intergenic
1048317020 8:133370053-133370075 AGGGTGGAGCAGGGAGGGGAGGG - Intergenic
1048613533 8:136049910-136049932 ATGGTGGAAGACAAAGGGGAAGG - Intergenic
1048781180 8:138003677-138003699 GTGGAGCAGCAGAAAGTGGAAGG - Intergenic
1048879384 8:138860103-138860125 AGGGTGGAGAAGAGAGGGGAAGG - Intronic
1048986459 8:139737569-139737591 TTGGTGGACCAGGAAATGGAGGG - Intronic
1049566505 8:143341854-143341876 AAGGGGGAGGAGAAAGAGGAAGG - Intronic
1049757462 8:144317063-144317085 ACGGGGCAGCAGCAAGTGGATGG - Exonic
1051207109 9:14699558-14699580 ATGGAGGAGGATATAGTGGAGGG + Intergenic
1051544556 9:18259602-18259624 AGAGGGGAGCAGAAAGAGGAGGG - Intergenic
1051929326 9:22366406-22366428 ATTGGGCAGCAGAAAGTAGAAGG - Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053059700 9:35021336-35021358 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1053330333 9:37200043-37200065 ATGGTGGCGCACAAATGGGAAGG - Intronic
1053809611 9:41839114-41839136 GGGGTGGAGCAGCAAGTGAATGG - Intergenic
1054620981 9:67348314-67348336 GGGGTGGAGCAGCAAGTGAATGG + Intergenic
1054923600 9:70566083-70566105 ATGGTGGTGGTGATAGTGGATGG + Intronic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1056324172 9:85462827-85462849 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1056356101 9:85803392-85803414 GGGGTGGAGCAGAAAATGGGAGG - Intergenic
1056604605 9:88076478-88076500 ATGCTGCGGCAGAAACTGGAAGG - Intergenic
1057865586 9:98677827-98677849 GTGCTGGAGCAGAGATTGGATGG - Intronic
1058718280 9:107741118-107741140 ATGGTGGAGAAGCAACTGGAGGG - Intergenic
1059458933 9:114417473-114417495 AGTGTGGAACAGAAACTGGAAGG - Intronic
1059520770 9:114939788-114939810 TTGGAGTAGAAGAAAGTGGAAGG - Intergenic
1060219009 9:121754666-121754688 ATGGTGGGGAAGGAAGGGGAGGG + Intronic
1060523952 9:124310017-124310039 AGGCTGGAGCAGGAAGTGGCAGG + Intronic
1060673675 9:125493073-125493095 ATGGTGGAAAAGAAAATGGTGGG + Intronic
1061465821 9:130778651-130778673 CTGGGGGATCTGAAAGTGGATGG - Intronic
1061569791 9:131470127-131470149 TATATGGAGCAGAAAGTGGAGGG + Intronic
1062692305 9:137848661-137848683 ATGGTGGTGCAGGATATGGAAGG - Intronic
1185550627 X:980670-980692 ATGATGGAGGAGGAAGAGGAGGG + Intergenic
1187250536 X:17594209-17594231 ATGGTGTACCAGAAAGAGCATGG - Intronic
1187307890 X:18113715-18113737 ATGGTGGAGGAGAAACAGGCAGG - Intergenic
1187378698 X:18780746-18780768 ATGGGAGAGCTGAAAGAGGAGGG + Intronic
1187437200 X:19283524-19283546 ATGGTGGAGTTCAAAGTGGAAGG - Intergenic
1187668614 X:21645139-21645161 ATAGTGGAGCAGAATATGAAAGG + Intronic
1188332724 X:28894149-28894171 ATGGTGGTGCAGGATATGGAAGG + Intronic
1188914724 X:35896443-35896465 ATGGTGGAGAAGCCATTGGATGG - Intergenic
1189149310 X:38688086-38688108 AAGGTGGAGCAGAGACTGGGTGG - Exonic
1189212136 X:39292444-39292466 TTGGTGGAGCAATAGGTGGATGG - Intergenic
1189230769 X:39450895-39450917 ATGGAGGAGGGGAGAGTGGAGGG - Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1191013913 X:55790022-55790044 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1191067199 X:56361934-56361956 GTGGTGGAGAAGAAAATGGTGGG + Intergenic
1191761625 X:64653456-64653478 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1192169038 X:68843157-68843179 CTGGTGGAGAAGAAAGGGGGCGG + Intergenic
1192495201 X:71611937-71611959 CTGGTGGCGCTGAAAGTCGAGGG + Intronic
1192706441 X:73531856-73531878 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1192731218 X:73804283-73804305 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1192956460 X:76075932-76075954 GTTGGGGAGCAGAAAGTTGAGGG - Intergenic
1193537395 X:82731226-82731248 ATGGTGGTGCAGCATATGGAAGG - Intergenic
1193628676 X:83853071-83853093 ATGGTGGAGTAGAAAGTCTCAGG + Intergenic
1194661001 X:96628421-96628443 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1194873480 X:99160774-99160796 ATGGTGGTGCAGAATATGAAAGG + Intergenic
1195326586 X:103763400-103763422 ATGGTGGTGCAGAATATAGAAGG + Intergenic
1196605902 X:117656721-117656743 GTGGTGGTGCAGGATGTGGAAGG - Intergenic
1197117221 X:122848018-122848040 ATGGTGCAACAGAAAGAGCACGG - Intergenic
1197500031 X:127230976-127230998 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1197964685 X:132046655-132046677 ATGGTGAAGCATAAAGTCAAAGG - Intergenic
1197995559 X:132368700-132368722 AGGATGGAGCAGAAAGGAGAAGG + Intergenic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198741130 X:139844311-139844333 AAGGAGTAGCAGAGAGTGGAGGG + Intronic
1198921892 X:141738373-141738395 TGAGAGGAGCAGAAAGTGGAGGG - Intergenic
1198966242 X:142230948-142230970 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1199381355 X:147176322-147176344 ATGCTGGAGGGGAAAGAGGAAGG + Intergenic
1199589986 X:149458627-149458649 AGAGTGGAGCATAAATTGGAAGG - Intergenic
1200507781 Y:4035938-4035960 ATGGTGCAGCAGGAATTTGATGG + Intergenic
1200813154 Y:7505124-7505146 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1201233969 Y:11892446-11892468 ATGGTGGTGCAGGATGTGGAAGG + Intergenic
1202025771 Y:20521011-20521033 ATGGTGGAGCAGAGAGTTAGTGG + Intergenic
1202076207 Y:21040245-21040267 ATGGTAGTGCAGAATATGGAAGG + Intergenic