ID: 970922985 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:21416785-21416807 |
| Sequence | CTGACATATAGTCCCATGAT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 84 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 4, 4: 78} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 970922985_970922988 | 23 | Left | 970922985 | 4:21416785-21416807 | CCTATCATGGGACTATATGTCAG | 0: 1 1: 0 2: 1 3: 4 4: 78 |
||
| Right | 970922988 | 4:21416831-21416853 | GGGAAGAATTCCACTTGTTCAGG | 0: 1 1: 0 2: 1 3: 11 4: 143 |
||||
| 970922985_970922987 | 3 | Left | 970922985 | 4:21416785-21416807 | CCTATCATGGGACTATATGTCAG | 0: 1 1: 0 2: 1 3: 4 4: 78 |
||
| Right | 970922987 | 4:21416811-21416833 | TATTTGAAAAGAATTTATTTGGG | 0: 1 1: 0 2: 9 3: 202 4: 1693 |
||||
| 970922985_970922986 | 2 | Left | 970922985 | 4:21416785-21416807 | CCTATCATGGGACTATATGTCAG | 0: 1 1: 0 2: 1 3: 4 4: 78 |
||
| Right | 970922986 | 4:21416810-21416832 | ATATTTGAAAAGAATTTATTTGG | 0: 1 1: 0 2: 11 3: 131 4: 1373 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 970922985 | Original CRISPR | CTGACATATAGTCCCATGAT AGG (reversed) | Intronic | ||