ID: 970922162

View in Genome Browser
Species Human (GRCh38)
Location 4:21407292-21407314
Sequence TAACCTGGATGGTTTATTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970922162 Original CRISPR TAACCTGGATGGTTTATTTA TGG (reversed) Intronic
900954924 1:5880931-5880953 TACCCTGGGTGGTTCATTTTGGG - Intronic
901385284 1:8904295-8904317 TAACCTGGATGTTTTCTCTTGGG + Intergenic
902780960 1:18704818-18704840 TCAGCTGCATCGTTTATTTATGG + Intronic
904244699 1:29179042-29179064 ATACCTGGGTGGTTTTTTTAAGG - Intronic
908676068 1:66605487-66605509 TAACCTGGATACTTGAATTAAGG + Intronic
909708706 1:78618637-78618659 TAACTTTGATCGTTTATTTGAGG + Intergenic
909842246 1:80342630-80342652 TAACATGGATGGTATATTTGAGG + Intergenic
909972394 1:82006430-82006452 TTACCTGAACTGTTTATTTAGGG - Intergenic
910361240 1:86415308-86415330 TCATCTGGATGCTTCATTTATGG - Intergenic
911541787 1:99165348-99165370 TAAACTGGATGATTTATGAAAGG - Intergenic
911596732 1:99806291-99806313 TAACCTAGAGTGATTATTTATGG - Intergenic
911603838 1:99877888-99877910 TTACCTGCATAGTTTACTTAAGG - Intronic
911786198 1:101950995-101951017 TAACTTACATGGTCTATTTAAGG + Intronic
911801950 1:102151904-102151926 TAGCTTGCATGGTTAATTTAAGG + Intergenic
917770583 1:178272983-178273005 TAATCTGGATAGTCAATTTAAGG - Intronic
919675696 1:200380538-200380560 CCACCTGGCTGGTTTCTTTAGGG - Intergenic
920974992 1:210777476-210777498 TAACATGGGTGGCTAATTTAGGG + Intronic
924541993 1:244989894-244989916 TAAAATGAATGGTTTATTTCTGG - Intronic
1063340677 10:5260630-5260652 TAACCTATAGGGCTTATTTAGGG + Intergenic
1064101718 10:12469602-12469624 AAACCTGGATAGCTTATTTCCGG + Intronic
1065092497 10:22249272-22249294 AAACCTAGATGGTTTGTATATGG + Intergenic
1065880470 10:30033456-30033478 TAAATTGGATAGTTTATCTAAGG - Intronic
1067721346 10:48729874-48729896 GAACCTGGATGGCTGTTTTAGGG - Intronic
1069725435 10:70574590-70574612 TGAGCTGGATGGATTATTTGAGG - Intergenic
1073769604 10:106721118-106721140 AAACCTTGATGCTTTATTTGGGG + Intronic
1078061702 11:8050681-8050703 TAACCAGGCCGTTTTATTTATGG - Intronic
1079525828 11:21386410-21386432 TAAACTAGATGGTTCATTTCAGG + Intronic
1086009890 11:82088779-82088801 TAACTTTGATCATTTATTTAAGG - Intergenic
1087836735 11:102882469-102882491 GAACATGCATGGTTTATTTTTGG - Intergenic
1089876266 11:121724608-121724630 GAAACTGGAAGGTTTATTGAGGG + Intergenic
1092223390 12:6730677-6730699 TAACTTTAATGGTTTTTTTAAGG - Exonic
1094658892 12:32447072-32447094 TAACCTATATGATTTATTTTGGG - Intronic
1097416514 12:59322814-59322836 TAATCTGGAAGGTTGGTTTATGG + Intergenic
1097955219 12:65478372-65478394 TAACCTGCATGTTTTTTTCAAGG - Intronic
1098007516 12:66014112-66014134 TAAACTAGATGGATTATTTATGG - Intergenic
1098058770 12:66538023-66538045 AAACAGGGATGGTTTATTTCTGG - Intronic
1098899222 12:76095601-76095623 TAACCTTGATCATTTAGTTAAGG - Intergenic
1098910981 12:76208303-76208325 TAAACTGGATGGTTCATCTCTGG + Intergenic
1099398792 12:82176598-82176620 TGACCTACATGGTTTATTGATGG + Intergenic
1100141042 12:91619300-91619322 AAACCTGGATGATATATTTTGGG + Intergenic
1105240539 13:18604632-18604654 TATGCTGGATAGTTTATTCATGG - Intergenic
1108239858 13:48452318-48452340 TGAGCTTGATGTTTTATTTATGG + Intronic
1109766899 13:66912733-66912755 TAAGGTATATGGTTTATTTATGG - Intronic
1111350336 13:87020323-87020345 GAACTTTGATGGTTTATTGATGG + Intergenic
1112706903 13:102080569-102080591 GAAACTGGATGGTTGATTTTTGG - Intronic
1118540215 14:66814609-66814631 TAACCTTGAGGGTTTGATTATGG - Intronic
1119005386 14:70922171-70922193 TACCCAGTATGGTGTATTTATGG + Intronic
1120284240 14:82477298-82477320 TAAGCAGGATGGCTTATTTCAGG + Intergenic
1126429672 15:48568674-48568696 TAACCAGAAGGGTTTATTTCTGG - Intronic
1128506400 15:68276136-68276158 GAAGCTGGCTGGTTTATTTGGGG - Intergenic
1131607105 15:93918046-93918068 CAACTTGGACAGTTTATTTAAGG - Intergenic
1131870935 15:96764287-96764309 TAAATTGGATGGATTATTTAAGG - Intergenic
1133195467 16:4166875-4166897 GAATCAGCATGGTTTATTTACGG - Intergenic
1133638442 16:7693562-7693584 TAACTTTGATGTTTTATTTCTGG + Intronic
1139246040 16:65444923-65444945 TAATTTGCATGTTTTATTTATGG - Intergenic
1144738290 17:17567066-17567088 TTCCCTGGATGATTTATTTTTGG - Intronic
1151369950 17:73641593-73641615 TAGCCTGGTTGGTTTTTTTTGGG - Intronic
1153386901 18:4509175-4509197 CAAACTTGAGGGTTTATTTAGGG - Intergenic
1154395459 18:13983700-13983722 GAACCCTGATGGTTTATTTAAGG + Intergenic
1154448335 18:14454431-14454453 TATGCTGGATAGTTTATTCATGG + Intergenic
1154490774 18:14920379-14920401 TAACTTGGAAGGCTTAATTAAGG + Intergenic
1156414047 18:36868682-36868704 AATACTGGATGGTTTTTTTAAGG - Intronic
1156730372 18:40187043-40187065 TAACTTTGATGATTTGTTTAAGG + Intergenic
1157699359 18:49751166-49751188 TAACTTGGGTGGTTTACTTTGGG + Intergenic
1166031631 19:40135269-40135291 TGATCTGGATGGTATATTTTTGG - Intergenic
927102974 2:19802150-19802172 GAAGCTGCATGGTTTAGTTAAGG - Intergenic
928050075 2:27983280-27983302 TAAATTTGAAGGTTTATTTATGG + Intronic
928496266 2:31835636-31835658 TAACTTGCATGGTCTATTTTTGG - Intergenic
930554036 2:52872107-52872129 GTAGCTGGATGGTTTATATATGG - Intergenic
933635157 2:84700784-84700806 TAACATATATGATTTATTTATGG + Intronic
934209012 2:89959271-89959293 TAACCTGAAGGATTTATTAAGGG - Intergenic
935801917 2:106706297-106706319 AAACATTGATGCTTTATTTATGG - Intergenic
939813776 2:146869022-146869044 TAACCTGGCTGATTAATTCAAGG + Intergenic
941040020 2:160610887-160610909 TAACCTAAATGCTTTATTTACGG - Intergenic
941926624 2:170902042-170902064 TAAGCTGGAAGGTGAATTTATGG - Intergenic
944110109 2:196123055-196123077 CAACCTGTATGGTTCTTTTATGG + Intergenic
944317545 2:198299529-198299551 CAACCTGCAAGCTTTATTTATGG + Intronic
945725274 2:213466854-213466876 TAACCTGGATGGTGTACTTCAGG - Intronic
946581861 2:221137636-221137658 TAACCTTGGTGGTTCATCTAAGG - Intergenic
947333427 2:229054607-229054629 TAACCTGGAGGGGTTCTCTAGGG - Intronic
1176067569 20:63206470-63206492 GAAGCTGGATGGGTCATTTATGG - Intronic
1177590903 21:23165555-23165577 TATCCTCCATGGATTATTTAGGG + Intergenic
1178325764 21:31644300-31644322 TAAACTGGATATTTTAATTAAGG - Intergenic
1179571149 21:42279576-42279598 TGAACTGGATGGTTTCTTTAAGG + Intronic
1185359526 22:50397289-50397311 TGACCTGGATTGTTTACTCAGGG - Intronic
949538802 3:5016288-5016310 TAATCTGTCTGGTTTATTTGTGG + Intergenic
949707116 3:6831124-6831146 TAACATGGATGGTCTATGTTAGG - Intronic
950771990 3:15319265-15319287 TATCGTTGCTGGTTTATTTAAGG + Intronic
951025227 3:17821389-17821411 TAACCTTGATGGTTTGATTAAGG - Intronic
951401869 3:22242390-22242412 TAACCTTGATCGTTTGGTTAAGG - Intronic
951958520 3:28286350-28286372 TATACTGGATAGTTTATATAGGG + Intronic
953069366 3:39504033-39504055 TAATCTGGATTATTCATTTATGG - Intronic
955479235 3:59372498-59372520 TACCCTGGATGGCTTAATTTGGG - Intergenic
955490443 3:59476906-59476928 TAACCTGGTTAGTATATTTTTGG + Intergenic
957362305 3:79175122-79175144 TTAGCTGGATAGTTTATTTTAGG + Intronic
957808350 3:85182332-85182354 TAAATTGGATGATTTAGTTAAGG - Intronic
958501549 3:94916563-94916585 TATCCTGAATGTTTTACTTAGGG + Intergenic
958606276 3:96362389-96362411 TAACCTTAATCATTTATTTAAGG - Intergenic
961780526 3:129317753-129317775 GAGCCTGGATGGGTTTTTTAGGG + Intergenic
962912905 3:139871133-139871155 TAATCAGGATGCTATATTTATGG + Intergenic
963823351 3:149924164-149924186 CAAAATGGATGGTCTATTTAAGG + Intronic
964119717 3:153170142-153170164 AAACGTGGTTGGTTTATTTGTGG + Intergenic
964274457 3:154994652-154994674 CAACCTGGATGTTTTCTTTCTGG + Intergenic
964506108 3:157401481-157401503 TAGCCAGGATGTTTTATTCATGG + Intronic
964572822 3:158129003-158129025 TAACCTTGATCGTGTAGTTAAGG + Intronic
965733174 3:171793750-171793772 TAACATGAATTGTTTATTTCTGG + Intronic
965997956 3:174910238-174910260 AAATCTGGATTGTTAATTTATGG - Intronic
966096372 3:176208602-176208624 TCATCTGGATGGTTTGTTCAAGG + Intergenic
966448729 3:180033491-180033513 TAACCTAGCTGTTTTATTTCTGG - Intronic
970492739 4:16591504-16591526 TACGCTGGATGTTTTCTTTAAGG + Intronic
970922162 4:21407292-21407314 TAACCTGGATGGTTTATTTATGG - Intronic
974284715 4:59848892-59848914 TCACCTTGATGGTTAATTTTAGG - Intergenic
974436274 4:61861315-61861337 TAACCTGGGTTATTGATTTATGG + Intronic
976983988 4:91269227-91269249 TAATTTGGATGTTTTAATTAAGG + Intronic
977137181 4:93319919-93319941 CAGCCTGGATGGTTTGCTTAGGG - Intronic
981449462 4:144879654-144879676 AAAACTGCCTGGTTTATTTAGGG + Intergenic
982290427 4:153776125-153776147 TAACCATGCTGGTTTATTTAAGG - Intergenic
982967697 4:161934979-161935001 AAACCTAGATGGTTCAATTATGG + Intronic
984380002 4:178980797-178980819 TCACCTGGCTGATGTATTTAAGG + Intergenic
986431574 5:7686118-7686140 TTACATGCATGGTTTATTGAAGG + Intronic
996077443 5:119213619-119213641 TAAGCTGGGTGGTTTGTTTATGG - Intronic
996326356 5:122278983-122279005 TGTCATGGATGTTTTATTTATGG + Intergenic
998474750 5:142411123-142411145 TAACCTTGAGGTTTTATGTAAGG - Intergenic
999968853 5:156838834-156838856 TTCCCTGGATGGTTTTTTCAGGG + Intergenic
1000604081 5:163309538-163309560 TAGCAAGGATAGTTTATTTAAGG - Intergenic
1001665106 5:173426360-173426382 GAACCTGGATGGCATATTAATGG - Intergenic
1002445645 5:179288407-179288429 GATCCTGTCTGGTTTATTTATGG + Intronic
1003623035 6:7719054-7719076 TATCCTGGATGAGTTATTGAAGG - Intergenic
1005397626 6:25399427-25399449 TATCGTGGATGGTTTATGTTTGG + Intronic
1005843415 6:29759428-29759450 TAACCTCCATGTTTTATTAATGG - Intergenic
1011586397 6:88930922-88930944 TTACTTGGATGGTTTCTTTATGG - Intronic
1012352965 6:98276296-98276318 TTACATGTATGGTTTCTTTATGG - Intergenic
1014247052 6:119079899-119079921 TTTCCTGGAAGGTCTATTTAAGG - Intronic
1014602249 6:123428218-123428240 TAATCTGATTGGTTTATTTTAGG - Intronic
1015305509 6:131702240-131702262 TAAAGTGGAAGGTTTAATTAAGG + Intronic
1016810178 6:148253253-148253275 TAAACATGAGGGTTTATTTATGG - Intergenic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1018962575 6:168458924-168458946 TAACATGGAAGTTTAATTTATGG + Intronic
1020091375 7:5344183-5344205 TAGCCTGGCTGGTGCATTTAGGG + Intronic
1020984170 7:15111481-15111503 GACCCTGGAGGGTATATTTAAGG - Intergenic
1022128516 7:27380635-27380657 TATCCTGGATCATTCATTTATGG + Intergenic
1023235850 7:38085876-38085898 CAACCTGGATGGTTATTATAAGG - Intergenic
1033581295 7:142739300-142739322 GAACTTGGATAGGTTATTTAAGG + Intergenic
1033739622 7:144260471-144260493 TAAAGTGGAAGGTTTAATTAAGG + Intergenic
1035120990 7:156566842-156566864 TAAGCCTGTTGGTTTATTTAAGG - Intergenic
1037554141 8:20005464-20005486 TAACCTCGATGGTTTTCTTTTGG + Intergenic
1038273468 8:26097153-26097175 TAATCTGGCTGATTTATCTAAGG + Intergenic
1038884176 8:31645484-31645506 CAACCTGTATGGATAATTTAGGG - Intronic
1040583844 8:48720961-48720983 TAACTTGGATGCTTTATTGGGGG - Intronic
1040628427 8:49179402-49179424 TTTCATGGAAGGTTTATTTAGGG - Intergenic
1041848606 8:62360325-62360347 TAACCAGGAAGGTTTGTTAAAGG + Intronic
1041860270 8:62504868-62504890 TAACCTGGATAGCTTGTTTGAGG - Intronic
1041988514 8:63955790-63955812 TAAGCTGGCAGGTTTATTTGGGG - Intergenic
1043050864 8:75383924-75383946 TAAACAGGATGGATTTTTTAGGG - Intergenic
1043237965 8:77892766-77892788 TAATGTGGATGGTTTTTTCAAGG + Intergenic
1045752409 8:105500875-105500897 TAACCTTTATGGTCTTTTTAAGG - Intronic
1046304680 8:112349734-112349756 TAAATTGGATGATTTTTTTAAGG - Intronic
1050563403 9:6857535-6857557 TATCCTGGATGGTTCCTTTAGGG - Intronic
1052899947 9:33784922-33784944 GAACTTGGATAGATTATTTAAGG + Intronic
1057389421 9:94630332-94630354 TAATCTGGAGGGTTTTTTTCAGG - Intronic
1058812463 9:108654354-108654376 TAACCTGCATGTTTCATGTAAGG + Intergenic
1059398868 9:114056135-114056157 CAAACTTGAGGGTTTATTTAGGG + Exonic
1059568896 9:115413093-115413115 TAACCTTGATTATTTAGTTAAGG + Intergenic
1188621014 X:32223946-32223968 TGACCTGGATGGCATTTTTAAGG - Intronic
1190628307 X:52359276-52359298 AAAGCTGGATGCTTTATTGAGGG - Intergenic
1191617630 X:63186554-63186576 TAACCTCGATGGTTTAAAAATGG + Intergenic
1192423433 X:71053954-71053976 TAAGTGTGATGGTTTATTTATGG + Intergenic
1197525005 X:127549818-127549840 AAACTTGGATTGTTTATTTTGGG + Intergenic
1198941133 X:141957082-141957104 AAACATTGATGATTTATTTATGG + Intergenic