ID: 970922985

View in Genome Browser
Species Human (GRCh38)
Location 4:21416785-21416807
Sequence CTGACATATAGTCCCATGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970922985_970922988 23 Left 970922985 4:21416785-21416807 CCTATCATGGGACTATATGTCAG 0: 1
1: 0
2: 1
3: 4
4: 78
Right 970922988 4:21416831-21416853 GGGAAGAATTCCACTTGTTCAGG 0: 1
1: 0
2: 1
3: 11
4: 143
970922985_970922987 3 Left 970922985 4:21416785-21416807 CCTATCATGGGACTATATGTCAG 0: 1
1: 0
2: 1
3: 4
4: 78
Right 970922987 4:21416811-21416833 TATTTGAAAAGAATTTATTTGGG 0: 1
1: 0
2: 9
3: 202
4: 1693
970922985_970922986 2 Left 970922985 4:21416785-21416807 CCTATCATGGGACTATATGTCAG 0: 1
1: 0
2: 1
3: 4
4: 78
Right 970922986 4:21416810-21416832 ATATTTGAAAAGAATTTATTTGG 0: 1
1: 0
2: 11
3: 131
4: 1373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970922985 Original CRISPR CTGACATATAGTCCCATGAT AGG (reversed) Intronic